Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx

Functional expression of olfactory receptors in yeast and
development of a bioassay for odorant screening
Jasmina Minic1, Marie-Annick Persuy1, Elodie Godel1, Josiane Aioun1, Ian Connerton2,
Roland Salesse1 and Edith Pajot-Augy1
´
1 INRA, Neurobiologie de l’Olfaction et de la Prise Alimentaire, Recepteurs et Communication Clinique, Jouy-en-Josas, France
2 Division of Food Sciences, School of Biosciences, University of Nottingham, Loughborough, Leicestershire, UK

Keywords
Golf; odorant screening; olfactory receptors;
Saccharomyces cerevisiae; yeast bioassay
Correspondence
E. Pajot-Augy, INRA, Neurobiologie de
l’Olfaction et de la Prise Alimentaire,
Domaine de Vilvert, 78352 Jouy-en-Josas
Cedex, France
Fax: +33 1 34 65 22 41
Tel: +33 1 34 65 25 63
E-mail:
(Received 13 July 2004, revised 1 October
2004, accepted 18 November 2004)
doi:10.1111/j.1742-4658.2004.04494.x

The functional expression of olfactory receptors (ORs) is a primary requirement to examine the molecular mechanisms of odorant perception and coding. Functional expression of the rat I7 OR and its trafficking to the
plasma membrane was achieved under optimized experimental conditions in
the budding yeast Saccharomyces cerevisiae. The membrane expression of
the receptor was shown by Western blotting and immunolocalization methods. Moreover, we took advantage of the functional similarities between
signal transduction cascades of G protein-coupled receptor in mammalian
cells and the pheromone response pathway in yeast to develop a novel
biosensor for odorant screening using luciferase as a functional reporter.
Yeasts were engineered to coexpress I7 OR and mammalian Ga subunit, to

compensate for the lack of endogenous Gpa1 subunit, so that stimulation
of the receptor by its ligands activates a MAP kinase signaling pathway
and induces luciferase synthesis. The sensitivity of the bioassay was significantly enhanced using mammalian Golf compared to the Ga15 subunit,
resulting in dose-dependent responses of the system. The biosensor was
probed with an array of odorants to demonstrate that the yeast-borne I7
OR retains its specificity and selectivity towards ligands. The results are
confirmed by functional expression and bioluminescence response of human
OR17-40 to its specific ligand, helional. Based on these findings, the bioassay using the luciferase reporter should be amenable to simple, rapid and
inexpensive odorant screening of hundreds of ORs to provide insight into
olfactory coding mechanisms.

The olfactory receptors (ORs) are a large group of
proteins belonging to subfamily I of G protein coupled
receptors (GPCRs) that bind odorant ligands. These
receptors are predicted to contain seven transmembrane helices that change their relative orientation
upon odorant stimulation, resulting in the conformational change of the receptor and productive interaction of its intracellular loops with Golf, the a subunit
of the heterotrimeric G protein [1–3]. Several lines of
evidence suggest that the mechanism of OR activation

by an odorant is central to understanding odorant perception and coding. Each OR recognizes multiple
odorants and most odorants are recognized by several
ORs [4–7]. One OR can discriminate between odorants
with different functional groups, molecular size or
shape and can even be sensitive to odorant concentration [8–10]. In addition, receptor perception of an
odorant can be enhanced or antagonized by the presence of another odorant [8, 11,12]. Despite the importance of OR pharmacology to olfactory detection and

Abbreviations
Endo H, endoglycosidase H; GPCR, G protein-coupled receptor; KLH, keyhole limpet hemocyanin; OR, olfactory receptor; PMSF,
phenylmethylsulfonyl fluoride; PNGase F, peptide N-glycosidase F; S14, somatostatin-14; SSTR2, somatostatin receptor subtype 2; PBST,
0.05% Tween, NaCl ⁄ Pi.

524

FEBS Journal 272 (2005) 524–537 ª 2004 FEBS


J. Minic et al.

discrimination, detailed characterization of ligand–
receptor interaction has been achieved for relatively
few ORs due to the absence of natural sources providing one receptor in sufficient amounts and to the
inherent difficulties associated with the expression of
ORs in heterologous cell systems [10].
A major hindrance to functional expression of ORs
has been the tendency of ORs to be retained in endoplasmic reticulum of heterologous cells due to inefficient
folding. This process results in receptor sequestration
through the formation of aggregates and degradation
before they can be transported to the plasma membrane
[13,14]. The failure of ORs to translocate efficiently to
the plasma membrane was also associated with the
absence of adequate accessory proteins and chaperones
in non-native cells, or with the absence of glycosylation
at the N-terminus of the OR [15]. However, ORs do
not even traffic well to the plasma membrane when
expressed in a cell line derived from olfactory epithelium (ODORA cells) that exhibits some olfactory sensory neuron characteristics [10,16,17].
Plasma membrane trafficking of ORs in commonly
cultured cell lines was slightly improved by appending
N-terminal protein sequences from other seven transmembrane domain family members. Fusion proteins
have been constructed between ORs and either the
b2-adrenergic receptor [18], the N-terminal extension of

rhodopsin [19] or the membrane import sequence of the
serotonin receptor [20]. Functional expression of mouse
71 OR was dramatically increased upon coexpression
with the b2-adrenergic receptor, but not that of rat I7
or human OR17-40 receptors [21]. This suggested that
different ORs may require distinct GPCR partners to
drive surface expression, maybe through their persistent
physical association. An alternative approach for the
functional expression of ORs utilized an adenovirus
vector to deliver OR cDNAs to the sensory neurons of
olfactory epithelia [4,8]. However, this approach has
practical limitations due to the difficulty in maintaining
olfactory neurons in primary culture, the inconsistency
of viral-mediated gene transfer, and the cost if it was to
be applied to a large number of ORs.
The aim of this study was to optimize the baker’s
yeast Saccharomyces cerevisiae as a host system for
properly expressing an OR at the plasma membrane,
and for its efficient coupling to a signaling pathway
that produces a measurable response to odorant stimulation. The yeast system was chosen for several reasons. Firstly, S. cerevisiae has been successfully used
for functional expression of many GPCRs [22–28]. Secondly, yeast constitutes an attractive system to study
membrane receptors providing a null background for
mammalian GPCRs and G proteins. Finally, yeast
FEBS Journal 272 (2005) 524–537 ª 2004 FEBS

Expression of olfactory receptors in yeast for screening

cells may provide a means for detailed investigation of
receptor pharmacology in vivo through the use of sensitive reporter systems that take advantage of the functional homologies between yeast pheromone and
mammalian GPCR signaling pathways.

In genetically modified yeast strains, the reporter
system is activated after receptor–ligand interaction,
Ga protein dissociation and activation of the MAP
kinase pathway [29]. Several GPCRs have been shown
to efficiently couple to the endogenous yeast Ga protein subunit, Gpa1. Yeast Gpa1, Ste4 and Ste18 are
structurally and functionally similar to mammalian Ga,
b and c subunits, respectively [30]. In many cases, this
functional coupling was improved by replacing Gpa1
by mammalian or chimeric Gpa1 ⁄ mammalian Ga subunits that have been shown to interact with both the
Ste4 ⁄ Ste18 complex and heterologous GPCR [31,32].
Additionally, other elements of the mating signal
transduction pheromone pathway were either deleted
or functionally replaced by their mammalian or
mutant counterparts to optimize S. cerevisiae for
GPCR structure–function investigations [22,26,29,33].
In the present study we have used the rat I7 OR as
a model to investigate the OR expression in yeast since
its preferred ligands (octanal, heptanal, nonanal) and
their effective concentration ranges have already been
determined [4,8,10,19]. We recently described how
S. cerevisiae can successfully be engineered as a reporter system for odorant detection [34]. Two different
yeast strains expressing an odorant receptor were only
able to grow on selective media following specific
odorant ligand stimulation. However, this growth
reporter had very limited sensitivity and was poorly
adapted to the transitory nature of the response. Thus,
methodological improvements were drastically needed
for this system to be ultimately used for pharmacological screening purposes. Here, we use luciferase as a
rapid reporter to study the I7 OR pharmacology. We
have optimized the experimental conditions for the

production of the I7 OR in yeast and used biochemical
and immunological methods to estimate the levels of
receptor expression and its cellular localization.

