Báo cáo khoa học: Molecular cloning, expression analysis and functional confirmation of ecdysone receptor and ultraspiracle from the Colorado potato beetle Leptinotarsa decemlineata pdf

Molecular cloning, expression analysis and functional
confirmation of ecdysone receptor and ultraspiracle from
the Colorado potato beetle Leptinotarsa decemlineata
Takehiko Ogura
1
, Chieka Minakuchi
1,
*, Yoshiaki Nakagawa
1
, Guy Smagghe
2
and
Hisashi Miyagawa
1
1 Division of Applied Life Sciences, Graduate School of Agriculture, Kyoto University, Japan
2 Laboratory of Agrozoology, Department of Crop Protection, Faculty of Bioscience Engineering, Ghent University, Belgium
The growth of insects progresses via unique physiologi-
cal events such as molting and metamorphosis. Those
processes are strictly regulated by two peripheral hor-
mones, molting hormone (20-hydroxyecdysone; 20E)
and juvenile hormone (JH). 20E controls transcription
of target genes by interacting with molting hormone
receptor proteins, which bind to ecdysone response ele-
ments (EcREs) located upstream of the target genes.
The transcriptional activation by 20E triggers signal
cascades, and the development is accomplished via
complex regulatory mechanisms [1]. The heterodimer
of two nuclear receptors, ecdysone receptor (EcR) and
ultraspiracle (USP), functions as a molting hormone
receptor, and 20E is known to be a ligand for EcR.
USP is the homologue of vertebrate RXR [2,3].

Amino-acid sequences of EcR and USP were first
determined in the dipteran fruit fly Drosophila melano-
gaster [4–6], and subsequently determined in other
insects [7–25], as well as a crustacean [26] and a tick
[27,28]. These receptor proteins consist of regions
Keywords
ecdysone receptor (EcR); Leptinotarsa
decemlineata; ponasterone A; ultraspiracle
(USP); 20-Hydroxyecdysone
Correspondence
Y. Nakagawa, Division of Applied Life
Sciences, Graduate School of Agriculture,
Kyoto University, Kyoto 606–8502, Japan
Fax: +81 75 7536123
Tel: +81 75 7536117
E-mail:
Present address
*Department of Biology, University of
Washington, Seattle WA 98195–1800, USA
(Received 27 April 2005, revised 13 June
2005, accepted 16 June 2005)
doi:10.1111/j.1742-4658.2005.04823.x
cDNA cloning of ecdysone receptor (EcR) and ultraspiracle (USP) of the
coleopteran Colorado potato beetle Leptinotarsa decemlineata (LdEcR and
LdUSP) was conducted. Amino-acid sequences of the proteins deduced
from cDNA sequences showed striking homology to those of other insects,
especially the coleopteran yellow mealworm Tenebrio molitor. Northern
hybridization analysis showed a 12.4-kb message for the LdEcR A-isoform,
a 10.5-kb message for the LdEcR B1-isoform and a 5.7-kb message for the
LdUSP, in fat body, gut, integument, testis and ovaries. In developmental

profile studies, expression of both the LdEcR and LdUSP transcript in
integument changed dramatically. In gel mobility shift assays, in vitro
translated LdEcR alone bound weakly to the pal1 ecdysone response ele-
ment, although LdUSP alone did not, and this binding was dramatically
enhanced by the addition of LdUSP. LdEcR ⁄ LdUSP complex also showed
significant binding to an ecdysone agonist, ponasterone A (K
D
¼ 2.8 nm),
while LdEcR alone showed only weak binding (K
D
¼ 73.4 nm), and
LdUSP alone did not show any binding. The receptor-binding affinity of
various ecdysone agonists to LdEcR ⁄LdUSP was not correlated to their
larvicidal activity to L. decemlineata. From these results, it was suggested
that multiple factors including the receptor binding affinity are related to
the determination of the larvicidal activity of nonsteroidal ecdysone agon-
ists in L. decemlineata.
Abbreviations
ANS-118, chromafenozide; DBH, dibenzoylhydrazine; EcR, ecdysone receptor; EcRE, ecdysone response element; 20E, 20-hydroxyecdysone;
pIC
50
, reciprocal logarithmic value of IC
50
; PonA, ponasterone A; RH-0345, halofenozide; RH-2485, methoxyfenozide; RH-5849, N-tert-butyl-
N,N¢-dibenzoylhydrazine; RH-5992, tebufenozide; RXR, retinoid X receptor; THR, thyroid hormone receptor; USP, ultraspiracle.
4114 FEBS Journal 272 (2005) 4114–4128 ª 2005 FEBS
referred to as A⁄ B, C (DNA binding), D, E (ligand
binding) and F, which is consistent to other members
of the nuclear receptor superfamily. Molecular regula-
tory mechanisms of transcriptional activation by 20E

