Báo cáo khoa học: Gene expression in response to endoplasmic reticulum stress in Arabidopsis thaliana ppt

Gene expression in response to endoplasmic reticulum
stress in Arabidopsis thaliana
Shinya Kamauchi, Hiromi Nakatani, Chiharu Nakano and Reiko Urade
Graduate School of Agriculture, Kyoto University, Uji, Japan
A nascent polypeptide synthesized on the rough
endoplasmic reticulum (ER) is translocated and
folded with the assistance of molecular chaperones
and other folding factors such as glycosylation ⁄ modi-
fication enzymes and disulfide oxidoreductases within
the ER. However, the folding of nascent polypep-
tides occasionally does not occur, resulting in the
accumulation of unfolded or misfolded proteins in
the ER (ER stress). To solve this problem, eukaryotic
cells sense ER stress and induce a set of genes called
unfolded protein response (UPR) genes. In the bud-
ding yeast Saccharomyces cerevisiae, ER transmem-
brane protein kinase ⁄ riboendonuclease Ire 1p is
activated by ER stress [1,2], and nonconventionally
splices mRNA of basic leucine zipper transcription
factor Hac 1p [3–5]. Hac 1p is translated from the
spliced mRNA and induces the UPR genes, having a
UPR cis-acting regulatory element [6–8]. On DNA
microarray analysis, 381 genes have been identified
as UPR ones induced by both tunicamycin (TM)
and dithiothreitol [9]. These comprise  6% of the
total yeast genes encoding 173 unknown proteins
and 208 proteins related to folding, glycosyla-
tion ⁄ modification, translocation, protein degradation,
Keywords
endoplasmic reticulum; fluid microarray;
gene expression; tunicamycin; unfolded

protein response
Correspondence
R. Urade, Graduate School of Agriculture,
Kyoto University, Uji, Kyoto 611-0011, Japan
Fax: +81 774 38 3758
Tel: +81 774 38 3757
E-mail:
Database
The nucleotide sequence data for soybean
SEL-1L are available in the DDBJ ⁄
EMBL ⁄ GenBank databases under accession
number AB197676.
(Received 15 March 2005, revised 11 May
2005, accepted 16 May 2005)
doi:10.1111/j.1742-4658.2005.04770.x
Eukaryotic cells respond to the accumulation of unfolded proteins in the
endoplasmic reticulum (ER). In this case, so-called unfolded protein
response (UPR) genes are induced. We determined the transcriptional
expression of Arabidopsis thaliana UPR genes by fluid microarray analysis
of tunicamycin-treated plantlets. Two hundred and fifteen up-regulated
genes and 17 down-regulated ones were identified. These genes were reana-
lyzed with functional DNA microarrays, using DNA fragments cloned
through fluid microarray analysis. Finally, 36 up-regulated and two down-
regulated genes were recognized as UPR genes. Among them, the up-regu-
lation of genes related to protein degradation (HRD1, SEL-1L ⁄ HRD3 and
DER1), regulation of translation (P58
IPK
), and apoptosis (BAX inhibitor-1)
was reconfirmed by real-time reverse transcriptase-PCR. The induction of
SEL-1L protein in an Arabidopsis membrane fraction on tunicamycin-treat-

ment was demonstrated. Phosphorylation of initiation factor-2a, which was
inhibited by P58
IPK
, was decreased in tunicamycin-treated plantlets. How-
ever, regulatory changes in translation caused by ER stress were not detec-
ted in Arabidopsis. Plant cells appeared to have a strategy for overcoming
ER stress through enhancement of protein folding activity, degradation of
unfolded proteins, and regulation of apoptosis, but not regulation of trans-
lation.
Abbreviations
AARE, amino acid response element; ATF6, activating transcription factor 6; AZC,
L-azetidine-2-carboxylic acid; BI-1, Bax inhibitor-1; eIF2a,
initiation factor-2a; Endo H, endoglycosidase H; ER, endoplasmic reticulum; ERAD, ER-associated protein degradation; ERSE, ER stress
response element; MS, Murashige and Skoog medium; PDI, protein disulfide isomerase; PKR, double stranded RNA-activated protein
kinase; P-UPRE, plant-specific UPR element; RAMP4, ribosomal-associated membrane protein 4; TM, tunicamycin; UPR, unfolded protein
response; UPRE, UPR cis-acting regulatory element; XBP-1, X-box binding factor.
FEBS Journal 272 (2005) 3461–3476 ª 2005 FEBS 3461
vesicle trafficking ⁄ transport, vacuolar protein sorting,
cell wall biogenesis, and lipid ⁄ inositol metabolism.
In comparison with those of yeast, the UPR genes
of mammalian cells are induced through a much more
complicated mechanism, which has been shown to be
triggered by at least three transcription factors, X-box
binding factor (XBP-1), activating transcription fac-
tor 6 (ATF6), and ATF4 [10]. The mammalian paralog
of yeast Ire 1p is activated by ER stress and splices
the invalid mRNA into mature mRNA encoding 371-
amino acid XBP-1 [11,12]. XBP-1 translated from the
spliced mRNA is translocated to the nucleus [13],
where it binds to its target sequence in the regulatory

regions of the P58
IPK
, ERdj4, HEDJ, EDEM, protein
disulfide isomerase (PDI)-P5, ribosomal-associated
membrane protein 4 (RAMP4), DnaJ ⁄ HSP40-like
genes, etc. [14]. ATF6 is an ER transmembrane protein
that senses ER stress through its luminal domain, and
then moves to Golgi bodies to be cleaved by site-1 and
site-2 proteases [15–17]. The cleaved ATF6 cytoplasmic
domain is released from Golgi membranes into the
nucleus, where it induces, in the presence of nuclear
factor Y, ER chaperone genes including BIP, GRP94,
Calreticulin and ORP150, which have an ER stress
response element (ERSE) in their regulatory regions
[18,19]. PERK is an interferone-induced double stran-
ded RNA-activated protein kinase (PKR)-related pro-
tein that senses ER stress through its luminal domain
and then phosphorylates initiation factor-2a (eIF2 a),
resulting in inhibition of bulk protein translation
[20,21] and stimulation of translation of ATF4 [22].
ATF4 is a basic leucine zipper transcription factor that
induces the transcription of many amino acid synthetic
enzymes and amino acid transporters by binding to
the amino acid response element (AARE) in the regu-
latory regions of these genes [23]. ATF4 has also been
shown to stimulate the transcription of CHOP, which
is important for apoptotic cell death [24].
In contrast to the UPR mechanism(s) in yeast and
animal cells, that of plant cells is not well understood.
Putative plant paralogs of yeast Ire1p have been found

in Arabidopsis thaliana and Oryza sativa [25,26]. Their
N-terminal luminal domains have each been shown to
function as a sensor for ER stress in yeast. However,
neither target mRNAs of transcription factors for
plant Ire1p nor target genes induced by this system
have been identified. On the other hand, the mRNAs
of BiP, calreticulin, calnexin and PDI have been shown
to be induced on treatment with TM and dithiothreitol
in Arabidopsis, Zea mays, Phaseolus vulgalis, Glycine
max and Nicotiana tabacum on northern analysis [27–
31]. The 21 UPR genes up-regulated by the stress
induced by both TM and dithiothreitol have been
identified among 8297 genes of the  27 000 protein-
coding genes of Arabidopsis with an Affimetrix Gene-
Chips [32].
In this paper, we present a list of the UPR genes of
Arabidopsis identified among all the protein-coding
genes. In order to increase the accuracy of the list, the
genes selected on fluid microarray analysis were reana-
lyzed by functional DNA microarray analysis. In addi-
tion to the genes related to protein folding and
degradation, genes related to protein translation and
apoptosis are also included in the list.
Results
Fluid microarray analysis of gene expression
on TM-treatment
To identify UPR genes among all the genes expressed
in Arabidopsis, we adopted the fluid microarray
method, by which target genes can be cloned from
selected fluid microarray beads. The fluid microarray

beads and probes for array analysis were prepared
using the mRNA from plantlets treated with or with-
out TM for 6 h. BiP mRNA, a representative UPR
gene, in TM-treated plantlets, was shown to increase
5.7 times compared to the level in untreated plantlets
on real-time RT-PCR analysis. For the control experi-
ment, competitive hybridization and sorting of the
beads with a cell sorter were performed on 4 · 10
4
beads with a 1 : 1 mixture of the probes, which had
been prepared from noninduced plantlets, and differen-
tially labeled with Cy5 and fluorescein. In the control
experiment, almost all of the beads after the control
hybridization were sorted in the diagonal line region,
the fluorescence intensities for fluorescein and Cy5
being the same (Fig. 1A). Based on the distribution of
beads in this experiment, we set three gates to collect
beads, i.e., for ones more heavily labeled with Cy5 (U1
and U2) and fluorescein (D). For differential gene
expression analysis, probes from TM-treated plantlets
were labeled with Cy5. Probes from nontreated plant-
lets were labeled with fluorescein. Then 4 · 10
5
beads
were hybridized with a 1 : 1 mixture of the two types
of probes. For analysis of differential gene expression,
1473 and 1703 beads were collected in fractions U1
and U2 of the up-regulated genes, and 3550 beads in
fraction D of the down-regulated genes (Figs 1B and
2A). The DNA fragments on beads in these fractions

were amplified by PCR and then sequenced. In the
up-regulated fractions, 215 genes (Table S1) were
found as clusters of clones, which were identified on
more than two beads, and 412 as singlet clones, which
were identified on single beads (Table S2). For the
Unfolded protein response genes in Arabidopsis S. Kamauchi et al.
3462 FEBS Journal 272 (2005) 3461–3476 ª 2005 FEBS
down-regulated fraction, 10% of the total beads were
analyzed to reveal 17 genes as clusters of clones
(Table 1) and 34 as singlet clones (Table S2).
Analysis with functional DNA microarrays
In order to increase the accuracy of the list of UPR
genes, we reanalyzed the genes selected on fluid micro-
array analysis with functional DNA microarrays. The
functional DNA microarrays were prepared by spot-
ting PCR fragments from the 215 up-regulated cluster
genes (Table S1) and the 17 down-regulated cluster
genes (Table 1) cloned on fluid microarray analysis.
Singlet genes were omitted from the functional DNA
microarray analysis, because the list of singlet genes
was predicted to contain missorted non-UPR genes
at a high frequency. Functional DNA microarray
analyses were performed with mRNA preparations
from plantlets treated with or without TM, dithio-
threitol or l-azetidine-2-carboxylic acid (AZC). AZC
is a proline analog that is incorporated in nascent
polypeptides instead of proline and prevents the fold-
ing of the polypeptides [33]. Induction of BiP mRNA
by dithiothreitol- or AZC-treatment (3 h or 17 h,
respectively) was confirmed to be 3.4 or 22-times