Results
Yeast transformations
Functional expression of the I7 or OR17-40 receptor
was achieved in the yeast strain MC18 modified to
allow sensitive bioassay based on synthesis of luciferase upon odorant stimulation. Strain MC18 has been
reported to have an unknown mutation that prevents
cell cycle arrest upon activation of the pheromone525


Expression of olfactory receptors in yeast for screening

Fig. 1. mRNA of the rat I7 OR or human OR17-40 receptor in transformed yeast strains. Total RNAs from either uninduced or induced
strains transformed with pJH2-I7 or pJH2-OR17-40 expression vectors were subjected to RT-PCR using specific primers to demonstrate that mRNA synthesis of the ORs occurs even in uninduced
cells. I7 cDNA in pJH2-I7 plasmid and OR17-40 cDNA in pJH2OR17-40 plasmid were amplified in parallel as positive controls.

mating signaling pathway and to lack GPA1 gene [35].
The yeast strains with the I7 expression vector, pJH2I7, or the OR17-40 expression vector, pJH2-OR17-40,
were then transformed, respectively, with either pRGPGolf or pRGP-Ga15 vectors to replace the lacking
GPA1 gene, or with PRGP-Golf. RT–PCR analysis
conducted on RNA extracted from the strains shows
mRNA bands for the ORs (Fig. 1) and the two Ga
proteins at expected sizes (data not shown). In addition, RT–PCR analysis demonstrated that mRNA of
the olfactory receptors is present in both uninduced
and induced yeast cells (Fig. 1). This indicates a leakage of GAL1 ⁄ 10 promoter in glucose-containing minimal medium. The reporter plasmid pRHF-luc was
cotransformed in the yeast strains at the same time as
the pRGP vector. It places expression of luciferase

under control of the FUS1 promoter, which is activated downstream of the MAP kinase cascade (illustrated
in Fig. 2).
Biochemical characterization of the yeast I7 OR
To examine the presence of the I7 protein in uninduced and induced yeast cells, membrane preparations
526

J. Minic et al.

Fig. 2. Modifications of yeast pheromone and signal transduction
pathway to yield agonist-induced luciferase activity. The heterologous OR receptor activated by its odorant ligand couples to an
heterotrimetric G-protein consisting of a mammalian Ga subunit
(Golf or Ga15) and the yeast bc subunit, Ste4 ⁄ Ste18. Ga dissociates
from the complex and allows Ste4 ⁄ Ste18 to activate the mating
MAP kinase cascade. This in turn induces luciferase synthesis
under the control of the FUS1 promoter, allowing quantitative readouts of the receptor–ligand interaction.

were analyzed by immunoblotting using a polyclonal
antibody raised against I7. No immunoreactivity was
detected in control membrane preparations from either
nontransformed MC18 yeast cells or cells transformed
with the initial pJH2-somatostatin receptor subtype 2
(SSTR2) plasmid (Fig. 3A). In the case of yeast cells
transformed with the pJH2-I7 expression vector two
immunoreactive bands were observed at approximately
40 and 51 kDa (Fig. 3A). The calculated molecular
weight for the I7 OR is 39 kDa, it is therefore likely
that the 40 kDa band corresponds to the receptor
monomer. The 51 kDa band may correspond to a glycosylated form of the receptor since I7 OR contains
two N-glycosylation sites, one at the N terminus and
another in the second extracellular loop.

To determine if the I7 receptor is glycosylated in
S. cerevisiae, the membrane fraction from the induced
yeast cells was digested with either endoglycosidase H
(Endo H) or peptide N-glycosidase F (PNGase F).
Figure 3B shows that the 51-kDa band is sensitive to both
Endo H and PNGase F digestion, resulting in almost
FEBS Journal 272 (2005) 524–537 ª 2004 FEBS


J. Minic et al.

Expression of olfactory receptors in yeast for screening

A

B

Fig. 3. Immunoblot analysis of the I7 OR in yeast membrane extracts. (A) Membranes were prepared from nontransformed yeast (MC18),
and transformed with either control expression vector, pJH2- SSTR2 or pJH2-I7. Each lane was loaded with 30 lg of membrane proteins.
Samples were analyzed by SDS ⁄ PAGE followed by Western blotting using anti-I7 IgG. Yeast were grown at 15 °C. (B) The glycosylation status of the I7 OR was investigated on membranes from yeast transformed with pHJ2-I7 expression vector induced with 2% galactose at
15 °C. Membrane proteins were digested with either Endo H or PGNase F. The corresponding controls were performed by using water
instead of deglycosylation enzymes in respective incubation buffer. Each lane was loaded with 10 lg of protein. Immobilized samples were
probed with anti-I7 IgG.

complete deglycosylation to yield the 40-kDa band.
The 51-kDa band thus represents the receptor monomer with the exclusive addition of mannose residues.
The presence of the immunoreactive bands in the
lanes relative to uninduced yeast cells (Fig. 3A) is a
further sign of GAL1 ⁄ 10 promoter leakage, as already
seen at the mRNA level.

Luciferase bioassay and functional expression
of the ORs in yeast
To address the functional integrity of the ORs
expressed in yeast, we developed a luciferase reporter
bioassay. Initially, the bioassay was configured using a
control yeast strain transformed to coexpress luciferase
under control of FUS1 with the SSTR2 receptor and
Gpa1. When this strain was incubated with either
a-factor to stimulate endogenous a-factor receptor
(Ste2), or with somatostatin 14 (S14) to stimulate
SSTR2 receptor, luciferase activity was observed to
increase in a dose-dependent manner (data not shown).
Thus, the bioassay provides an effective readout of
GPCR–ligand interaction and we therefore applied the
assay to monitor the I7 or OR17-40 activity.
Figure 4A summarizes differential luciferase-mediated luminescence detected in the yeast strains expressing I7 OR, grown at various conditions, following
FEBS Journal 272 (2005) 524–537 ª 2004 FEBS

their stimulation with 5 lm heptanal, octanal or nonanal. In this set of experiments the effects of yeast
growth temperature and GAL1 ⁄ 10 promoter induction
were tested in order to optimize I7 OR functional
expression. As some GPCRs were reported to fold and
traffic better to the plasma membrane when their
expression level is restricted by reduced temperatures
[36,37], we examined I7 OR activity in yeasts grown
at 30 or 15 °C. Indeed, luciferase-mediated responses
to odorants were dependent on the yeast growth temperature. The temperature shift to 15 °C markedly
improved the functional response of the receptor
(Fig. 4A).
The luciferase reporter activity was compared in

uninduced and galactose-induced conditions since a
GAL1 ⁄ 10 promoter leakage had been detected in uninduced yeasts (Figs 1 and 3A). The luciferase-mediated
luminescence responses to odorant stimulations were
increased in induced cells compared to uninduced cells
(Fig. 4A), indicating that galactose induction increases
the yield of functional I7 OR relative to the leakage
level.
Figure 4A also shows that functional responses to
odorants were several-fold higher in the strain coexpressing the Golf subunit in comparison to the strain
coexpressing the Ga15 subunit when grown in the same
conditions.
527