were studied intensively in D. melanogaster [29–33],
and were also reported for a dipteran, the yellow fever
mosquitoe Aedes aegypti [34], and lepidopterans, the
tobacco hornworm Manduca sexta [35–37] and the
silkworm Bombyx mori [38,39]. On the other hand,
the natural ligand of USP is unknown, although recent
in vitro experiments indicated that JH binds to USP
and regulates transcriptional events [40–42].
Although 20E is a steroidal compound, some syn-
thetic ecdysone agonists which have no steroid struc-
ture are known. Interestingly, it has been noted that,
while the binding affinity of ecdysteroids such as 20E
and its agonist, ponasterone A (PonA), is comparable
among insect species, that of nonsteroidal ecdysone
agonists, dibenzoylhydrazines (DBHs), are different
among insect orders [43]. Recently, the X-ray crystal
structure of the ligand binding domain of EcR was
solved for the lepidopteran tobacco budworm Helio-
this virescens [44]. Superimposition of PonA and a
DBH type compound, BYI06830, as bound to EcR
ligand binding domain, suggested that an aromatic
ring moiety of BYI06830 occupies a binding pocket
which is not fully shared with PonA. Thus, there is a
possibility that the difference of binding affinity of
DBHs to receptors among insect species is due to the
difference of structures of the ligand binding pocket.
In the other study, we demonstrated that the molting
hormone activities of ecdysone agonists measured in
cultured integument system of the lepidopteran rice
stem borer Chilo suppressalis are correlated to and

ruled by their respective receptor binding affinity to
in vitro translated EcR and USP proteins of C. suppres-
salis [45]. These recent results indicate that the import-
ance to investigate ligand–receptor interactions and
compare structures of molting hormone receptors
among insects is increasing for a better understanding
of the function of molting hormone in insect growth
and development.
Previously, we performed structure–activity relation-
ship (SAR) studies of ecdysone agonists using C. sup-
pressalis, the lepidopteran Spodoptera exigua and a
coleopteran field pest, the Colorado potato beetle
Leptinotarsa decemlineata [46–57]. In those studies, the
larvicidal activity of DBHs against C. suppressalis was
correlated with those against S. exigua but not correla-
ted with those against L. decemlineata, suggesting that
the receptor-binding of DBHs in L. decemlineata is dif-
ferent to those in C. suppressalis and S. exigua. The
aim of this study is to examine the SAR of ecdysone
agonists for the molecular interaction with the molting
hormone receptor. Here, we report (a) the determin-
ation of primary amino acid structures of EcR and
USP from L. decemlineata (b) the analysis of mRNA
expression profile of L. decemlineata, EcR and USP,
and (c) the measurement of the binding affinity of
steroidal and nonsteroidal ecdysone agonists to the
in vitro translated receptor proteins. Comparison of
the receptor-binding affinity between various insects is
expected to lead molecular bases for the divergence of
the toxicity of ecdysone agonists.

Results
cDNA cloning of LdEcR and LdUSP
A 379-bp fragment was amplified by RT-PCR using
degenerate primers, and its sequence was determined. A
deduced amino acid sequence of the PCR product was
homologous to a corresponding part of EcRs of other
insects. Then we subsequently conducted 5¢-RACE and
3¢-RACE, and sequences of 1337-bp and 998-bp frag-
ments were determined, respectively. Combining these
sequences of PCR fragments, we deduced the whole
cDNA sequence of LdEcR to be 2714-bp long. The lon-
gest open reading frame (ORF), which is followed by an
in-frame termination codon, encodes a 565 amino acid
peptide (Fig. 1A). The deduced amino acid sequence
has a structure typical for the nuclear receptor super-
family. We also amplified an 833-bp fragment by
5¢-RACE to determine a 2165-bp sequence. A 488
amino acid sequence was deduced from this 2165-bp
cDNA sequence, which was different to the 565 amino
acid sequence only in a part of A ⁄ B region (Fig. 1B). A
database search was conducted using the blast program
( and the longer
sequence (565 amino acids) was found to be highly
homologous to previously reported EcR A-isoform of
other insects. Thus we concluded that the longer cDNA
encodes L. decemlineata EcR A-isoform (LdEcR-A).
On the other hand, the shorter sequence (488 amino
acids) was determined to be an EcR B1-isoform of
L. decemlineata (LdEcR-B1).
In the same way, we determined a 1699-bp sequence