higher than that in untreated plantlets on real-time
RT-PCR analysis. To identify the up-regulated UPR
genes, it was required that candidate UPR genes
show a mean fold variation of greater than 1.2-fold
with all the treatments with TM, dithiothreitol and
AZC. In addition, from the list, we eliminated the
genes in which the degree of variation was lower
than the sum of the background variation and twice
the standard deviation. The degree of background
variation was obtained by means of a self ⁄ self hybridi-
zation experiment with Cy5 or Cy3-labeled target
DNA fragments prepared from nontreated plantlet
mRNA. Thus, the expression difference between selec-
ted genes was regarded as being significant below a
probability of error of 5%. Thirty-six genes were con-
firmed to be induced under the three different induct-
ive conditions, because these genes satisfied this
criterion (Fig. 2B and Table 2). These genes com-
prised 30 for which some functional information was
available and six for which no information was avail-
able. Among them, 27 genes were putative paralogs
that have been reported to be UPR genes in yeast
and ⁄ or mammalian cells. The functional categories
comprise protein folding (13 genes), translocation (six
genes), ER-associated protein degradation (ERAD)
(three genes; HRD1-like, SEL-1L ⁄ HRD3-like, and
DER1-like), protein glycosylation and modification
(two genes), regulation of translation (P58
IPK
) [34],

and vesicle trafficking (two genes). The induction of
HRD1-like, SEL-1L ⁄ HRD3-like, DER1-like, and
P58
IPK
mRNA was confirmed by real-time RT-PCR
analysis (Fig. 3). In addition, we found that an anti-
apoptosis protein, Bax inhibitor-1 (BI-1) [35,36], was
also included in the list of up-regulated UPR genes.
Induction of this paralog by ER stress in organisms
other than plants has not been reported. The induc-
tion of BI-1 mRNA by ER stress in Arabidopsis was
confirmed by real-time RT-PCR analysis (Fig. 3).
Furthermore, the induction (1.5-fold variation) of
Homo sapiens BI-1 by TM-treatment for 24 h was
confirmed in Hep G2 cells, a cell line derived from a
human hepatoma, by real-time RT-PCR (data not
shown).
A
B
Fig. 1. Competitive hybridization on fluid microarrays. (A) Control hybridization: 4 · 10
4
beads were hybridized with a 1 : 1 mixture of differ-
entially labeled probes from noninduced plantlets. (B) Competitive hybridization: 4 · 10
5
beads were hybridized with a 1 : 1 mixture of cDNA
probes prepared from induced (Cy5) and noninduced plantlets (fluorescein) as described under Experimental procedures. After hybridization,
beads that went to gates U1, U2 and D were collected and subjected to gene analysis as described under Experimental procedures.
S. Kamauchi et al. Unfolded protein response genes in Arabidopsis
FEBS Journal 272 (2005) 3461–3476 ª 2005 FEBS 3463
To identify the down-regulated UPR genes, we

required that candidate UPR genes show a mean fold
variation of lower than 0.8-fold with all the treatments
with TM, dithiothreitol and AZC. Two genes encoding
vegetative storage proteins, Vsp1 and Vsp2 [37,38], sat-
isfied this criterion. Vsp2-beads comprised 58% of the
beads collected and were analyzed at gate D.
Putative cis-acting regulatory element
of UPR genes
In yeast, ER stress activates Ire1p, which triggers
the nonconventional splicing of HAC1 mRNA [3–5].
Hac1p produced from the spliced mRNA induces the
transcription of UPR genes by binding to their UPR
cis-acting regulatory element (UPRE), CAGCGTG
[6–8]. In mammals, four kinds of cis-acting regulatory
elements, which respond to ER stress, are known.
Mammalian UPRE (TGACGTG-T ⁄ G) has been
shown to be the specific cis-acting regulatory element
for XBP1 and is referred to as the XBP1 binding site
[39,40]. ERSE (CCAAT-N9-CCACG) has been found
to be recognized by both ATF6 and XBP1 in vitro
[41]. ERSEII (ATTGG-N-CCACG) has also been
demonstrated to be a target of ATF6 [42]. Binding of
ATF6 to these cis-acting regulatory elements occurs in
collaboration with general transcription factor nuclear
factor-Y [43,44]. AARE (C ⁄ EBT-ATF) (TT-G ⁄
T-CATCA), which was discovered in the CHOP pro-
moter, is recognized by ATF4, translation of which is
accelerated by ER stress [24]. In plants, a plant-specific
UPR element (P-UPRE) (ATTGGTCCACGTCATC),
which contains two mammalian UPR cis-acting regula-

tory elements such as ERSEII and XBP1 binding
sequences, was found in the 5¢ upstream regions of the
BiP and calnexin genes [45]. Furthermore, complement-
ary sequences to the mammalian ERSE and XBP1
binding sequences have been found in the 5¢ upstream
regions of several genes that are induced by TM- or
dithiothreitol-treatment [32,45]. Therefore, we searched
for P-UPRE, the XBP1 binding sequence, ERSE,
AARE, or complementary sequences in the 5¢ upstream
regions (up to 1000 nucleotides) of the UPR genes. Sin-
gle or plural putative cis-acting regulatory elements
were found in the 5¢ upstream regions of 28 of the 36
up-regulated genes (Fig. 2C and Table 3). No cis-acting
regulatory element sequence was found in the 5¢
upstream regions of the two down-regulated genes.
Increase in putative SEL-1L due to ER stress
in Arabidopsis
In yeast and mammalian cells, the HRD1 ⁄ HRD3
(SEL-1L) ubiquitination system coupled to protein
degradation by 26S proteasomes is known to be
induced to remove unfolded proteins under ER stress
[9,46]. Plant paralogs of these genes have not been
identified yet. In this study, the transcriptional induc-
tion of genes homologous to mammalian HRD1 and
SEL-1L [47–49] was observed (Fig. 3). Then, HRD1-
and SEL-1L-like cDNAs were cloned with mRNA of
Fig. 2. Overview of the fluid microarray and functional microarray
analyses. (A) Gene selection by fluid microarray analysis. Gates,
U1, U2 and D were set as shown in Fig. 1B. Singlet, a gene identi-
fied on a single bead. Cluster, a gene identified on more than two

beads. (B) Analysis with functional DNA microarrays. The genes
selected in (A) were analyzed. Two hundred and thirty-two genes
(215 up-regulated cluster and 17 down-regulated cluster genes)
were spotted on functional DNA microarrays. The functional DNA
microarray analysis was carried out with target DNA fragments pre-
pared from the mRNA of control plantlets or plantlets treated with
tunicamycin (TM), dithiothreitol (DTT) or
L-azetidine-2-carboxylic acid
(AZC) as described under Experimental procedures. The numbers
are the numbers of genes that showed an expression difference
between control plantlets and plantlets treated with TM, DTT or
AZC. The numbers in the ‘Overlap’ row are the numbers of overlap-
ping up-regulated genes or down-regulated genes upon treatments
with the three reagents. (C) Venn diagram of the numbers of over-
lapping and nonoverlapping putative UPR cis-acting regulatory ele-
ments of the 36 up-regulated genes selected in (B). The numbers
in parentheses are the numbers of genes that have a cis-acting reg-
ulatory element. Bold letters are the numbers of overlapping genes.
ERSE, CCAAT-N9-(A ⁄ C)CACG; XbpI, TGACGTG(G ⁄ T); P-UPRE,
ATTGG(T ⁄ G)CCACGTCAT; AARE, TT(G ⁄ T)CATCA.
Unfolded protein response genes in Arabidopsis S. Kamauchi et al.
3464 FEBS Journal 272 (2005) 3461–3476 ª 2005 FEBS
Arabidopsis plantlets by RT-PCR. Their nucleotide
sequences coincided with those presented in the data-
base of ‘The Arabidopsis Information Resource’
( The putative amino acid
sequence of an HRD1-like protein contained an N-ter-
minal signal sequence and five membrane-spanning
regions (data not shown). The recombinant luminal
domain of the HRD1-like protein was expressed in

Escherichia coli and purified. Unfortunately, autoubiq-
uitination activity was not detected for the recombin-
ant HRD1-like protein. On the other hand, the
putative amino acid sequence of Arabidopsis SEL-1L
(At SEL-1L) contained an N-terminal signal sequence
(Met1–Glu20), two N-glycosylation consensus seq-
uences, and a membrane-spanning region (Phe623–
Arg643) near the C-terminus (data not shown). The
amino acid sequence of a soybean paralog of SEL-1L,
which was deduced from the nucleotide sequence of
cDNA cloned from young leaves by RT-PCR, was clo-
sely similar to Arabidopsis ones (data not shown).
Anti-(At SEL-1L) serum was prepared with the recom-
binant luminal domain (Phe21–Val622) of At SEL-1L,
which was expressed in E. coli and isolated. The anti-
serum only immunoreacted with a 74 kDa protein of
control plantlets on western blotting analysis (Fig. 4A).
With TM-treatment, the 74 kDa protein gradually
decreased and a 70 kDa band began to appear at 4 h
after the treatment. During the next 24 h, the 70 kDa
band significantly increased. The size of the 74 kDa
band decreased to 70 kDa on endoglycosidase H
(Endo H) digestion. On the other hand, the 70 kDa
band was insensitive to Endo H (Fig. 4B). From these
results, the 70 kDa protein was thought to be a non-
glycosylated form of At SEL-1L. On cell fractionation,
At SEL-1L was assumed to be a membrane protein, as
judging from the existence of a putative membrane
spanning region (Fig. 4C). The 70 kDa band of plant-
lets treated with TM for 24 or 48 h was denser than

the 74 kDa band of the control plantlets (Fig. 4B).
Thus, it was suggested that At SEL-1L polypeptides
were synthesized from the At SEL-1L mRNA induced
by ER stress, but that N-glycosylation of newly syn-
thesized At SEL-1L molecules was inhibited by TM.
ER stress and phosphorylation of eIF2a
In this study, we found that the mRNA of P58
IPK
was
induced by ER stress (Table 2 and Fig. 3). P58
IPK
was
first identified as an inhibitor of interferon-induced
PKR in mammalian cells [50]. The PKR family
responds to different stress signals and attenuates
translation by phosphorylating the specific serine resi-
due of eIF2a [51] to protect cells from the stress.
P58
IPK
inhibits PKR-mediated translational arrest by
inactivating the kinase by binding to the domain of
PKR family members. In mammals, ER stress also
causes translational arrest through phosphorylation
of eIF2a by PKR-like ER kinase, PERK [20,52].
Table 1. Genes recovered at gate D and functional DNA microarray analysis of them. Tunicamycin (TM), dithiothreitol (DTT) and L-azetidine-
2-carboxylic acid (AZC) values are means for six experiments. Control ratio obtained on competitive hybridization with Cy5- and Cy3-labeled
control mRNA; values are means for six experiments. SD, standard deviation; n.d., not determined.
AGI gene Description
Fluid microbead
array (number of