Expression of olfactory receptors in yeast for screening

A

J. Minic et al.

and Ga15 in membrane fractions are constant regardless of the temperature and galactose induction, while
the level of the I7 OR is higher in membrane fractions
from yeasts induced by galactose at 15 °C (Fig. 4B).
Thus, the highest level of both membrane-associated
and active I7 OR were obtained in yeast induced by
galactose at 15 °C. Therefore, we chose to perform
pharmacological analysis on the yeast coexpressing I7
and Golf under these conditions.
Pharmacological characterization of the yeast
I7 OR

B

Fig. 4. Effects of galactose induction and temperature on functional
expression of the I7 OR in yeast. (A) Luciferase bioluminescence
was measured following yeast stimulation by odorants in two
strains expressing either I7 OR and Golf, or I7 OR and Ga15. Strains
were grown in minimal media with 2% glucose (uninduced) or subsequently in minimal media with 2% galactose (induced) at 30 or
15 °C. Differential bioluminescence for each sample was calculated
with respect to controls that were prepared by replacing the odorant
by water. The data were recorded as the mean ± SEM of three separate experiments. (B) Western blot analysis of the I7 receptor, Golf
and Ga15 expression levels in the corresponding yeast membrane
lysates as in (A) (20 lg of protein per lane). Note that the highest
level of I7 receptor expression is obtained in induced strains at
15 °C while the levels of Golf and Ga15 do not change significantly.

In addition, the protein levels of I7 OR, Golf and
Ga15 in strains from Fig. 4A were compared. The
immunoblot analysis indicated that the levels of Golf
528

Previous pharmacological investigations of the I7 OR
expressed in mammalian cells have shown that receptor responses to odorants are dose dependent [10,38].
In this study, the yeast-borne I7 OR was stimulated by
heptanal, octanal or nonanal over the concentration
range from 5 · 10)14 to 5 · 10)4 m. All three ligands
evoked luciferase reporter activity in a dose-dependent
manner as presented in Fig. 5A. Response thresholds
for heptanal, octanal and nonanal were 3 · 10)9,
7 · 10)9, and 5 · 10)8 m, respectively. The maximal

amplitude was detected for 5 · 10)7 m octanal.
Interestingly, as observed with the I7 OR expression
in mammalian cells, dose–response curves of the yeast
OR I7 were bell-shaped instead of exhibiting a plateau
at high ligand concentrations. As shown in Fig. 5A no
significant response was detected for odorant concentrations 5 · 10)4 m or higher. This could be due to
odorant and ⁄ or its solvent toxicity to yeast cells or to
receptor desensitization at the highest ligand concentrations. It was checked that a final odorant concentration of 5 · 10)5 m corresponds to a concomitant
dilution of the organic solvent that is not deleterious
to the yeast cells. This was tested by cell shape examination and count after incubation in the odorant dilutions, and also by monitoring the influence of odorant
dilutions on the luciferase bioassay performed with
S14 stimulation of a control yeast strain coexpressing
SSTR2, Gpa1 and the luciferase reporter. Only final
odorant concentrations of the three aldehydes above
10)4 m were toxic for yeast cells, and this was ascribed
to the presence of the organic solvent (dimethyl sulfoxide) itself, which was deleterious for the yeast cells. So
the bioluminescence response as a function of odorant
concentration is significant up to 5 · 10)5 m. The narrow bell-shaped dose–response curves in the range
from 5 · 10)8 m to 5 · 10)5 m indeed define the operational range of the I7 receptor.
We also examined receptor specificity by testing
whether a panel of nine various odorants might be
recognized by the yeast I7 OR. Among these, octanol,
FEBS Journal 272 (2005) 524–537 ª 2004 FEBS


J. Minic et al.

Expression of olfactory receptors in yeast for screening

Fig. 5. Differential bioluminescence dose–response upon odorant stimulation of yeast-expressed olfactory receptors. Measurements were

performed on yeast transformed to coexpress the I7 OR, Golf and the luciferase reporter (A), and on yeast coexpressing the human OR1740, Golf, and the luciferase reporter (B). These strains were induced with 2% galactose at 15 °C. Dose–response curves are plotted as a difference of bioluminescence response to odorants relative to controls obtained by replacing odorants with water.

octanon and octanoic acid were selected as they possess the same carbon chain length but have different
functional groups. None of them induced any luciferase activity when tested over a wide range of concentrations (5 · 10)12 to 5 · 10)4 m).
Similarly, the commonly used odorants isoamyl-acetate, lyral, lilial, pyridine, diacetyl and cyclohexyl-acetate, tested over the same concentration range, failed to
induce any luciferase activity. These findings are consistent with those obtained with the I7 OR expressed
in mammalian cells [8,10] and strongly suggest that
yeast expressed I7 OR retains the ligand selectivity and
specificity equivalent to its mammalian expressed counterpart.
The yeast-expressed OR17-40 was stimulated with
helional in the concentration range 5 · 10)14 to
5 · 10)4 m, yielding a bioluminescence dose–response
curve shown in Fig. 5B, with a threshold concentration
of 6 · 10)8 m, and maximal amplitude for 5 · 10)6 m.
As in the case of I7 OR, this curve is bell shaped, and
finely tuned for helional concentrations between
5 · 10)5 m and 5 · 10)7 m. In order to test OR17-40
specificity, heptanal was used as a negative control [20]
over the whole range of concentrations studied (data
not shown).
Cellular localization of the I7 OR in yeast
Immunoblot analysis showed that the I7 receptor is
associated with the yeast membrane fraction. In order
to check that the I7 receptor is, at least partly, associFEBS Journal 272 (2005) 524–537 ª 2004 FEBS

ated with yeast plasma membrane, the I7-specific antibody was used to immunostain nonpermeabilized
spheroplasts. Spheroplasts of nontransformed MC18
yeast cells showed no staining with the anti-I7 IgG
(Fig. 6). In contrast, all the spheroplasts of I7 OR
yeast strain cells that had been induced with galactose

at 15 °C showed an intense cortical labeling (Fig. 6)
indicating a clear presence of the receptor at the
plasma membrane.
In order to examine the ultracellular localization of
the receptor, immunogold electron microscopy was
performed on induced I7-transformed yeast cells grown
at 15 °C (Fig. 7). The presence of the I7 OR was obvious at the plasma membrane (two to four gold particles per section) demonstrating that the I7 molecules
are targeted to their functional location (long arrows).
A few gold particles were associated with vesicular
structures located at the plasma membrane (double
arrows), consistent with the membrane trafficking of
the I7 OR molecules. In the cytoplasm, gold particles
were associated with endoplasmic reticulum cisternae
(short arrows), thus localizing the I7 OR molecules to
their secretion pathway. The receptor was also present
in vacuoles (arrowheads) and sometimes associated
with vacuole membranes (open arrowheads). No gold
grains were observed on sections where the primary or
the secondary antibody was omitted. The presence of
the gold particles associated with the plasma membrane indicates that at least some of the I7 molecules
produced are inserted at the site commensurate with
their ability to sense the external environment.
529


Expression of olfactory receptors in yeast for screening

Fig. 6. Immunofluorescence confocal microscopy of the I7 OR
in yeast. Optical (left panels) and confocal (right panels) visualization of spheroplasts from nontransformed MC18 yeast and yeast
transformed with pJH2-I7 expression vector (induced at 15 °C).