by combining sequences of 157-bp, 690-bp and 994-bp
of RT-PCR, 5¢-RACE and 3¢-RACE fragments. A 384
amino acid sequence (Fig. 1C) encoded by the longest
ORF of the cDNA sequence has a structure typical for
the nuclear receptor superfamily. A database search
with the blast program showed that this deduced
sequence is highly homologous to other USPs. Thus
we determined this sequence as L. decemlineata USP
(LdUSP).
T. Ogura et al. Molting hormone receptors of L. decemlineata
FEBS Journal 272 (2005) 4114–4128 ª 2005 FEBS 4115
LdEcR-A and LdUSP amino acid sequences were
compared with EcR and USP sequences of other
insects, respectively (Table 1). The C region of
LdEcR shares a very high amino acid identity with
that of other EcR sequences (91–94%). The E region
of LdEcR is also highly homologous to those of
other EcRs (> 60%), especially to EcR-A from
coleopteran Tenebrio molitor (TmEcR-A, 91%) and
orthopteran Locusta migratoria (LmEcR, 89%). The
D region is homologous to those of T. molitor and
L. migratoria (78% and 70%, respectively), but less
homologous to those of others (< 38%). The A ⁄ B
regions are rather diverse among all sequences
(< 52%). Similarly, the amino acid identity of the
C region of LdUSP is also very high among all
sequences (89–95%). Both D and E ⁄ F regions are
also highly homologous to those of T. molitor and
L. migratoria (96% and 75%, 88% and 69%, respec-
tively), although they are less homologous to other

USPs. A ⁄ B regions of USPs are highly diverse (6–
45%), as observed for EcRs.
mRNA expression profiles
The spatial expression pattern of EcR mRNA was
analyzed using total RNA prepared from the fat body,
gut, integument and whole body of L. decemlineata
larvae at day 4 of the last (4th) instar. A 12.4-kb mes-
sage was detected by the LdEcR common probe in the
integument and whole body, and slightly in the gut.
The mRNA of EcR was not detectable in the fat body
(Fig. 2A). We also demonstrated the temporal expres-
sion pattern of LdEcR in the integument of 4th instar
larvae. As shown in Fig. 2A, the EcR message steeply
increased at day 4, then remained at the high expres-
sion level until day 8. Total RNAs from the whole
body of male and female adult, testis and ovaries as
well as from L. decemlineata cells were subjected to
northern hybridization analysis. Although the EcR
message was detected in all tissues, the message was
weak in adult males. Expression of mRNA of LdEcR
seems to be much higher in adult female than in adult
male. The EcR transcript abounds in L. decemlineata
Fig. 1. The deduced amino acid sequence of L. decemlineata molting hormone receptor. (A) The deduced amino acid sequence of LdEcR-A.
The DNA binding domain (DBD, C-region) is underlined. The ligand binding domain (LBD, E-region) is underlined with dashes. The junction of
LdEcR-A and LdEcR-B1 is shown by an arrow head. Gly164 and the downstream sequences are common between LdEcR-A and LdEcR-B1.
The five amino acids encoded a 15-bp sequence that is absent in some cDNAs is boxed. (B) The deduced amino acid sequence of the iso-
form-specific region of LdEcR-B1. This sequence connects to Gly164 in (A). (C) The deduced amino acid sequence of LdUSP. The DNA bind-
ing domain (DBD, C-region) is underlined. The ligand binding domain (LBD, E ⁄ F-region) is underlined with dashes. The sequence data of
LdEcR-A, LdEcR-B1 and LdUSP have been submitted to the DDBJ ⁄ EMBL ⁄ GenBank nucleotide sequence database under the accession
number AB211191, AB211192 and AB211193, respectively.