beads)
Functional DNA microarray (fold
variation)
U1 U2 D TM DTT AZC Control (SD)
At5g24770 Vegetative storage protein Vsp2 0 0 182 0.20 0.78 0.38 0.99 (0.04)
At5g24780 Vegetative storage protein Vsp1 0 0 12 0.19 0.79 0.12 0.98 (0.05)
At2g39330 Putative mylosinase-binding protein 0 0 15 0.36 1.10 n.d. 1.10 (0.05)
At5g50960 Nucleotide-binding protein 1 0 4 0.97 1.20 5.64 0.93 (0.08)
At3g04120 Glyceraldehyde-3-phosphate dehydrogenase C subunit 0 0 2 0.68 0.99 0.98 1.01 (0.03)
At5g64120 Peroxidase 0 0 2 n.d. n.d. 0.05 1.01 (0.03)
At4g34490 Adenylyl cyclase-associated protein CAP2 0 0 2 0.94 0.94 0.02 1.09 (0.14)
At4g37410 Cytochrome P450 0 0 2 0.28 1.03 0.84 0.94 (0.04)
At5g04140 Ferredoxin-dependent glutamate synthase 0 0 5 0.83 0.97 n.d. 3.89 (6.12)
At4g22470 Extensin-like protein 0 0 5 0.27 0.91 0.02 1.03 (0.03)
At5g47930 Ribosomal protein S27 0 0 3 1.15 0.95 0.69 1.09 (0.06)
At1g01060 Similar to DNA binding protein CCA1 0 0 2 0.24 0.82 0.01 0.89 (0.08)
At2g07671 Unknown 0 0 31 0.21 0.93 6.56 1.30 (0.15)
At4g32610 Unknown 0 0 2 0.92 0.96 0.74 1.10 (0.09)
At2g07707 Unknown 0 0 12 0.28 0.90 2.16 1.04 (0.07)
At3g02200 Unknown 0 0 4 0.99 1.00 0.32 0.93 (0.06)
At5g51190 Unknown 0 0 8 1.12 0.99 2.95 18.08 (0)
S. Kamauchi et al. Unfolded protein response genes in Arabidopsis
FEBS Journal 272 (2005) 3461–3476 ª 2005 FEBS 3465
Table 2. Genes up-regulated by ER stress. Tunicamycin (TM), dithiothreitol (DTT) and L -azetidine-2-carboxylic acid (AZC) values are means
for six experiments. Control ratio obtained on competitive hybridization with Cy5- and Cy3-labeled control mRNA; values are means for six
experiments. SD, standard deviation.
AGI gene Description
Fluid microbead
array (number of
beads) Functional DNA microarray (fold variation)

U1 U2 TM DTT AZC Control (SD)
PROTEIN FOLDING
At1g09080 BiP-like
a,b
0 2 38.24 38.35 508.73 3.13 (0.33)
At5g28540 BiP
a,b
302 91 3.81 4.06 36.22 1.14 (0.14)
At5g42420 BiP 140 26 4.12 4.09 53.67 1.21 (0.10)
At5g61790 Calnexin 1
a,b
82 12 3.42 2.63 25.26 0.27 (0)
At5g07340 Calnexin 2
a,b
0 7 2.37 2.34 10.48 0.97 (0.09)
At1g56340 Calreticulin 1 0 22 2.16 2.07 1.94 1.02 (0.15)
At1g09210 Calreticulin 2
a,b
16 44 2.43 2.02 1.51 0.95 (0.05)
At4g24190 AtHsp90-7
a,b
34 3 3.86 2.65 6.88 1.05 (0.12)
At2g47470 Similar to PDI
a
5 54 2.11 2.28 3.53 1.05 (0.19)
At1g77510 Similar to PDI 30 2 3.82 2.68 11.98 0.91 (0.07)
At2g32920 Similar to PDI
a
2 0 2.46 2.50 10.30 1.01 (0.08)
At1g04980 Similar to PDI 1 1 3.22 3.00 10.46 0.95 (0.13)

At5g58710 AtCYP20-1 (cyclophilin ROC7) 0 3 1.43 1.34 2.13 1.01 (0.08)
GLYCOSYLATION ⁄ MODIFICATION
At2g02810 UDP-glucose ⁄ UDP-galactose
transporter
a,b
2 3 3.53 2.08 21.95 0.94 (0.04)
At2g41490 UDP-GlcNac:dolichol phosphate
N-acetyl-glucosamine-1-phosphate
transferase
a
0 2 1.55 1.53 6.67 1.01 (0.09)
TRANSLOCATION
At5g50460 SEC61 gamma subunit 2 22 1.94 1.66 5.54 1.07 (0.13)
At1g29310 Similar to SEC61 alpha subunit 0 4 1.5 1.61 11.89 0.97 (0.10)
At2g34250 Similar to SEC61 alpha subunit 0 2 1.27 1.38 2.11 0.96 (0.07)
At1g27330 Similar to SERP1 ⁄ RAMP4 203 120 2.42 1.82 13.48 0.98 (0.04)
At1g27350 Similar to SERP1 ⁄ RAMP4
a,b
0 13 2.05 1.72 10.61 1.08 (0.19)
At3g51980 Similar to ER chaperone SIL 1 2 34 2.39 3.00 52.88 0.98 (0.12)
PROTEIN DEGRADATION
At1g65040 Similar to HRD1 7 11 3.36 2.33 6.48 0.99 (0.07)
At4g21810 Similar to DER1
a,b
0 7 1.67 1.59 4.23 1.09 (0.07)
At1g18260 Similar to SEL-1L ⁄ HRD3 0 3 1.54 1.54 9.16 0.96 (0.11)
TRANSLATION
At5g03160 P58
IPK
2 14 2.06 1.76 10.76 0.94 (0.11)

VESICLE TRAFFICKING
At3g07680 Similar to Emp24p 0 4 1.47 1.29 2.73 0.98 (0.05)
At4g21730 Similar to NEM-sensitive fusion protein 0 3 7.52 9.68 688.38 1.05 (0.19)
ANTI-APOPTOSIS
At5g47120 BI-1 0 2 2.30 1.73 86.70 0.99 (0.07)
UNCLASSIFIED
At2g25110 Similar to stroma cell-derived factor
a
0 3 2.14 2.08 9.17 0.93 (0.03)
At5g09410 Similar to anther ethylene-up-regulated
calmodulin-binding protein ER1
1 1 1.20 1.20 3.59 0.89 (0.05)
UNKNOWN
At5g18090 2 3 1.20 1.25 14.31 0.90 (0.06)
At1g56580 5 70 1.95 1.98 9.66 1.04 (0.02)
At5g64510 8 3 12.74 5.87 181.56 1.29 (0.32)
At5g14890 1 7 3.60 5.60 46.17 1.05 (0.05)
At3g22235 0 4 1.51 2.49 1.28 1.11 (0.09)
At1g29060 0 3 1.79 1.78 33.69 1.02 (0.07)
a
Gene identified by Martı
`
nez and Chrispeels [32].
b
Genes identified by Noh et al. [54].
Unfolded protein response genes in Arabidopsis S. Kamauchi et al.
3466 FEBS Journal 272 (2005) 3461–3476 ª 2005 FEBS
Mammalian P58
IPK
has been shown to be induced at a

later phase of ER stress [53]. Deletion of P58
IPK
has
been reported to result in an increase in phosphory-
lated eIF2a. Hence P58
IPK
is thought to function as a
feedback regulator for translational regulation in the
later phase of ER stress. The phosphorylated Ser51 of
eIF2a in plantlets was examined during ER stress by
western blot analysis (Fig. 5A). The level of phosphor-
ylated eIF2a (Ser51) in the plantlets treated with TM
was lower than that in untreated plantlets. The phos-
phorylated eIF2a increased again on removal of TM
from the medium after 6 h of treatment. However, the
protein synthesis in plantlets, which was assayed as the
incorporation of [
35
S]-labeled Met and Cys into nas-
cent proteins, was not affected by TM-treatment
(Fig. 5B).
Discussion
In this study, we tried to make a list of the UPR genes
in Arabidopsis. In total, 215 up-regulated and 17
down-regulated cluster genes were cloned from mRNA
of Arabidopsis plantlets treated with TM on fluid
microarray analysis. A functional DNA array was pre-
pared by using the cloned gene fragments, and then
used for analysis. Among the 215 up-regulated cluster
genes, only 63 showed statistically positive signals on

functional DNA array analysis, showing differences in
the expression of target mRNA of the plantlets treated
with or without TM. Because the fluid microarray
beads included a large number with highly expressed
housekeeping genes, some of them might be missorted
at the gates, which would expand the list of genes. Of
the beads collected at gates U1 and D on fluid micro-
array analysis, 89 and 87% were regarded as up-regu-
lated and down-regulated genes on functional DNA
microarray analysis, respectively. On the other hand,
38% of the beads collected at gate U2 were regarded
as up-regulated genes on functional DNA microarray
analysis. This suggests that the discrepancy between
the values obtained in the two analyses is mainly due
to the beads missorted at gate U2. However, of the
rest, the 50 genes that showed no up-regulated signal
for the plantlets treated with TM showed an up-regula-
ted signal in the plantlets treated with dithiothreitol
and ⁄ or AZC. In addition, 23 of the genes that showed
no difference in expression on DNA microarray analy-
sis between plantlets treated and untreated with TM
had putative UPR cis-acting regulatory elements in
their upstream regions. Furthermore, 27 of the 63
genes were eliminated on functional DNA microarray
analysis from the list by setting some criteria. There-
fore, the remaining 36 genes, which satisfied these
criteria, were considered to be reliable up-regulated
UPR genes. Among these 36 genes, 12 coincided with
up-regulated UPR genes previously identified on ana-
lysis with an Affimetrix GeneChips loaded with 8297