Immunolabeling was performed with the anti-I7 IgG and an
Alexa488-coupled secondary antibody on nonpermeabilized spheroplasts. Scale bar, 5 lm.

The I7 OR quantification by ELISA-type test
To quantify the level of I7 OR associated with membranes, an ELISA-type test was carried out using the
specific anti-I7 IgG. As purified I7 receptor is not available the calibration curve was generated by serial dilution of keyhole limpet hemocyanin (KLH)-coupled I7
antigenic N-terminal 15-amino acid peptides. Fig. 8A
shows this calibration curve as well as the negative control obtained by probing KLH alone. Using the KLHcoupled I7 peptide as a standard, the I7 antigen concentration in the range 1–100 lm could be measured
accurately (SD < 10%). Fig. 8B shows the ELISA
measurements collected from the serial dilution of
membrane preparations from yeast cells expressing the
I7 OR induced at 15 °C. Membrane proteins from control SSTR2-strain were included as a negative control.
Increasing amounts of membrane proteins from the
control yeast failed to elicit an ELISA signal indicating
the specificity of the reaction (Fig. 8B). In contrast, the
I7 expressing yeast produced a dose-dependent signal
that could be saturated with higher amounts of
530

J. Minic et al.

Fig. 7. Ultrastructural localization of the I7 OR in yeast. Yeast strain
transformed with pJH2-I7 expression vector and induced at 15 °C
was immuno-labeled with the primary anti-I7 IgG and 10 nm goldconjugated secondary antibody. Gold grains are present on the
plasma membrane (long arrows) and vesicles near the plasma
membrane (double arrows). They are also associated with endoplasmic reticulum cisternae (short arrows), the vacuole (arrowheads) and sometimes with vacuolar membrane (open arrows).
Bar, 0.25 lm.

membrane fraction bearing I7 OR. The concentration
of I7 receptor produced in induced yeast was deduced

to be 327 pmolỈmg)1 of membrane protein, i.e. 1.44 ·
105 receptor per cell. This compares to 352 pmolỈmg)1
of membrane protein for recombinant expression of the
a-factor receptor Ste2p itself in S. cerevisiae [25], which
is the best level ever achieved for any GPCR membrane
expression in yeast.

Discussion
In this study we developed a novel, robust and sensitive yeast-based bioassay for odorant screening. Yeast
was engineered to functionally express an olfactory
receptor in conjunction with a mammalian Ga subunit
and to exhibit agonist-dependent luciferase reporter
FEBS Journal 272 (2005) 524–537 ª 2004 FEBS


J. Minic et al.

Fig. 8. ELISA-type test for quantification of I7 expressed in yeast
cells. The ELISA test was performed by using an anti-I7 primary
antibody and a biotin-conjugated antibody plus horseradish streptavidine peroxidase to quantify the presence of I7 OR. (A) Calibration curve obtained by probing KLH-coupled I7 antigenic N-terminal
15-amino acid peptides. Uncoupled KLH was probed as a control.
(B) ELISA signal plotted as a function of increasing amount of total
proteins in membrane fractions from I7 yeast strain induced at
15 °C, and from yeast expressing SSTR2 as a control.

activity. By taking advantage of structural and functional similarities between yeast and mammalian
GPCR signaling pathways, this assay enables the
quantitative measurement of receptor activity, or alternately the detection of its ligands. Using known ligands of I7 OR (heptanal, octanal and nonanal), we
successfully demonstrated that they act as agonists as
already experienced in mammalian cells. Odorants of

the same carbon chain length but with different functional groups failed to induce any luciferase activity
demonstrating that the yeast borne receptor retains its
ligand specificity and selectivity. In addition, validation
of the system was completed by demonstrating that six
commonly used odorants do not stimulate luciferase
activity. OR17-40 also exhibited an intense and specific
FEBS Journal 272 (2005) 524–537 ª 2004 FEBS

Expression of olfactory receptors in yeast for screening

bioluminescence in response to helional stimulation.
This corroborates the adequacy of the bioassay for a
totally different olfactory receptor.
By fusing the pheromone inducible FUS1 promoter
sequence to the coding sequence of luc, the expression
of luciferase was regulated through activation of the
MAP kinase signaling pathway upon OR–odorant
interaction, to allow quantification of the dose–
response to odorants. The luciferase reporter was chosen for its sensitivity, rapidity and easy to perform
enzymatic reaction. In a previous study we used the
FUS1–His1 or FUS1–Hph reporters to provide odorant-dependent yeast growth on histidine-deficient or
hygromycin-containing medium, respectively [34]. Such
assays are commonly used for GPCRs but have low
sensitivity and are time consuming as they include a
delay of 24–48 h in response [24,34]. Therefore, they
are not best adapted to study ORs regarding the transitory nature of their response to odorants, their desensitization and recycling observed in mammalian cells
and possible degradation of odorant molecules at yeast
growth temperatures. b-galactosidase assay for GPCR
agonist screening is more rapid but requires relatively
expensive fluorogenic substrates for sensitive readout

[31]. We believe that our luciferase sensor can be at
the basis of efficient, rapid and low cost screening of a
large range of odorants.
The signal can be significantly enhanced through Ga
subunit engineering. The intense reporter activity registered demonstrates that the receptor naturally coupling
Ga protein, Golf, is able to interact efficiently with
both the heterologous OR and the endogenous Gbc
complex, Ste4 ⁄ Ste18. The efficient coupling of Golf to
the pheromone response pathway was previously demonstrated when it complemented a Gpa1 null mutation
in S. cerevisiae [35]. This is in contrast to a chimeric
Gpa1–Golf, which showed poor coupling efficiency
with either the OR and ⁄ or Ste4 ⁄ Ste18 [34]. We also
observed higher sensor sensitivity with Golf than with
the promiscuous Ga15 commonly used for pharmacological studies of recombinant ORs. This probably arises
from the poor affinity of Ga15 for yeast Gbc, as such a
lack of affinity has already been reported for
Gpa1 ⁄ Ga15,16 chimeras in S. cerevisiae [31,32].
Another aspect of this study was the optimization of
OR functional expression in S. cerevisiae. During the
last decade only a handful of mammalian ORs have
been functionally expressed in heterologous systems
due to inefficient receptor insertion into the plasma
membrane [10,13,14,17]. Here, we found that I7 OR
functional responses to odorants were notably
enhanced when yeasts were induced in galactosecontaining medium at 15 °C. The achievement of high
531


Expression of olfactory receptors in yeast for screening

I7 response to ligand stimulation was correlated to its
improved expression, since on Western blots a significant increase in receptor level was observed in the
membrane fraction. Under these conditions, neither
aggregation of possibly misfolded receptors within the
yeast, nor yeast vacuole overloading with species intended for degradation were observed by immunogold
labeling. Thus, it appears that galactose induction at
15 °C provides adequate conditions for functional
receptor expression. It remains unclear how S. cerevisiae responds to mild low temperatures and at which
stage of the folding ⁄ trafficking process the reduced
temperatures have an effect. Recently it was reported
that in S. cerevisiae a temperature downshift to 10–
18 °C leads to an induction of specific ‘cold shock proteins’, some of which are able to serve as molecular
chaperones [39]. Such proteins could be involved in the
upregulation of I7 OR functional expression observed
at 15 °C. However, other mechanisms that arise upon
lowering the temperature must also be considered. For
instance, lower temperature may positively affect the
yield of properly folded proteins [40–42]. Also, it is
interesting to note that reduced temperatures increase
the content in higher sterols within yeast cell membranes [43]. This may not only improve receptor insertion into the plasma membrane [44], but also allow
correct receptor activity [45].
The achievement of receptor plasma membrane
insertion was demonstrated by confocal immunofluorescence microscopy of nonpermeabilized spheroplasts
and by ultrastructural immunogold analysis. In addition, immunological analysis of raw and deglycosylated
samples showed that the predominant receptor form in
the membrane fraction is the mannose-glycosylated
monomer. Indeed, only high mannose elongation of
core sugars can occur in S. cerevisiae, contrary to
mammalian cells [46]. However, considering the yeast
I7 receptor discrimination between closely related ligands strongly suggests the authenticity of its ligand

binding and the maintenance of the coding ability at
the receptor level. Consequently this suggests that glycosylation of I7 OR is not a major determinant of
receptor pharmacology.
Odorant concentrations giving rise to responses in
yeast cells are several orders of magnitude higher than
those observed in COS or ODORA cells [10]. This discrepancy in the behavior of I7 and OR17-40 receptors
expressed in yeast vs. mammalian cells could be due to
differences in the lipid membrane composition and
organization between the two heterologous systems
[45]. Nevertheless, by comparing the threshold concentrations for I7 OR response to odorant stimulation, we
find that heptanal ranks first as in COS cells, where as
532

J. Minic et al.

octanal and nonanal are less potent ligands. Thus,
although higher odorant concentrations are necessary
to activate the receptor in this nonmammalian cellular
background, the receptor affinity ranking and selectivity are close to those in mammalian cells.
The yeast system was optimized for functional
expression and sensitive characterization of the olfactory receptors. It could be amenable to a rapid, inexpensive screening assay with an extended dynamic
range, in which the many orphan ORs could be investigated against the extraordinary large number of naturally occurring odorants. Although optimization is
certainly required for transfer to a high throughput
format, this method demonstrates a potential for conveniently screening a large number of organic molecules as novel GPCR ligands which could serve as
leads for drug discovery.

Experimental procedures
Odorants and other reagents
Odorant solutions were prepared just before use as described previously [10,34]. Octanal, nonanal, heptanal, diacetyl, cyclohexyl-acetate, octanol, octanon, octanoic acid,
isoamyl-acetate, pyridine were from Sigma-Aldrich (Saint

Quentin, Fallavier, France). Helional was a generous gift
from Givaudan-Roure (Dubendorf, Switzerland), courtesy
ă
of B Schilling. Lyral and lilial were kindly provided by
Roche (Meylan, France).
Complete protease inhibitor cocktail, Endo H and PNGase F were from Roche Diagnostics GmbH (Mannheim,
Germany). NaCl ⁄ Pi pH 7.4 was from Oxoid (Basingstoke,
Hampshire, England). Phenylmethylsulfonyl fluoride
(PMSF), KLH, poly(l-lysine) (Mr > 300 000), meta-periodate and Tween 20 were from Sigma-Aldrich. RQ1 RNAsefree DNAse was from Promega (Charbonnieres-les-Bains,
France). Enzymes used for molecular cloning were from
Promega and New England Biolabs (Beverly, MA, USA).
The DNA size marker was DRIgest III from Amersham
Pharmacia Biotech Europe (Orsay, France). Protein size
markers were Broad Range Prestained SDS ⁄ PAGE Standards from Bio-Rad (Marnes la Coquette, France).

Expression vectors
All plasmid manipulations were performed in E. coli strain
DH5a from Gibco BRL (Invitrogen, Cergy Pontoise,
France). After selection, a single colony was used to isolate
the plasmid for yeast transformation. The multicopy plasmid construct, pJH2-I7, for I7 receptor expression, was
obtained by homologous recombination in the pJH2SSTR2 expression vector (kindly provided by MH Pausch,
Cyanamid Agricultural Research Center, Princeton, NJ,

FEBS Journal 272 (2005) 524–537 ª 2004 FEBS


J. Minic et al.

USA) as described previously [34]. OR17-40 full-length
sequence was cloned into a pGEM-T vector, then inserted

in the pCMV-Tag3 expression vector for N-terminal c-myc
tagging using sites BamHI and XhoI of the multiple cloning
site as described previously [10]. pJH2-OR17-40 expression
vector was obtained from pJH2-SSTR2 by homologous
recombination introducing the c-myc-OR17-40 coding
sequence, using primers (5¢-CGTCAAGGAGAAAAAAC
CCCGGATCTAAAAAATGGAGCAGAAACTCATCTC
TGAAGAGGATCTG-3¢) and (5¢-GCATGCCTGCAGG
TCGACTCTAGAGGATCTCAAGCCAGTGACCGCCT
CCC-3¢), and checked for the presence and sequence of the
new insert, as in the case of pJH2-I7.
Plasmids pJH2-I7 and pJH2-OR17-40 carry a galactose
inducible GAL1 ⁄ 10 promoter. The expression vector also
contains a GAL4 gene under the control of the GAL10 promoter. The induction of the yeast, by galactose containing
media, results in overexpression of GAL4, in turn inducing
an increase of the expression of the OR gene under control
of GAL1. The pJH2 vector contains the URA3-selectable
marker.
Two Ga protein expression vectors, pRGP-Golf, or
pRGP-Ga15 were used. The pRGP-Golf vector with the
cDNA of Golf under control of Gpa1 promoter was reported by Crowe et al. [35]. The pRGP-Ga15 expression vector
was obtained by replacing Golf coding sequence by the Ga15
coding sequence. The pRGP vector contains HIS3-selectable marker. To endow the yeast strain with a reporter capacity, a pRHF-luc plasmid was constructed by replacing the
hph coding sequence from the pRHF-hph plasmid [35] by
the luciferase coding sequence. In this vector the Photinus
pyralis cDNA sequence is placed downstream the FUS1
promoter. The pRHF-luc vector contains TRP1-selectable
marker.

Yeast transformation, growth and galactose

induction
The S. cerevisiae strain MC18 (MATa gpa1::lacZ [LEU2]
ade2-1 his3-11, 15 leu2-3112 trp1-1 ura3-1 can1–100) [35]
was transformed with either pJH2-I7 or pJH2-OR17-40,
pRGP-Golf, pRHF-luc or with pJH2-I7, pRGP-Ga15,
pRHF-luc expression vectors using the lithium acetate
method [47]. Transformed cells were plated on 2% agar in
media A: yeast nitrogen base (Difco, Detroit, MI, USA),
synthetic drop-out CSM media without HIS, LEU, TRP,
URA (Bio101, Inc., Vista, CA, USA), 40 mgỈmL)1 adenine,
complemented with 2% glucose. The colonies were grown
in liquid media A complemented with 2% glucose at either
30 or 15 °C, until they reached exponential growth phase
(attenuance at 600 nm, D600, in the range 1–2). The presence of plasmids in transformed cells was verified by PCR
on nucleic acid extracts. Induction of I7 expression was performed as reported for the SSTR2 induction [24] with the
exception of the temperature. In brief, the cells were washed

FEBS Journal 272 (2005) 524–537 ª 2004 FEBS

Expression of olfactory receptors in yeast for screening

to remove glucose and cultured for 4–6 h in the selection
media containing 3% lactate, then pelleted and diluted to a
D600 0.5 and finally cultured in the selection media A containing 2% galactose at either 30 or 15 °C for about 18 or
60 h, respectively. All subsequent experiments with either
uninduced or induced yeasts were carried out with cells in
exponential growth phase (D600 in the range 1–3).