Arabidopsis probe sets [32,54]. Two down-regulated
genes, Vsp1 and Vsp2, which satisfied all the criteria,
are known to be for temporary nitrogen-storage pro-
teins [38], and are subject to regulation by sugars,
light, phosphates, nitrogen, wounding, auxins, jasmo-
nates and oxidative-stress [55]. The down-regulation of
Vsp1 and Vsp2 may result in an increase in the intra-
cellular amino acid pool, which may play an important
role in the recovery from ER stress. In mammalian
cells, ER stress affects cellular amino acid metabolism
via the PERK ⁄ ATF4-mediated signaling pathway,
which induces some amino acid synthesis- and trans-
port-related genes [23]. No putative UPR cis-acting
regulatory element was found in the 5¢ upstream
regions of Arabidopsis Vsp1 and Vsp2. Therefore, it is
not clear whether these genes are directly regulated by
the UPR system or down-regulated by a metabolic dis-
order caused by ER stress.
Thirteen genes, which encode six protein families
responsible for protein folding, are included in the
UPR gene list. Among them, BiP (three genes), calnex-
in (two genes), calreticulin (two genes), and AtHSP 90-
7 (one gene) have been shown to be induced by ER
stress on northern blotting [25,54]. Four genes enco-
ding PDI families are also included in the list. PDI
and its family members are characterized by the pres-
Fig. 3. Confirmation of transcriptional induction of six genes by
real-time RT-PCR analysis. The amounts of actin, BiP, HRD1, SEL-
1L, DER1, p58
IPK

and BI-1 mRNAs in total RNA from Arabidopsis
plantlets treated with TM (black bars), DTT (hatched bars), or AZC
(white bars) for 2 h were determined by real-time RT-PCR as des-
cribed under Experimental procedures. The value for each mRNA
was standardized to the value for actin mRNA in the corresponding
total RNA preparation. Fold expression change was calculated as
the ratio of mRNA in the plantlets treated and untreated with a
stress reagent. Each value represents the mean for two experi-
ments.
S. Kamauchi et al. Unfolded protein response genes in Arabidopsis
FEBS Journal 272 (2005) 3461–3476 ª 2005 FEBS 3467
Table 3. Putative cis-acting regulatory elements of genes up-regulated by ER stress. Position designated from the 5¢ terminus of the ATG
initiation codon. Lowercase letters in sequences correspond to N9 in ERSE-like sequence CCAAT-N9-(A/C) CACG.
AGI gene Description
cis-Acting regulatory element
Motif-like Position
At1g09080 BiP-like ERSE-like CGTGTcaagaagtgATTGG(142–124)
ERSE-like CGTGTctgcttgtgATTGG(220–202)
At5g28540 BiP P-UPRE ATTGGTCCACGTCAT(168–154)
At5g42420 BiP Xbp1 binding-like CCACGTCA(187–180)
P-UPRE ATTGGACCACGTCAT(193–179)
At5g61790 Calnexin 1 ERSE-like CGTGGcctgttatgATTGG(237–219)
Xbp1 binding-like TGACGTGG(240–233)
At5g07340 Calnexin 2 P-UPRE ATTGGGCCCAGGTCA(290–274)
At1g56340 Calreticulin 1 ERSE-like CGTGTatttaactaATTGG(147–129)
At1g09210 Calreticulin 2 ERSE-like CGTGTcggttacctACCGG(178–160)
At4g24190 AtHsp90-7 ERSE-like CCAATacaaaactaCCACG(229–211)
Xbp1 binding-like CCACGTCA(253–246)
At2g47470 Similar to PDI Xbp1 binding-like CCACGTCA(139–132)
At1g77510 Similar to PDI ERSE-like CCAATgaaaactctCCACG(158–140)

At2g32920 Similar to PDI –
At1g04980 Similar to PDI ERSE-like CGTGTgacaatatcATTGG(128–110)
Xbp1 binding-like TGACGTGT(131–124)
At5g58710 AtCYP20-1 (cyclophilin ROC7) Xbp1 binding-like TGACGTGG(83–76)
ERSE-like CCAATtacaattgtACACG(134–116)
At2g02810 Similar to UDP-glucose ⁄ UDP-galactose transporter –
At2g41490 UDP-GlcNac:dolichol phosphate N-acetylglucosamine-
1-phosphate transferase ERSE-like CGTGGcaaatccttATTGG(128–110)
–
At5g50460 SEC61 gamma subunit Xbp1 binding-like TGACGTGT(171–164)
Xbp1 binding-like TGACGTGT(322–315)
At1g29310 Similar to SEC61 alpha subunit ERSE-like CGTGTatccgtattATTGG(439–420)
At2g34250 Similar to SEC61 alpha subunit –
At1g27330 Similar to SERP1 ⁄ RAMP4 ERSE-like CCAATcactgaccgCCACG(223–205)
At1g27350 Similar to SERP1 ⁄ RAMP4 ERSE-like CCAATtatagacggCCACG(269–251)
At3g51980 Similar to ER chaperone SIL 1 Xbp1 binding-like TGACGTGT(149–142)
ERSE-like CGTGTaataatataATTGG(146–128)
At1g65040 Similar to HRD1 ERSE-like CGTGTcgttatatcATTGG(338–320)
At4g21810 Similar to DER1 –
At1g18260 Similar to SEL-1L ⁄ HRD3 ERSE-like CGTGGccggttactATTGG(176–158)
At5g03160 P58
IPK
ERSE-like CGTGGgtcataacgATTGG(244–226)
ERSE-like CGTGTttaattatcATTGG(304–286)
At3g07680 Similar to Emp24p ERSE-like CCAATgatataacgCCACG(437–419)
Xbp1 binding-like TGACGTGG(477–470)
Xbp1 binding-like ACACGTCA(609–602)
At4g21730 Similar to NEM-sensitive fusion protein –
At5g47120 BI-1 ERSE-like CGTGGatgattcttATTGG(298–280)
At2g25110 Similar to stroma cell-derived factor –

At5g09410 Similar to anther ethylene-up-regulated calmodulin-
binding protein ER1 ERSE-like CGTGTcggaggtttATTGG(271–253)
Xbp1 binding-like TGACGTGG(396–389)
At5g18090 Unknown AARE-like TTTCATCA(154–161)
At1g56580 Unknown AARE-like TTTCATCA(271–278)
At5g64510 Unknown –
At5g14890 Unknown –
At3g22235 Unknown –
At1g29060 Unknown ERSE-like CCAATattaaaacgCCACG(233–215)
Unfolded protein response genes in Arabidopsis S. Kamauchi et al.
3468 FEBS Journal 272 (2005) 3461–3476 ª 2005 FEBS
ence of one or two thioredoxin homologous motifs per
molecule. Yeast and mammalian PDIs are known as
multifunctional folding catalysts and molecular chaper-
ones, which catalyze the formation and rearrangement
of disulfide bonds between correct pairs of cysteine
residues in nascent polypeptide chains in the ER [56].
Mammalian PDI functions not only as a catalytic
enzyme but also as a subunit of microsome triacylglyc-
erol transfer protein [57] and prolylhydroxylase [58].
Mammalian PDI family ER-60 ⁄ ERp57, which also
exhibits protein oxidoreductase activity, interacts and
cooperates with calnexin or calreticulin for oxidative
folding of N-glycosylated proteins [59–61]. The genes
of these PDI families are UPR genes [41]. In the Ara-
bidopsis genome, 13 genes encoding putative PDI-rela-
ted proteins, i.e. At1g04980 (NP 171990), At1g07960
(NP172274), At1g15020 (NP 172955), At1g35620 (NP
564462), At1g21750 (NP 173594), At1g52260
(NP 175636), At1g77510 (NP 177875), At2g01270 (NP

565258), At2g32920 (NP 180851), At2g47470
(NP182269), At3g54960 (NP 191056), At3g16110 (NP
188232), and At5g60640 (NP 568926), were found.
Identification and characterization of these PDI family
proteins were not carried out. However, they were sup-
posed to play important roles in protein folding, as
four PDI-related genes among the above 13 genes were
confirmed to be induced by ER stress. A gene enco-
ding cyclophilin family protein ATCYP20-1 was identi-
fied as a UPR gene. Twenty-nine genes encoding
cyclophilin family members were found in the Arabi-
dopsis genome [62]. Among them, five gene products
are assumed to be targeted to the ER lumen with
N-terminal signal peptides. Among them, ATCYP20-1
has the amino acid sequence RFWH, which is an
essential sequence for peptidyl prolyl cis, trans iso-
merase activity. Hence, it is suggested that ATCYP20-1
may participate in the folding of proteins in the ER.
The genes of six translocation-related proteins were
found to be induced. In mammalian cells and yeast,
translocon subunit proteins are thought to be induced
to enhance retrotranslocation of unfolded proteins
from the ER to the cytosol [63]. The retrotranslocated
proteins are degraded by 26S proteasomes. Recently,
in tobacco, a GFP-fusion protein containing the P
region of calreticulin, which is a model of a misfolded
A
B
C
Fig. 4. Increase in At SEL-1L in the membranes of Arabidopsis

plantlets on TM-treatment. (A) Plantlets were incubated in the pres-
ence (lanes 7–12) or absence of TM (lanes 1–6) for the indicated
times. Proteins were extracted and then subjected to SDS ⁄ PAGE.
At SEL-1L was stained by western blotting with antiserum as des-
cribed under Experimental procedures. (B) Plantlets were incubated
in the presence (lanes 3 and 4) or absence of TM (lanes 1 and 2)
for 48 h. Proteins were extracted, digested with (lanes 2 and 4) or
without (lanes 1 and 3) Endo H, and then subjected to SDS ⁄ PAGE.
At SEL-1L was stained by western blotting with antiserum as des-
cribed under Experimental procedures. (C) The total (lane 1), super-
natant (lane 2), and membrane (lane 3) fractions obtained from the
plantlets treated with TM for 48 h on centrifugation at 100 000 g
were subjected to SDS ⁄ PAGE, and At SEL-1L was stained by
western blotting with antiserum as described under Experimental
procedures.
A
B
Fig. 5. Effect of TM-treatment on phosphorylation of eIF2a. Plant-
lets were incubated in the medium with TM for 6 h (lane 2), 7 h
(lane 3), or 9 h (lane 4), or without TM for 9 h (lane 1) as described
under Experimental procedures. In other experiments, plantlets
were incubated in the medium with TM for 6 h and then incubated
in the medium without TM for an additional 1 h (lane 5) or 2 h (lane
6). (A) After the incubation, the proteins were extracted from the
plantlets and subjected to SDS ⁄ PAGE. Phosphorylated Ser51 of
eIF2a was determined by western blot analysis as described under
Experimental procedures. (B) After the incubation, proteins of the
plantlets were metabolically labeled with [
35
S]Met and [

35
S]Cys for
20 min at 25 °C. Then, the proteins were extracted and subjected
to SDS ⁄ PAGE. Labeled proteins were determined by fluorography
as described under Experimental procedures.
S. Kamauchi et al. Unfolded protein response genes in Arabidopsis
FEBS Journal 272 (2005) 3461–3476 ª 2005 FEBS 3469
protein in the ER, was shown to be retrotranslocated
to the cytosol, ubiquitinated, and then degraded [64].
The induction of translocon subunits by ER stress in
Arabidopsis suggests that an ERAD system similar to
those of yeast or mammalian cells may remove mis-
folded proteins produced in the ER of plant cells. This
is supported by our finding that the genes encoding
putative plant DER1, HRD1 and SEL-1L ⁄ HRD3 were
also induced by ER stress. DER1 is a hydrophobic
protein that is localized to the ER. In yeast, deletion
of DER1 prevents degradation of unfolded proteins,
suggesting that the function of DER1 may be specific-
ally required for ERAD [65]. Yeast HRD1 is an ER-
membrane-anchored ubiquitin ligase, which is required
for the degradation and ubiquitination of several
ERAD substrates, and is associated with relevant
ubiquitin-conjugating enzymes [46]. At HRD1, which
has the same nucleotide sequence as that registered in
‘The Arabidopsis Information Resource’, was cloned
by RT-PCR with mRNA from Arabidopsis. Six trans-
membrane regions and a RING-H2 domain of Arabi-
dopsis HRD1 (At HRD1) showed high sequence
homology with those of yeast and human HRD1s.