RNA extraction and RT-PCR
RNA was extracted from yeast cells following the hot acidic phenol procedure. RT-PCR was performed on DNAsetreated RNA extracts. Primers used for RT-PCR were: for

the I7 OR (5¢-CGTCAAGGAGAAAAAACCCCGGATCT
AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG
CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA
TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG
AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC
TCATCTCTGAAGAGGATCTG-3¢) and (5¢-GCATG
CCTGCAGGTCGACTCTAGAGGATCTCAAGCCAGT
GACCGCCTCCC-3¢); for Golf (5¢-GGTACCGCTGCAA
TGGGGTGTTTGGGCAAC-3¢) and (5¢-GCGGCCGCCT
CAGATCACAAGAGTTCGTACTGC-3¢); for Ga15 (5¢-AT
GGCCCGGTCCCTGACTTGG-3¢) and (5¢-TCACAGCA
GGTTGATCTCGTCC-3¢). Negative controls for the presence of remaining DNA were provided by RT-PCR with
the same primers performed on nonreverse transcribed
mRNA.

Isolation of yeast membranes
Membranes were prepared from yeast cells washed twice
with ice-cold water, harvested by centrifugation and resuspended in an equal volume of ice-cold lysis buffer (50 mm
Tris ⁄ HCl pH 7.5, 1 mm EDTA, 0.1 mm PMSF, 250 mm
sorbitol) and the Complete protease inhibitor cocktail.
Glass beads (425–600 lm, Sigma) were added and cells
were disrupted by seven cycles of 1 min of vigorous vortexing ⁄ 1 min of cooling on ice. Samples were pooled and centrifuged at 5000 g for 10 min at 4 °C to remove unbroken
cells and cell walls. The supernatant was further centrifuged
at 40 000 g for 40 min at 4 °C. This second pellet, enriched
in membranes, was resuspended in the lysis buffer with a
Dounce homogenizer, and stored in aliquots at )80 °C.
The protein concentration of the membrane preparation
was determined using the BCA reagent (Pierce, Brebieres,
France) with BSA as a standard.

Immunoblot analysis
Proteins of the membrane fraction were separated by electrophoresis on 12% SDS polyacrylamide gels and electrotransferred onto Hybond-C Extra membrane (Amersham
Pharmacia Biotech Europe). The membrane was blocked

533


Expression of olfactory receptors in yeast for screening

with 5 lgỈmL)1 polyvinyl alcohol for 1 min. This reaction
was stopped by soaking the membrane in 4.5% nonfat
dried milk in NaCl ⁄ Pi. Membranes were incubated overnight at 4 °C with rabbit anti-I7 polyclonal antibody raised
against its N-terminal 15 amino acids (custom made by
Neosystem, Strasbourg, France), rabbit anti-Golf (1 : 500,
Santa Cruz Biotechnology, Santa Cruz, CA, USA) or goat
anti-Ga16 (1 : 500, Santa Cruz Biotechnology) at 1 lgỈmL)1
in 4.5% nonfat dried milk in NaCl ⁄ Pi. After washing,
membranes were incubated for 1 h at room temperature
with either biotin conjugated anti-rabbit IgG (Sigma)
(1 : 1000) and streptavidin-horseradish peroxidase conjugate (Amersham Pharmacia Biotech Europe) (1 : 1000) or
anti-goat IgG conjugated to horseradish peroxidase
(1 : 2000) diluted in the same buffer. Blots were revealed
using the enhanced chemiluminescence (ECL) detection kit
from Amersham Pharmacia Biotech Europe.

Glycosylation studies
Deglycosylation with Endo H was performed by incubation
of 2 mgỈmL)1 membrane proteins with 0.14 mL)1 Endo H
in 40 mm sodium citrate buffer, pH 5.5, 0.5% SDS, 2 mm
PMSF for 3 h at 37 °C. Deglycosylation with PNGase F

was performed by incubation of 3 mgỈmL)1 membrane proteins with 7 mL)1 of PNGase F in NaCl ⁄ Pi pH 7.5, 0.5%
SDS, and 2 mm PMSF overnight at 37 °C. Samples were
subsequently immunoblotted as described above.

ELISA quantification of I7 expressed at yeast
membrane
Quantification of the I7 receptor expression was performed
using the I7 antibody in an ELISA calibrated against the
initial antigen comprising the N-terminal 15-amino acid
peptide, coupled with glutaraldehyde to KLH as a carrier
protein. Serial dilutions of membrane fraction of yeast
expressing the I7 OR (3.5 mgỈmL)1 total protein) or the
KLH-coupled-antigenic peptide (0–1 · 10)13 mol) were
deposited in the poly(l-lysine) (0.01%) coated wells of a
96-well plastic plate for 1 h at 37 °C. Corresponding dilutions of KLH alone, membrane fraction of nontransformed
yeast, or membrane fraction of yeast transformed with the
pJH2-SSTR2 plasmid and thus expressing the SSTR2
receptor instead of the I7 OR [24] were also deposited as
negative controls. The plates were saturated for 2 h in the
blocking buffer [3% (v ⁄ v) goat serum, 3% (w ⁄ v) BSA in
NaCl ⁄ Pi], then incubated overnight at 4 °C with the anti-I7
IgG in blocking buffer (1 : 200). After rinsing three times
with 0.05% (v ⁄ v) Tween, NaCl ⁄ Pi (PBST) and three times
with NaCl ⁄ Pi the plates were incubated for 1 h at 37 °C
with the secondary anti-rabbit biotinylated antibody
(1 : 500) and horseradish streptavidine peroxidase (1 : 500)
in blocking buffer. After extensive washing with PBST and
NaCl ⁄ Pi, 3,3¢,5,5¢-tetramethylbenzidine kit from Kirkegaard
534

J. Minic et al.

& Perry Laboratories (Gaithersburg, MD, USA) was used
to yield a colorimetric reading.

Immunodetection and confocal microscopy
Yeast cells were fixed in 1 ⁄ 10 (v ⁄ v) formaldehyde for
30 min and washed twice with 1.2 m sorbitol, 1% (v ⁄ v)
2-mercaptoethanol, 0.1 m potassium phosphate buffer,
pH 6.5. Cells were resuspended in this buffer and transformed into spheroplasts by incubating the cells with
50 mL)1 lyticase (Sigma) for 15 min at 30 °C while shaking. The spheroplasts were then washed twice with 1.2 m
sorbitol, 0.1 m potassium phosphate buffer, pH 6.5, and
deposited on 0.01% (w ⁄ v) poly(l-lysine)-coated glass slides.
Slides were treated with blocking buffer [3% (v ⁄ v) goat
serum, 3% (w ⁄ v) BSA in NaCl ⁄ Pi] for 1 h at room temperature. Each slide was then incubated with the primary
anti-I7 IgG (0.001 mgỈmL)1) diluted in the blocking buffer
overnight at 4 °C. After washing three times with 1% (w ⁄ v)
BSA, PBST, and once with 1% (w ⁄ v) BSA, NaCl ⁄ Pi, the
slides were incubated with secondary Alexa488-labelled
anti-rabbit IgG (Molecular Probes, Eugene, OR, USA)
diluted 1 : 3000 in the blocking buffer for 1 h at room temperature in the dark. After incubation, the slides were
washed three times with PBST, twice with 0.1 m NaHCO3,
0.15 m NaCl, pH 8.2, and twice with NaCl ⁄ Pi. Slides were
mounted with Vectashield antifading mounting medium
(Vector Laboratories, Inc., Burlingame, CA, USA) and
stored at 4 °C in the dark until viewed. Immunolabeled
spheroplasts were observed with a Carl Zeiss LSM 310 confocal laser scanning microscope. Images were treated using
imagej and Adobe photoshop (Adobe Systems, San Jose,
CA, USA) softwares.

Immunodetection and electron microscopy
Yeast cell fixation and embedding were carried out according to the protocol described by Sander et al. [23]. Briefly,
cells were fixed with 4% (v ⁄ v) paraformaldehyde,
2.5% (v ⁄ v) glutaraldehyde and 1% (w ⁄ v) meta-periodate in
0.1 m cacodylate buffer pH 7.3, for 3.5 h at room temperature. Afterwards, the cells were washed twice with this buffer and incubated overnight in buffered glycine (2%). The
following day, cells were postfixed in 1% OsO4 in cacodylate buffer for 1 h, washed with water, subsequently treated with aqueous 2% (w ⁄ v) uranyl acetate for 1 h and
enclosed in 2% (w ⁄ v) agar-agar. After consolidation at
4 °C and fixation in 2.5% (v ⁄ v) glutaraldehyde for 15 min,
the pellet was cut into 1 mm3 pieces. These were dehydrated in a graded ethanol series and embedded in epoxy resin
(LX112, Ladd Research Industries, Inland Europe, Conflans ⁄ Lanterne, France). Ultra-thin sections (50–100 nm)
were cut with an ultra-microtome (Ultracut, Reichert,
Vienna, Austria) and collected on nickel grids for immunogold labeling. For ultrastructural localization of the I7 OR,

FEBS Journal 272 (2005) 524–537 ª 2004 FEBS


J. Minic et al.

sections collected on nickel grids were permeabilized at
room temperature with saturated meta-periodate water
solution for 1 h, washed with water then with 0.1 m HCl
(10 min) and again with water. Free aldehydic sites were
quenched by incubation with 2% (w ⁄ v) glycine in NaCl ⁄ Pi.
Afterwards, nonspecific sites were blocked with incubating
buffer consisting of 10% (v ⁄ v) normal goat serum and
5% (v ⁄ v) BSA, 0.5% (v ⁄ v) Triton X-100 and 0.5% (v ⁄ v)
Tween 20 in NaCl ⁄ Pi for 1 h. After several washes in the
incubation buffer, sections were incubated overnight with
the anti-I7 IgG (1 : 50) in the incubation buffer in a wet
chamber at 4 °C. The sections were washed in NaCl ⁄ Pi

containing 0.1% (w ⁄ v) acetylated BSA (NaCl ⁄ Pi ⁄ BSAc,
Aurion, Wageningen, the Netherlands), and then incubated
with 10 nm gold-conjugated goat anti-rabbit F(ab¢)2 fragments (Aurion) diluted 1 : 40 in NaCl ⁄ Pi ⁄ BSAc applied
1.5 h at room temperature. After extensive washing in
NaCl ⁄ Pi ⁄ BSAc and NaCl ⁄ Pi, the antigen–antibody complex
was stabilized with 2.5% glutaraldehyde in NaCl ⁄ Pi. The
sections were then contrasted using Reynolds’ lead citrate
before observation. Controls for the immunocytochemical
reaction were carried out by replacing either the primary or
the secondary antibody by the incubation buffer in the
reaction sequence. The sections were finally viewed under a
CM12 Philips electron microscope.

Functional assay in vivo
Two million cells in 200 lL culture media were incubated
with an odorant for 60 min at room temperature to
induce the reaction scheme summarized in Fig. 1. The
yeast cells were then pelleted and resuspended in 200 lL
25 mm glycylglycin buffer (pH 7.8), 1 mm EDTA, 8 mm
MgSO4, 1% (v ⁄ v) Triton X-100, 15% (v ⁄ v) glycerol, 1 mm
dithiothreitol. Samples were homogenized for 20 s with a
Potter in an Eppendorf tube and luciferase activity was
recorded from 100 lL placed in a Lumat LB 9501 luminometer (Berthold Technologies, Bad Wildbad, Germany).
The reaction was initiated by injection of 2.2 mm luciferin
in 25 mm glycylglycin buffer (pH 7.5), 15 mm MgSO4,
5 mm ATP. In control experiments, stimulation was performed using solutions in which the odorant had been
replaced by water. Relative bioluminescence values provided by the luminometer were averaged and expressed as a
differential between the sample and its corresponding control. All experiments were performed in triplicate and the
results shown in the figures are representative of at least
two independent experiments.

Acknowledgements
We thank Dr M.H. Pausch for providing the pJH2SSTR2 plasmid, and Dr B. Schilling (Givaudan-Roure)
for the gift of helional. We also wish to warmly thank

FEBS Journal 272 (2005) 524–537 ª 2004 FEBS

Expression of olfactory receptors in yeast for screening

D. Grebert for her dedicated and skilful support and
Dr L. McCartney for critical comments on the manuscript. This work was financially supported by Institut
National de la Recherche Agronomique, the SPOTNOSED Project of the European Community (IST´
2001-38739), the Action Concertee Incitative ‘Olfactory
biosensors’ of the French Ministry of Research, and
the Ile-de-France region, in the framework of a
SESAME contract. J.M. is a postdoctoral fellow supported by a grant within the SPOT-NOSED Project.

References
1 Gether U & Kobilka BK (1998) G protein-coupled
receptors. II. Mechanism of agonist activation. J Biol
Chem 273, 17979–17982.
2 Ronnett GV & Moon C (2002) G proteins and olfactory
signal transduction. Annu Rev Physiol 64, 189–222.
3 Wess J (1997) G-protein-coupled receptors: molecular
mechanisms involved in receptor activation and selectivity of G-protein recognition. FASEB J 11, 346–354.
4 Zhao H, Ivic L, Otaki JM, Hashimoto M, Mikoshiba K
& Firestein S (1998) Functional expression of a mammalian odorant receptor. Science 279, 237–242.
5 Malnic B, Hirono J, Sato T & Buck LB (1999) Combinatorial receptor codes for odors. Cell 96, 713–723.
6 Gaillard I, Rouquier S, Pin JP, Mollard P, Richard S,
Barnabe C, Demaille J & Giorgi D (2002) A single

olfactory receptor specifically binds a set of odorant
molecules. Eur J Neurosci 15, 409–418.
7 Reed RR (2004) After the holy grail: establishing a
molecular basis for mammalian olfaction. Cell 116, 329–
336.
8 Araneda RC, Kini AD & Firestein S (2000) The molecular receptive range of an odorant receptor. Nat
Neurosci 3, 1248–1255.
9 Touhara K (2002) Odor discrimination by G proteincoupled olfactory receptors. Microsc Res Tech 58, 135–
141.
10 Levasseur G, Persuy MA, Grebert D, Remy JJ, Salesse
R & Pajot-Augy E (2003) Ligand-specific dose–response
of heterologously expressed olfactory receptors. Eur J
Biochem 270, 2905–2912.
11 Oka Y, Omura M, Kataoka H & Touhara K (2004)
Olfactory receptor antagonism between odorants.
EMBO J 23, 120–126.
12 Duchamp-Viret P, Chaput MA & Duchamp A (1999)
Odor response properties of rat olfactory receptor neurons. Science 284, 2171–2174.
13 Lu M, Echeverri F & Moyer BD (2003) Endoplasmic
reticulum retention, degradation, and aggregation of
olfactory G-protein coupled receptors. Traffic 4, 416–
433.