Unfortunately, it is unclear whether or not At HRD1
functions as an ubiquitin ligase, as the cytosolic
domain of At HRD1, which was expressed in E. coli
and isolated, showed no self-ubiquitination activity
with an in vitro assay system involving commercial
human E1 and yeast E2 (UbCH5c). Yeast HRD3 is an
ER-resident glycoprotein with a single span near the
C-terminus, which stabilizes HRD1 and regulates the
cytosolic HRD1 RING-H2 domain through interac-
tion with the HRD1 transmembrane domain [66]. We
showed that At SEL-1L was a membrane-anchored
glycoprotein and that it increased under ER stress. In
order to clarify the details of the mechanism of plant
ERAD, functional characterization of these proteins
must be performed.
In mammalian cells, ER stress responses are com-
posed of three steps, i.e., enhancement of the refolding
and degradation of unfolded proteins, attenuation of
translation [20,21], and apoptosis [24]. ER stress has
not been found to cause attenuation of translation in
plants. In this study, we found that the P58
IPK
gene
was up-regulated by ER stress. Mammalian P58
IPK
is
induced at a later phase of ER stress and inhibits
PKR-mediated translational arrest by binding to the
kinase domain of the PKR family [53]. However, bulk
protein translation of Arabidopsis was not affected by

ER stress, even though the phosphorylation of eIF2a
(Ser51) was partially inhibited by ER stress. The phos-
phorylation of eIF2a (Ser51) increases the translational
efficiency of yeast GCN4 mRNA and mammalian
ATF4 mRNA, which have four and two upstream
open reading frames in the 5¢ noncoding portion,
respectively [67,68]. Induction of Arabidopsis P58
IPK
followed by a decrease in the phosphorylation of
eIF2a (Ser51) may increase the translational efficiency
for unidentified gene(s).
It is unclear whether apoptosis may function as a
UPR in plants, although inhibition of ER-type IIA
Ca
2+
-pumps has been reported to induce ER stress
and apoptosis in soybean cells [69]. In this study, we
identified apoptosis-related gene BI-1 as a UPR gene.
BI-1 is an evolutionarily conserved integral membrane
protein localized in the ER [35,36]. In mammalian
cells, BI-1 affords protection from apoptosis induced
by ER stress by inhibiting BAX activation and translo-
cation to mitochondria, by preserving the mitochond-
rial membrane potential, and by suppressing caspase
activation [70]. BAX and Bcl2, and their relatives were
not found in plants. However, in rice and barley, BI-1
has been shown to suppress fungal elicitor-induced
apoptosis [71,72].
Experimental procedures
Plant materials and treatments

Sterile seeds of Arabidopsis thaliana (Columbia) were germi-
nated in 0.5· Murashige and Skoog medium [73] containing
1% (w ⁄ v) sucrose (MS), and cultured for two weeks. To
prepare a cDNA tagged library and probes for transcrip-
tome analysis with fluid microarrays or functional DNA
microarrays, whole plantlets were treated by immersing
their roots in MS containing 5 lgÆ mL
)1
TM, 1 mm dithio-
threitol or 50 mm AZC for the indicated times. For the
control experiment, plantlets were treated with MS without
stress reagents. For relative quantification of mRNA by
real-time RT-PCR, and pulse-labeling experiments with
[
35
S]Met and [
35
S]Cys, the upper parts of plants were cut
off from their roots and immersed in MS with a stress rea-
gent.
Real-time RT-PCR analysis
Total RNA was isolated with an RNeasy Plant Mini kit
(Qiagen, Valencia, CA) from plant tissues treated with or
without TM for 6 h. Relative quantification of mRNA was
carried out by the real-time RT-PCR method with an ABI
PRISM 7000 Sequence Detection System (Applied Biosys-
tems, Foster City, CA). Forward primers, 5¢-AAGTCGT
TGCACCTCCTGAGA-3¢,5¢-TCAAGGACGCTGTTGT
CACTGT-3¢,5¢-ACACGGCAAATAACGTTCATCTCTA-
3¢,5¢-GGACTGCTTTCATCTGGCTTGT-3¢,5¢-TCTCT

GTTGGGTTTATCTCTTTGGTT-3¢,5¢-TGATGGAAGA
AGCAGTGGATGA-3¢ and 5¢-CGTAGAAGAGTGGTA
Unfolded protein response genes in Arabidopsis S. Kamauchi et al.
3470 FEBS Journal 272 (2005) 3461–3476 ª 2005 FEBS
CAAGCAGATG-3¢, were used for detection of the
mRNAs of actin, BiP, P58
IPK
, BI-1, At HRD1, At SEL-1L
or Arabidopsis DER1 (At DER1), respectively.
Reverse primers, 5¢-ATCGACGGGCCTGACTCAT-3¢,
5¢-CAACATTGAGCCCAGCAATAAC-3¢,5¢-CAGCTAT
TTAAGCCGTCTTTTCCA-3¢,5¢-GATAGATGCAGAGC
CACCAAAGA-3¢,5¢-CGGACATGAGAGAGCAAAGT
CA-3¢,5¢-CAGCTGCAAATTATGGTGAAG-3¢ and 5¢-
ACCCGACGGTGGTGACTACA-3¢, were used for detec-
tion of the mRNAs of actin, BiP, P58
IPK
, BI-1, At HRD1,
At SEL-1L and At DER1, respectively.
TaqMan probes (Applied Biosystems), 5¢-VIC-CAG
TACCTTCCAGCAGATGTGGATCGC-TAMRA-3¢,5¢-
FAM-CCAGCTTACTTACTTCAATGATGCTCAAAGG
C-TAMRA-3¢,5¢-FAM-CTATGCAAGGTCTCAGTCAG
GCTCGGC-TAMRA-3¢,5¢-FAM-ATGCTAATGTGGC
TCCAGTTTGCCTCT-TAMRA-3¢,5¢-FAM-TCCACTCT
CTTTTGAGCCATCCAATGC-TAMRA-3¢,5¢-FAM-AA
CGACTTGCTTTTGCTCTTCTCTCGC-TAMRA-3¢ and
5¢-FAM-ATTATAACCCGGTCGTATCTCACGGC-TAM
RA-3¢, were used for detection of the mRNAs of actin,
BiP, P58

IPK
, BI-1, At HRD1, At SEL-1L and At DER1,
respectively.
Preparation of fluid microarrays
A cDNA tagged library was constructed according to Bren-
ner’s method [74]. In brief, mRNA was extracted from
plant tissues, except roots, treated with or without TM for
6 h. A total of 2.5 lg of mRNA from plants treated with
or without TM was combined and converted to cDNA with
a5¢-biotin-conjugated anchored (dT19) primer containing a
BsmBI restriction sequence as a primer and a dNTP mix-
ture containing 5-methyl dCTP as a substrate. The DNA
fragments were digested with DpnII and BsmBI, and then
ligated into a tag vector (tag library plasmid) (Takara Bio
Co. Ltd, Kyoto, Japan).
DNA fragments for loading onto antitag microbeads
were prepared by PCR using the tagged library as a tem-
plate and a 6-carboxyl-fluorescein-labeled reverse primer
(BD Biosciences Clontech, Palo Alto, CA). The DNA frag-
ments were digested with PacI and then treated with T4
DNA polymerase in the presence of dGTP to expose the
tags as single strands. The DNA fragments were loaded
onto antitag microbeads. Microbeads combined with cDNA
were selected with a cell sorter, MoFlo
TM
(DacoCytoma-
tion, Glostrup, Denmark), and then treated with T4 DNA
polymerase and T4 DNA ligase to fill the gap between the
cDNA and the tag. 6-Carboxyl-fluorescein was removed by
DpnII digestion. Then the antisense strand of cDNA on the

microbeads was labeled by ligation with an adaptor carry-
ing 3¢-6-carboxyl-fluorescein and removed by treatment with
150 mm NaOH. The microbeads that carried antisense
strands were removed from the microbeads that carried
sense strands using the cell sorter.
Fluid microarray analysis
For analysis of differentially expressed mRNA in Arabidopsis
treated with or without TM, fluid microarray analysis was
performed. Probes for competitive hybridization on the fluid
microrrays were prepared from the same mRNA sources as
those used for the preparation of the cDNA tagged library.
In brief, mRNA was converted to cDNA using a flanking
oligo dT primer carrying a T7 promoter sequence for first
strand synthesis. The probes were synthesized from cDNA
derived from control or TM-treated plantlets by T7 RNA
polymerase reaction in the presence of fluorescein-UTP or
Cy5-UTP. A mixture of probes was then hybridized with a
mixture of 4 · 10
5
fluid microarray beads prepared from the
control or TM-treated plantlets at 50 °C overnight. Labeled
fluid microarray beads were washed in 1· NaCl ⁄ Cit (0.15 m
NaCl, 0.015 m sodium citrate, pH 7) ⁄ 0.1% (w ⁄ v) SDS and
0.1· NaCl ⁄ Cit ⁄ 0.1% (w ⁄ v) SDS at 65 °C for 15 min [75].
The distribution of microbeads in Fig. 1A allowed us to set
gates for collecting microbeads that were more heavily labe-
led with Cy5 or fluorscein (Fig. 1B). The polygons in Fig. 1B
represent the gates at which microbeads carrying up-regula-
ted or down-regulated clones (D) were collected. The up-
regulated clone fraction was further separated at two gates