535


Expression of olfactory receptors in yeast for screening

14 McClintock TS & Sammeta N (2003) Trafficking prerogatives of olfactory receptors. Neuroreport 14, 1547–
1552.

15 Katada S, Tanaka M & Touhara K (2004) Structural
determinants for membrane trafficking and G protein
selectivity of a mouse olfactory receptor. J Neurochem
90, 1453–1463.
16 Murrell JR & Hunter DD (1999) An olfactory sensory
neuron line, Odora, properly targets olfactory
proteins and responds to odorants. J Neurosci 19, 8260–
8270.
17 Gimelbrant AA, Haley SL & McClintock TS (2001)
Olfactory receptor trafficking involves conserved regulatory steps. J Biol Chem 276, 7285–7290.
18 McClintock TS, Landers TM, Gimelbrant AA,
Fuller LZ, Jackson BA, Jayawickreme CK & Lerner MR
(1997) Functional expression of olfactory-adrenergic
receptor chimeras and intracellular retention of heterologously expressed olfactory receptors. Brain Res Mol Brain
Res 48, 270–278.
19 Krautwurst D, Yau KW & Reed RR (1998) Identification of ligands for olfactory receptors by functional
expression of a receptor library. Cell 95, 917–926.
20 Hatt H, Lang K & Gisselmann G (2001) Functional
expression and characterization of odorant receptors
using the Semliki Forest virus system. Biol Chem 382,
1207–1214.
21 Hague C, Uberti MA, Chen Z, Bush CF, Jones SV,
Ressler KJ, Hall RA & Minneman KP (2004) Olfactory
receptor surface expression is driven by association with
the beta2-adrenergic receptor. Proc Natl Acad Sci USA
101, 13672–13676.
22 King K, Dohlman HG, Thorner J, Caron MG &
Lefkowitz RJ (1990) Control of yeast mating signal
transduction by a mammalian beta 2-adrenergic receptor and Gs alpha subunit. Science 250, 121–123.
23 Sander P, Grunewald S, Bach M, Haase W, Reilander H

& Michel H (1994) Heterologous expression of the
human D2S dopamine receptor in protease-deficient
Saccharomyces cerevisiae strains. Eur J Biochem 226,
697–705.
24 Price LA, Kajkowski EM, Hadcock JR, Ozenberger BA
& Pausch MH (1995) Functional coupling of a mammalian somatostatin receptor to the yeast pheromone
response pathway. Mol Cell Biol 15, 6188–6195.
25 David NE, Gee M, Andersen B, Naider F, Thorner J &
Stevens RC (1997) Expression and purification of the
Saccharomyces cerevisiae alpha-factor receptor (Ste2p),
a 7-transmembrane-segment G protein-coupled receptor.
J Biol Chem 272, 15553–15561.
26 Erickson JR, Wu JJ, Goddard JG, Tigyi G, Kawanishi
K, Tomei LD & Kiefer MC (1998) Edg-2 ⁄ Vzg-1 couples
to the yeast pheromone response pathway selectively in
response to lysophosphatidic acid. J Biol Chem 273,
1506–1510.

536

J. Minic et al.

27 Erlenbach I, Kostenis E, Schmidt C, Hamdan FF,
Pausch MH & Wess J (2001) Functional expression of
M (1), M (3) and M (5) muscarinic acetylcholine receptors in yeast. J Neurochem 77, 1327–1337.
28 Miret JJ, Rakhilina L, Silverman L & Oehlen B (2002)
Functional expression of heteromeric calcitonin generelated peptide and adrenomedullin receptors in yeast.
J Biol Chem 277, 6881–6887.
29 Pausch MH (1997) G-protein-coupled receptors in Saccharomyces cerevisiae: high-throughput screening assays
for drug discovery. Trends Biotechnol 15, 487–494.

30 Dohlman HG & Thorner JW (2001) Regulation of G
protein-initiated signal transduction in yeast: paradigms
and principles. Annu Rev Biochem 70, 703–754.
31 Dowell SJ & Brown AJ (2002) Yeast assays for G-protein-coupled receptors. Recept Channels 8, 343–352.
32 Brown AJ, Dyos SL, Whiteway MS, White JH, Watson
MA, Marzioch M, Clare JJ, Cousens DJ, Paddon C,
Plumpton C, Romanos MA & Dowell SJ (2000) Functional coupling of mammalian receptors to the yeast
mating pathway using novel yeast ⁄ mammalian G protein alpha-subunit chimeras. Yeast 16, 11–22.
33 Noble B, Kallal LA, Pausch MH & Benovic JL (2003)
Development of a yeast bioassay to characterize G protein-coupled receptor kinases. Identification of an NH2terminal region essential for receptor phosphorylation.
J Biol Chem 278, 47466–47476.
34 Pajot-Augy E, Crowe M, Levasseur G, Salesse R &
Connerton I (2003) Engineered yeasts as reporter systems for odorant detection. J Recept Signal Transduct
Res 23, 155–171.
35 Crowe ML, Perry BN & Connerton IF (2000) Golf
complements a GPA1 null mutation in Saccharomyces
cerevisiae and functionally couples to the STE2 pheromone receptor. J Recept Signal Transduct Res 20, 61–73.
36 Jaquette J & Segaloff DL (1997) Temperature sensitivity
of some mutants of the lutropin ⁄ choriogonadotropin
receptor. Endocrinology 138, 85–91.
37 Hansen MK, Tams JW, Fahrenkrug J & Pedersen PA
(1999) Functional expression of rat VPAC1 receptor in
Saccharomyces cerevisiae. Receptors Channels 6,
271–281.
38 Araneda RC, Peterlin Z, Zhang X, Chesler A &
Firestein S (2004) A pharmacological profile of the aldehyde receptor repertoire in rat olfactory epithelium.
J Physiol 555, 743–756.
39 Kandror O, Bretschneider N, Kreydin E, Cavalieri D &
Goldberg AL (2004) Yeast adapt to near-freezing temperatures by STRE ⁄ Msn2,4-dependent induction of
trehalose synthesis and certain molecular chaperones.

Mol Cell 13, 771–781.
40 Arora D & Khanna N (1996) Method for increasing the
yield of properly folded recombinant human gamma
interferon from inclusion bodies. J Biotechnol 52, 127–
133.

FEBS Journal 272 (2005) 524–537 ª 2004 FEBS


J. Minic et al.

41 Mendoza JA, Rogers E, Lorimer GH & Horowitz PM
(1991) Unassisted refolding of urea unfolded rhodanese.
J Biol Chem 266, 13587–13591.
42 Tachibana H, Ohta K, Sawano H, Koumoto Y &
Segawa S (1994) Relationship between the optimal temperature for oxidative refolding and the thermal stability
of refolded state of hen lysozyme three-disulfide derivatives. Biochemistry 33, 15008–15016.
43 Gasch AP, Spellman PT, Kao CM, Carmel-Harel O,
Eisen MB, Storz G, Botstein D & Brown PO (2000)
Genomic expression programs in the response of yeast
cells to environmental changes. Mol Biol Cell 11,
4241–4257.

FEBS Journal 272 (2005) 524–537 ª 2004 FEBS

Expression of olfactory receptors in yeast for screening

44 Meijberg W & Booth PJ (2002) The activation energy for
insertion of transmembrane alpha-helices is dependent on
membrane composition. J Mol Biol 319, 839–853.

45 Lagane B, Gaibelet G, Meilhoc E, Masson JM, Cezanne
L & Lopez A (2000) Role of sterols in modulating the
human mu-opioid receptor function in Saccharomyces
cerevisiae. J Biol Chem 275, 33197–33200.
46 Kukuruzinska MA, Bergh ML & Jackson BJ (1987)
Protein glycosylation in yeast. Annu Rev Biochem 56,
915–944.
47 Schiestl RH, Manivasakam P, Woods RA & Gietz RD
(1993) Introducing DNA into yeast by transformation.
Methods 5, 79–85.

537