(U1 and U2) to divide the beads fraction into two. DNA
fragments on the sorted beads were amplified by PCR, sub-
cloned into pT7Blue-2 (Novagen, Darmstadt, Germany),
and then sequenced by the Dye Terminator method.
Sequences of more than 300 nucleotides were adopted as use-
ful data from the sequence data obtained. Filtering of
sequence data and trimming of the vector sequence were car-
ried out with the Paracel Filtering Package (Paracel, Inc.,
Pasadena, CA). The obtained sequence was searched for the
sequence data in ‘The Arabidopsis Information Resource’
( Then, clustering of
the sequence was performed with the Paracel Clustering
Package (Paracel, Inc.).
Functional DNA microarray analysis
Functional DNA microarrays were prepared by spotting
the PCR fragments derived from the genes selected as up-
or down-regulated genes on fluid microarray analysis. The
PCR fragments were amplified using the cDNA fragments
subcloned into pT7Blue-2 as a template. Each fragment
was spotted at two sites on a slide glass. Target DNA frag-
ments were synthesized by in vitro reverse transcription
reaction using Cy3-dUTP or Cy5-dUTP from 1.5 lgof
mRNA of control plantlets or plantlets treated with TM,
dithiothreitol or AZC for 6 h, 3 h or 17 h. The labeled tar-
gets were hybridized to a functional DNA microarray in
6· NaCl ⁄ Cit ⁄ 0.2% (w ⁄ v) SDS ⁄ 5· Denhardt’s solution ⁄
carrier DNA at 65 °C for 14 h [75], and then washed in
1.2· NaCl ⁄ Cit ⁄ 0.2% (w ⁄ v) SDS, 2.2· NaCl ⁄ Cit ⁄ 0.2%
(w ⁄ v) SDS and then 3.2· NaCl ⁄ Cit ⁄ 0.2% (w ⁄ v) SDS at
S. Kamauchi et al. Unfolded protein response genes in Arabidopsis

FEBS Journal 272 (2005) 3461–3476 ª 2005 FEBS 3471
55 °C for 5 min. The functional DNA microarray was rin-
sed once with 0.05 · NaCl ⁄ Cit. The fluorescence was
scanned with a GeneChipÒ Scanner 428 (Affymetrix, Inc.,
Santa Clara, CA). The same experiments were carried out
using three functional DNA microarrays. The data were
analysed using BioDiscovery imagene Ver. 4.2 (BioDiscov-
ery, El Segundo, CA). The mean Cy5 : Cy3 ratio values
were calculated as the Cy5 value divided by both the
correction value and the raw Cy3 value. Calculation of the
correction value was carried out as described below:
(a) Spots were selected according to the following criteria:
[signal mean] ) [background mean] more than 60 000, and
[signal mean] more than [background mean] + 2 · [back-
ground standard deviation (SD)]; (b) Log (Cy5 : Cy3) of the
spots selected in (a) was calculated; (c) Mean value I SD of
(b) was calculated; (d) Spots were selected according to the
following criteria: Log (Cy5 : Cy3) ranged within the mean
values I SD obtained in (c); (e) Mean Log (Cy5 : Cy3) of
the spots selected in (d) was calculated; (f) Mean Log
(Cy5 : Cy3) in (e) was converted to a natural value, which
corresponds to the correction value.
Control experiments (self ⁄ self hybridization) to obtain a
spot-specific background Cy5 : Cy3 ratio for judgment of
significant differences in the Cy5 : Cy3 ratio were carried
out. Target DNA fragments were synthesized using
Cy3-dUTP or Cy5-dUTP from the mRNA of control plant-
lets, and then hybridized competitively to a functional
DNA microarray under the same conditions as for the
comparative experiments. Mean control Cy5 : Cy3 ratios

and their SD were calculated from the six values obtained
in triplicate control experiments on two spots on functional
DNA microarray assays. Most of the background
[Cy5 : Cy3 I SD] values were in the range of 1.2–0.8.
Hence, it was judged as a significant difference when the
Cy5 : Cy3 ratio was more than 1.2 and also more than
[background Cy5 : Cy3 ratio + 2 · SD], or less than 0.8
and also less than [background mean] + 2 · [background
standard deviation (SD)].
Construction of an expression vector for the
putative luminal domain of At SEL-1L
The cDNA encoding At SEL-1L was cloned by RT-PCR
with a forward primer, 5¢-ACGTCGCTGCAGCGATCT
GATCACTGAGAAAC-3¢, and a reverse primer, 5¢-AAA
GCCGGTACCCTCTGCTATTACAATGACGAAAACGAT
TATC-3¢, using mRNA from Arabidopsis plantlets treated
with TM for 6 h. The obtained fragments were digested
with PstI and KpnI, and then cloned into pBluescript
(Stratagene, La Jolla, CA) digested with PstI and KpnI.
The insert in the vector was sequenced by the fluorescence
dideoxy chain termination method (Applied Biosystems).
An expression vector for the putative luminal domain of At
SEL-1L, which corresponds to residues 21–621, was con-
structed as described below. For cloning into an expression
vector, two kinds of DNA fragments were amplified by
PCR with two sets of primers. One set comprised a forward
primer as the DNA sequence encoding the N-terminus of
the luminal domain of At SEL-1L containing an NdeI
restriction site, 5¢-ACGTCTGACATATGTTTGGCGT
TCACGCTCGTCCC-3¢, and a reverse primer correspond-

ing to the sequence containing a XhoI restriction site in
At SEL-1L, 5¢-AAATCTTCATCCTCCTCGCCTCGAG-3¢.
The other set comprised a forward primer corresponding to
the sequence containing a XhoI restriction site in At SEL-
1L, 5¢-AAAGGTGCTCTAAGGAAATCTCGAG-3¢, and a
reversed primer as the DNA sequence encoding the C-ter-
minus of the luminal domain of At SEL-1L containing a
XhoI restriction site, GTGGTGCTCGAGCACCACATT
CTCTATCCAAGTCTC-3¢. The former or latter PCR frag-
ments produced were digested with NdeI and XhoI, or
XhoI, respectively, and then cloned into pET-30Xa ⁄ LIC
digested with NdeI and XhoI. Expression vector pET-30 ⁄
At SEL-1L allows the fusion of the histidine tag
LEHHHHHH to the C-terminus of a recombinant protein.
Expression and purification of the recombinant
luminal domain of At SEL-1L BL21(DE3) cells
were transformed with pET-30/At SEL-1L
The expression of the putative luminal domain of At
SEL-1L was induced by the addition of 0.4 mm isopropyl
thio-b-d-galactoside for 4 h. The recombinant protein was
produced as inclusion bodies in E. coli. The cells from 2 L
culture broth were collected by centrifugation, disrupted
by sonication in 40 mL of 20 mm Tris ⁄ HCl buffer,
pH 7.9, containing 5 mm imidazole, 0.5 m NaCl and 1 mm
CaCl
2
(binding buffer), and then centrifuged at 10 000 g
for 30 min at 4 °C. The pellet was suspended in the bind-
ing buffer containing 6 m urea and 5 m m 2-mercaptoetha-
nol (urea-binding buffer) by sonication, and dissolved by

adjusting the pH to 9 with 1 m NaOH and then readjust-
ing it to 8 with 1 m HCl. A sample was applied to a His-
Bind quick cartridge (Novagen) equilibrated with the
urea-binding buffer. After washing the cartridge with the
urea-binding buffer, the luminal domain of At SEL-1L
was eluted with the urea-binding buffer containing 1 m
imidazole, and then concentrated with a Centriprep-10
(Millipore, Billerica, MA). The purified luminal domain of
At SEL-1L was used for the preparation of rabbit anti-
serum. The recombinant protein was confirmed to have an
initial methionine residue by N-terminal sequencing.
Analysis of At SEL-1L in Arabidopsis
Plantlets treated with TM for the indicated times were fro-
zen in liquid nitrogen and then ground into a fine powder
with a micropestle SK-100 (Tokken, Inc., Chiba, Japan).
Proteins were extracted from 100 mg of the tissue with
Unfolded protein response genes in Arabidopsis S. Kamauchi et al.
3472 FEBS Journal 272 (2005) 3461–3476 ª 2005 FEBS
80 lL of Laemmli’s SDS ⁄ PAGE buffer [76] containing a
1% (v ⁄ v) cocktail of protease inhibitors (Sigma, Inc.,
St. Louı
`
s, MO) by boiling for 5 min. For Endo H treat-
ment, 300 mg of plant tissue was ground, suspended in
800 lL of 100 mm tricine ⁄ KOH buffer, pH 7.5, containing
0.5 m sucrose, 1 mm EDTA and a 1% (v ⁄ v) cocktail of
protease inhibitors, and then filtered through a cell strai-
ner (BD Biosciences, Bedford, MA). The filtrate was cen-
trifuged at 1000 g for 10 min at 4 °C to remove tissue
debris. The supernatant obtained was centrifuged at

100 000 g for 1 h at 4 °C. The pellet was dissolved in
16 lL 0.1 m phosphate buffer, pH 5.5, containing 0.2%
(w ⁄ v) SDS and 0.5% (v ⁄ v) 2-mercaptoethanol by boiling
for 5 min. The resulting solution was diluted with four
volumes of 0.1 m phosphate buffer and then digested with
15 mU Endo H (Sigma, Inc.) at 37 °C overnight. After
digestion, proteins were treated with the SDS ⁄ PAGE buf-
fer. For cell fraction analysis, the supernatant and pellet
fraction obtained on centrifugation at 100 000 g were trea-
ted with the SDS ⁄ PAGE buffer. Twenty-five micrograms
of protein was subjected to SDS ⁄ PAGE and then blotted
onto a poly(vinylidene difluoride) membrane. The At
SEL-1L protein was then immunostained with 1 : 1000-
diluted anti-At SEL-1L serum and horseradish peroxidase-
conjugated rabbit Ig antiserum (Promega, Madison, WI)
as secondary antibodies, using Western Lightning Chemi-
luminescence Reagent (PerkinElmer Life Sciences, Boston,
MA).
Pulse labeling of proteins
For pulse labeling of proteins, plant tissues cut from the
roots were treated with or without TM for the indicated
times, and then incubated in 1 mL of MS containing
50 lCi (1850 kBq) each of [
35
S]Met and [
35
S]Cys (NEN Life
Science Products, Inc., Boston, MA) for 20 min at 25 °C.
The labeled plant tissues were rinsed with MS, frozen with
liquid nitrogen, and then ground with an electrical homo-

genizer, S-203, equipped with a spindle (Inouchi-Seieidou
Ltd, Osaka, Japan). The disrupted sample was boiled for
2 min in SDS⁄ PAGE buffer containing a 10% (v ⁄ v) cock-
tail of protease inhibitors. Then, 35 lg of protein was sub-
jected to SDS ⁄ PAGE. [
35
S]Met and [
35
S]Cys in the gel were
detected by fluorography with Enlightning (NEN Life Sci-
ence Products, Inc.).
Detection of phosphorylated Ser51 of eIF2a
Plant tissues cut off from the roots were treated as des-
cribed above with or without TM for the indicated times.
Plant proteins (30 lg of proteins) were separated by
SDS ⁄ PAGE and then blotted onto poly(vinylidene difluo-
ride) membranes. Phosphorylated Ser51 of eIF2a was im-
munostained with rabbit eIF2a phospho-specific polyclonal
antibodies (Biosource International, Camarillo, CA).
Protein measurement
The concentrations of proteins were measured using an RC
DC protein assay kit (Bio-Rad Laboratories, Hercules,
CA), with c-immunoglobulin as an internal standard.
Acknowledgements
We greatly thank Dr Makoto Kito, Emeritus Professor
of Kyoto University, for the critical reading of the
manuscript, valuable advice and warm encouragement.
This study was supported by a Grant for the Program
for Promotion of Basic Research Activities for Innova-
tive Biosciences.

References
1 Cox JS, Shamu CE & Walter P (1993) Transcriptional
induction of genes encoding endoplasmic reticulum resi-
dent-proteins requires a transmembrane protein kinase.
Cell 73, 1197–1206.
2 Mori K, Ma W, Gething M-J & Sambrook JF (1993) A
transmembrane protein with cdc2+ ⁄ CDC28-related kin-
ase activity is required for signaling from the ER to the
nucleus. Cell 74, 743–756.
3 Cox JS & Walter P (1996) A novel mechanism for regu-
lating the activity of a transcription factor that controls
the unfolded protein response. Cell 87, 391–404.
4 Mori K, Kawahara T, Yoshida H, Yanagi H & Yura T
(1996) Signalling from the endoplasmic reticulum to the
nucleus: transcription factor with a basic-leucine zipper
motif is required for the unfolded protein-response
pathway. Genes Cells 1, 803–817.
5 Nikawa J, Akiyoshi M, Hirata S & Fukuda T (1996)
Saccharomyces cerevisiae IRE2 ⁄ HAC1 is involved in
IRE1-mediated KAR2 expression. Nucleic Acids Res 24,
4222–4226.
6 Kohno K, Normington K, Sambrook J, Gething M-J &
Mori K (1993) The promoter region of the yeast KAR2
(BiP) gene contains a regulatory domain that responds
to the presence of unfolded proteins in the endoplasmic
reticulum. Mol Cell Biol 13, 877–890.
7 Mori K, Ogawa N, Kawahara T, Yanagi H & Yura T
(1998) Palindrome with a spacer of one nucleotide is
characteristic of the cis-acting unfolded protein response
element in Saccharomyces cerevisiae. J Biol Chem 273,

9912–9920.
8 Mori K, Sant A, Kohno K, Normington K, Gething
MJ & Sambrook JF (1992) A 22 bp cis-acting element
is necessary and sufficient for the induction of the yeast
KAR2 (BiP) gene by unfolded proteins. EMBO J 11,
2583–2593.
9 Travers KJ, Patil CK, Wodicka L, Lockhart DJ, Weiss-
man JS & Walter P (2000) Functional and genomic
S. Kamauchi et al. Unfolded protein response genes in Arabidopsis
FEBS Journal 272 (2005) 3461–3476 ª 2005 FEBS 3473
analyses reveal essential coordination between the
unfolded protein response and ER-associated degrada-
tion. Cell 101, 249–258.
10 Mori K (2000) Tripartite management of unfolded pro-
teins in the endoplasmic reticulum. Cell 101, 451–454.
11 Calfon M, Zeng H, Urano F, Till JH, Hubbard SR,
Harding HP, Clark SG & Ron D (2002) IRE1 couples
endoplasmic reticulum load to secretory capacity by
processing the XBP-1 mRNA. Nature 415, 92–96.
12 Tirasophon W, Welihinda AA & Kaufman RJ (1998) A
stress response pathway from the endoplasmic reticulum
to the nucleus requires a novel bifunctional protein
kinase ⁄ endoribonuclease (Ire1p) in mammalian cells.
Genes Dev 12, 1812–1824.
13 Yoshida H, Matsui T, Yamamoto A, Okada T & Mori K
(2001) XBP1 mRNA is induced by ATF6 and spliced by
IRE1 in response to ER stress to produce a highly active
transcription factor. Cell 107, 881–891.
14 Lee AH, Iwakoshi NN & Glimcher LH (2003) XBP-1
regulates a subset of endoplasmic reticulum-resident

chaperone genes in the unfolded protein response. Mol
Cell Biol 23, 7448–7459.
15 Haze K, Yoshida H, Yanagi H, Yura T & Mori K
(1999) Mammalian transcription factor ATF6 is synthe-
sized as a transmembrane protein and activated by pro-
teolysis in response to endoplasmic reticulum stress.
Mol Biol Cell 10, 3787–3799.
16 Okada T, Haze K, Nadanaka S, Yoshida H, Seidah NG,
Hirano Y, Sato R, Negishi M & Mori K (2003) A serine
protease inhibitor prevents endoplasmic reticulum stress-
induced cleavage but not transport of the membrane-
bound transcription factor ATF6. J Biol Chem 278,
31024–31032.
17 Ye J, Rawson RB, Komuro R, Chen X, Dave
´
UP, Prywes
R, Brown MS & Goldstein JL (2000) ER stress induces
cleavage of membrane-bound ATF6 by the same pro-
teases that process SREBPs. Mol Cell 6, 1355–1364.
18 Haze K, Okada T, Yoshida H, Yanagi H, Yura T,
Negishi M & Mori K (2001) Identification of the G13
(cAMP-response-element-binding protein-related pro-
tein) gene product related to activating transcription
factor 6 as a transcriptional activator of the mammalian
unfolded protein response. Biochem J 355, 19–28.
19 Yoshida H, Okada T, Haze K, Yanagi H, Yura T,
Negishi M & Mori K (2000) ATF6 activated by proteo-
lysis binds in the presence of NF-Y (CBF) directly to
the cis-acting element responsible for the mammalian
unfolded protein response. Mol Cell Biol 20, 6755–6767.

20 Harding HP, Zhang Y, Bertolotti A, Zeng H & Ron D
(2000) Perk is essential for translational regulation and
cell survival during the unfolded protein response. Mol
Cell 5, 897–904.
21 Harding HP, Zhang Y & Ron D (1999) Protein transla-
tion and folding are coupled by an endoplasmic-reticu-
lum-resident kinase. Nature 397, 271–274.
22 Harding HP, Zhang Y, Zeng H, Novoa I, Lu PD, Cal-
fon M, Sadri N, Yun C, Popko B, Paules R, Stojdl DF,
Bell JC, Hettmann T, Leiden JM & Ron D (2003) An
integrated stress response regulates amino acid metabo-
lism and resistance to oxidative stress. Mol Cell 11,
619–633.
23 Barbosa-Tessmann IP, Chen C, Zhong C, Schuster SM,
Nick HS & Kilberg MS (1999) Activation of the
unfolded protein response pathway induces human
asparagine synthetase gene expression. J Biol Chem 274,
31139–31144.
24 Bruhat A, Averous J, Carraro V, Zhong C, Reimold AM,
Kilberg MS & Fafournoux P (2002) Differences in the
molecular mechanisms involved in the transcriptional
activation of the CHOP and asparagine synthetase genes
in response to amino acid deprivation or activation of the
unfolded protein response. J Biol Chem 277, 48107–
48114.
25 Koizumi N, Martı
`
nez IM, Kimata Y, Kohno K, Sano H
& Chrispeels MJ (2001) Molecular characterization of
two Arabidopsis Ire1 homologs, endoplasmic reticulum-

located transmembrane protein kinases. Plant Physiol
127, 949–962.
26 Okushima Y, Koizumi N, Yamaguchi Y, Kimata Y,
Kohno K & Sano H (2002) Isolation and character-
ization of a putative transducer of endoplasmic reticu-
lum stress in Oryza sativa . Plant Cell Physiol 43, 532–
539.
27 D’Amico L, Valsasina B, Daminati MG, Fabbrini MS,
Nitti G, Bollini R, Ceriotti A & Vitale A (1992) Bean
homologs of the mammalian glucose-regulated proteins:
induction by tunicamycin and interaction with newly
synthesized seed storage proteins in the endoplasmic
reticulum. Plant J 2, 443–455.
28 Fontes EBP, Shank BB, Wrobel RL, Moose SPO,
Brian GR, Wurtzel ET & Boston RS (1991) Characteri-
zation of an immunoglobulin binding protein homolog
in the maize floury-2 endosperm mutant. Plant Cell 3,
483–496.
29 Koizumi N, Ujino T, Sano H & Chrispeels MJ (1999)
Overexpression of a gene that encodes the first enzyme
in the biosynthesis of asparagine-linked glycans makes
plants resistant to tunicamycin and obviates the tunica-
mycin-induced unfolded protein response. Plant Physiol
121, 353–361.
30 Oliver SC, Venis MA, Freedman RB & Napier RM
(1995) Regulation of synthesis and turnover of maize
auxin-binding protein, and observations on its passage
to the plasma membrane: comparisons to maize
immunoglobulin-binding protein cognate. Planta 197,
465–474.

31 Shank KJ, Su P, Brglez I, Boss WF, Dewey RE & Bos-
ton RS (2001) Induction of lipid metabolic enzymes
during the endoplasmic reticulum stress response in
plants. Plant Physiol 126, 267–277.
Unfolded protein response genes in Arabidopsis S. Kamauchi et al.
3474 FEBS Journal 272 (2005) 3461–3476 ª 2005 FEBS
32 Martı
`
nez IM & Chrispeels MJ (2003) Genomic analysis
of the unfolded protein response in Arabidopsis shows
its connection to important cellular processes. Plant Cell
15, 561–576.
33 Lee AS (1987) Coordinated regulation of a set of genes
by glucose and calcium ionophores in mammalian cells.
Trends Biochem Sci 12, 20–23.
34 Bilgin DD, Liu Y, Schiff M & Dinesh-Kumar SP (2003)
P58
IPK
, a plant ortholog of double-stranded RNA-
dependent protein kinase PKR inhibitor, functions in
viral pathogenesis. Dev Cell 4, 651–661.
35 Bolduc N, Ouellet M, Pitre F & Brisson LF (2003)
Molecular characterization of two plant BI-1 homolo-
gues which suppress Bax-induced apoptosis in human
293 cells. Planta 216, 377–386.
36 Kawai-Yamada M, Jin L, Yoshinaga K, Hirata A &
Uchimiya H (2001) Mammalian Bax-induced plant cell
death can be down-regulated by overexpression of Ara-
bidopsis Bax Inhibitor-1 (AtBI-1). Proc Natl Acad Sci
USA 98, 12295–12300.

37 Utsugi S, Sakamoto W, Murata M & Motoyoshi F
(1998) Arabidopsis thaliana vegetative storage protein
(VSP) genes: gene organization and tissue-specific
expression. Plant Mol Biol 38, 565–576.
38 Utsugi S, Sakamoto W, Ogura Y, Murata M &
Motoyoshi F (1996) Isolation and characterization of
cDNA clones corresponding to the genes expressed pre-
ferentially in floral organs of Arabidopsis thaliana. Plant
Mol Biol 32, 759–765.
39 Lee K, Tirasophon W, Shen X, Michalak M, Prywes R,
Okada T, Yoshida H, Mori K & Kaufman RJ (2002)
IRE1-mediated unconventional mRNA splicing and
S2P-mediated ATF6 cleavage merge to regulate XBP1
in signaling the unfolded protein response. Genes Dev
16, 452–466.
40 Wang Y, Shen J, Arenzana N, Tirasophon W, Kaufman
RJ & Prywes R (2000) Activation of ATF6 and an
ATF6 DNA binding site by the endoplasmic reticulum
stress response. J Biol Chem 275, 27013–27020.
41 Yoshida H, Haze K, Yanagi H, Yura T & Mori K
(1998) Identification of the cis-acting endoplasmic reti-
culum stress response element responsible for transcrip-
tional induction of mammalian glucose-regulated
proteins. Involvement of basic leucine zipper transcrip-
tion factors. J Biol Chem 273, 33741–33749.
42 Kokame K, Kato H & Miyata T (2001) Identification
of ERSE-II, a new cis-acting element responsible for the
ATF6-dependent mammalian unfolded protein response.
J Biol Chem 276, 9199–9205.
43 Li M, Baumeister P, Roy B, Phan T, Foti D, Luo S &

Lee AS (2000) ATF6 as a transcription activator of the
endoplasmic reticulum stress element: thapsigargin
stress-induced changes and synergistic interactions with
NF-Y and YY1. Mol Cell Biol 20, 5096–5106.
44 Yoshida H, Okada T, Haze K, Yanagi H, Yura T,
Negishi M & Mori K (2001) Endoplasmic reticulum
stress-induced formation of transcription factor complex
ERSF including NF-Y (CBF), and activating transcrip-
tion factors 6a and 6b that activates the mammalian
unfolded protein response. Mol Cell Biol 21, 1239–1248.
45 Oh D-H, Kwon C-S, Sano H, Chung W-I & Koizumi
N (2003) Conservation between animals and plants of
the cis-acting element involved in the unfolded protein
response. Biochem Biophys Res Commun 301, 225–230.
46 Bays NW, Gardner RG, Seelig LP, Joazeiro CA &
Hampton RY (2001) Hrd1p ⁄ Der3p is a membrane-
anchored ubiquitin ligase required for ER-associated
degradation. Nat Cell Biol 3, 24–29.
47 Donoviel DB, Donoviel MS, Fan E, Hadjantonakis A
& Bernstein A (1998) Cloning and characterization of
Sel-1l, a murine homolog of the C. elegans sel-1 gene.
Mech Dev 78, 203–207.
48 Harada Y, Ozaki K, Suzuki M, Fujiwara T, Takahashi
E, Nakamura Y & Tanigami A (1999) Complete cDNA
sequence and genomic organization of a human pan-
creas-specific gene homologous to Caenorhabditis ele-
gans Sel-1. J Hum Genet 44, 330–336.
49 Nadav E, Shmueli A, Barr H, Gonen H, Ciechanover A
& Reiss Y (2003) A novel mammalian endoplasmic reti-
culum ubiquitin ligase homologous to the yeast Hrd1.

Biochem Biophys Res Commun 303, 91–97.
50 Lee TG, Tang N, Thompson S, Miller J & Katze
MG (1994) The 58,000-dalton cellular inhibitor of the
interferon-induced double-stranded RNA-activated
protein kinase (PKR) is a member of the tetratrico-
peptide repeat family of proteins. Mol Cell Biol 14,
2331–2342.
51 Yan W, Frank CL, Korth MJ, Sopher BL, Novoa I,
Ron D & Katze MG (2002) Control of PERK eIF2a
kinase activity by the endoplasmic reticulum stress-
induced molecular chaperone P58
IPK
. Proc Natl Acad
Sci USA 99, 15920–15925.
52 Melville MW, Hansen WJ, Freeman BC, Welch WJ &
Katze MG (1997) The molecular chaperone hsp40 regu-
lates the activity of P58
IPK
, the cellular inhibitor of
PKR. Proc Natl Acad Sci USA 94, 97–102.
53 van Huizen R, Martindale JL, Gorospe M & Holbrook
NJ (2003) P58
IPK
, a novel endoplasmic reticulum stress-
inducible protein and potential negative regulator of
eIF2a signaling. J Biol Chem 278, 15558–15564.
54 Noh S-J, Kwon CS, Oh D-H, Moon JS & Chung W-I
(2003) Expression of an evolutionarily distinct novel
BiP gene during the unfolded protein response in Arabi-
dopsis thaliana. Gene 311, 81–91.

55 Mira H, Martı
`
nez N & Pen
˜
arrubia L (2002) Expression
of a vegetative-storage-protein gene from Arabidopsis is
regulated by copper, senescence and ozone. Planta 214,
939–946.
S. Kamauchi et al. Unfolded protein response genes in Arabidopsis
FEBS Journal 272 (2005) 3461–3476 ª 2005 FEBS 3475
56 Gilbert HF (1998) Protein disulfide isomerase. Methods
Enzymol 290, 26–50.
57 Wetterau JR, Combs KA, Spinner SN & Joiner BJ
(1990) Protein disulfide isomerase is a component of the
microsomal triglyceride transfer protein complex. J Biol
Chem 265, 9800–9807.
58 Tasanen K, Parkkonen T, Chow LT, Kivirikko KI &
Pihlajaniemi T (1988) Characterization of the human
gene for a polypeptide that acts both as the b subunit
of prolyl 4-hydroxylase and as protein disulfide isom-
erase. J Biol Chem 263, 16218–16224.
59 Oliver JD, van der Wal FJ, Bulleid NJ & High S (1997)
Interaction of the thiol-dependent reductase ERp57 with
nascent glycoproteins. Science 275, 86–88.
60 Urade R, Okudo H, Kato H, Moriyama T & Arakaki Y
(2004) ER-60 domains responsible for interaction with
calnexin and calreticulin. Biochemistry 43, 8858–8868.
61 Zapun A, Darby NJ, Tessier DC, Michalak M, Berger-
on JJ & Thomas DY (1998) Enhanced catalysis of ribo-
nuclease B folding by the interaction of calnexin or

calreticulin with ERp57. J Biol Chem 273, 6009–6012.
62 Romano PG, Horton P & Gray JE (2004) The Arabi-
dopsis cyclophilin gene family. Plant Physiol 134, 1268–
1282.
63 Pilon M, Schekman R & Ro
¨
misch K (1997) Sec61p
mediates export of a misfolded secretory protein from
the endoplasmic reticulum to the cytosol for degrada-
tion. EMBO J 16, 4540–4548.
64 Brandizzi F, Hanton S, DaSilva LL, Boevink P, Evans
D, Oparka K, Denecke J & Hawes C (2003) ER quality
control can lead to retrograde transport from the ER
lumen to the cytosol and the nucleoplasm in plants.
Plant J 34, 269–281.
65 Knop M, Finger A, Braun T, Hellmuth K & Wolf DH
(1996) Der1, a novel protein specifically required for
endoplasmic reticulum degradation in yeast. EMBO J
15, 753–763.
66 Gardner RG, Swarbrick GM, Bays NW, Cronin SR,
Wilhovsky S, Seelig L, Kim C & Hampton RY (2000)
Endoplasmic reticulum degradation requires lumen to
cytosol signaling: Transmembrane control of Hrd1p by
Hrd3p. J Cell Biol 151, 69–82.
67 Hinnebusch AG (2000) Mechanism and regulation of
initiator methionyl-tRNA binding to ribosomes. In
Translational Control of Gene Expression (Sonenberg N
Hershey JWB & Mathews M, eds), pp. 185–244. Cold
Spring Harbor Laboratory Press, Cold Spring Harbor,
NY.

68 Vattem KM & Wek RC (2004) Reinitiation involving
upstream ORFs regulates ATF4 mRNA translation in
mammalian cells. Proc Natl Acad Sci USA 101, 11269–
11274.
69 Zuppini A, Navazio L & Mariani P (2004) Endoplasmic
reticulum stress-induced programmed cell death in soy-
bean cells. J Cell Sci 117, 2591–2598.
70 Chae H-J, Kim H-R, Xu C, Bailly-Maitre B, Krajewska
M, Krajewski S, Banares S, Cui J, Digicaylioglu M, Ke
N et al. (2004) BI-1 regulates an apoptosis pathway
linked to endoplasmic reticulum stress. Mol Cell 15,
355–366.
71 Hu
¨
ckelhoven R, Dechert C & Kogel K-H (2003) Over-
expression of barley BAX inhibitor 1 induces break-
down of mlo-mediated penetration resistance to
Blumeria graminis. Proc Natl Acad Sci USA 100, 5555–
5560.
72 Matsumura H, Nirasawa S, Kiba A, Urasaki N, Saitoh
H, Ito M, Kawai-Yamada M, Uchimiya H & Terauchi
R (2003) Overexpression of Bax inhibitor suppresses the
fungal elicitor-induced cell death in rice (Oryza sativa l)
cells. Plant J 33, 425–434.
73 Murashige T & Skoog F (1962) A revised medium for
rapid growth and bioassays with tobacco tissue cultures.
Physiol Plant 15, 473–497.
74 Brenner S, Williams SR, Vermaas EH, Storck T, Moon
K, McCollum C, Mao J-I, Luo S, Kirchner JJ, Eletr S
et al. (2000) In vitro cloning of complex mixtures of

DNA on microbeads: physical separation of differen-
tially expressed cDNAs. Proc Natl Acad Sci USA 97,
1665–1670.
75 Sambrook J & Russell D (2001) Molecular Cloning: a
Laboratory Manual, 3rd edn. Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, NY.
76 Laemmli UK (1970) Cleavage of structural proteins
during the assembly of the head of bacteriophage T4.
Nature 227, 680–685.
Supplementary material
The following supplementary material for this article is
available online:
Table S1. Up-regulated genes selected for functional
DNA microarray analysis.
Table S2. List of singlet genes identified on fluid
microarray analysis.
Unfolded protein response genes in Arabidopsis S. Kamauchi et al.
3476 FEBS Journal 272 (2005) 3461–3476 ª 2005 FEBS