Molting hormone receptors of L. decemlineata T. Ogura et al .
4116 FEBS Journal 272 (2005) 4114–4128 ª 2005 FEBS
cells. A 10.5-kb transcript was also detected in all tis-
sues and developmental stages, although the signals
were very weak (Fig. 2A). Northern hybridization ana-
lysis using LdEcR-A and LdEcR-B1 probes indicated
that the 12.4-kbp signal is mRNA of LdEcR-A, and
the 10.5-kbp transcript is LdEcR-B1 mRNA (Fig. 2B).
We used LdEcR-A in the following experiments of our
study because the expression of LdEcR-A is much
higher than LdEcR-B1.
Northern hybridization analysis was also conducted
with the probe for USP using the same series of total
RNA. The expression pattern of LdUSP, as 5.7-kb
message, was similar to that of LdEcR-A over the dif-
ferent tissues and developmental stages. The very high
expression was observed in the whole body of female
adults (Fig. 2A).
SDS/PAGE and gel mobility shift assay of
in vitro translated proteins
LdEcR-A and LdUSP proteins were prepared by
in vitro transcription ⁄ translation with [
35
S]methionine
and subjected to SDS ⁄ PAGE analysis (Fig. 3).
Molecular mass for LdEcR-A and LdUSP was
A
B
Fig. 2. mRNA expression profiles of LdEcR
and LdUSP. (A) LdEcR mRNA and LdUSP

mRNA expression in the fat body (FB), gut
(GUT), integument (INT) and whole body
(WB) at day 4 in the last larval instar, in the
INT at day 0, 2, 4, 6 and 8 in the last larval
instar, and in the adult male WB (#), female
WB ($), testis TES and ovary (OVA), and
L. decemlineata cells BCIRL-Lepd-SL1
(CELL). For detecting LdEcR transcripts,
LdEcR common probe was used. Ethidium
bromide staining of rRNA is shown as a
control for equal loading. (B) The expression
of LdEcR-A and LdEcR-B1 mRNA in
integument of last instar larvae. Temporal
expression profiles were studied using
isoform-specific probes.
Table 1. Comparison of sequences. Sequence comparison between (A) L. decemlineata EcR A-isoform (LdEcR-A) and other EcR-A’s
(B) LdUSP and other USPs. Amino-acid identity against LdEcR-A and LdUSP is expressed as percentage in each region. We could not com-
pare F regions because their sequences are too short. TmEcR-A: Tenebrio molitor EcR-A (GenBank accession number Y11533 [22]), LmEcR:
Locusta migratoria EcR (AF049136), DmEcR-A: Drosophila melanogaster EcR-A (M74078, S63761), CsEcR-A: Chilo suppressalis EcR-A
(AB067811), AamEcR-A2: Amblyomma americanum (AF020188), UpEcR: Uca pugilator EcR-A2 (AF034086), TmUSP: T. molitor USP
(AJ251542), LmUSP: L. migratoria USP (AF136372), DmUSP: D. melanogaster USP (X53417), CsUSP: C. suppressalis USP (AB081840),
UpUSP: U. pugilator USP (AF032983).
AA⁄ B C D E F Total
TmEcR-A 52 94 78 91 – 80
LmEcR 34 94 70 86 – 68
DmEcR-A 23 91 25 67 – 34
CsEcR-A 38 92 26 61 – 51
AamEcR-A2 20 92 31 66 – 48
UpEcR 19 92 38 70 – 53
BA⁄ BC D E⁄ F Total

TmUSP 45 95 96 75 74
LmUSP 41 94 88 69 68
DmUSP 16 89 21 39 38
CsUSP 39 91 59 47 53
UpUSP 22 91 64 54 52
T. Ogura et al. Molting hormone receptors of L. decemlineata
FEBS Journal 272 (2005) 4114–4128 ª 2005 FEBS 4117
estimated to be 64 kDa and 49 kDa, respectively, from
the mobility in the gel. The 64 kDa LdEcR-A protein
was consistent with the predicted size from the
deduced amino acid sequence (63.4 kDa). In the lane
of translation products of LdEcR-A, extra bands with
lower molecular weight were observed. They were
probably degradation products of the full length
64 kDa protein. Similar results were obtained for the
in vitro translation of USP of C. suppressalis [13].
Otherwise, they might be products of internal initiation
or premature termination of translation. The 49 kDa
LdUSP protein was slightly larger than the size predic-
ted from deduced amino acid sequence (43.1 kDa).
This might be the result of post-translational modifica-
tions.
A gel mobility shift assay was conducted using
in vitro translated LdEcR-A and LdUSP proteins
(Fig. 4). The mixture of LdEcR-A and LdUSP clearly
bound to the pal1 EcRE probe [58]. Interestingly, a
weak signal was also detected for LdEcR-A alone.
When a 100-fold excess of unlabeled competitor was
added, the band shift observed for the mixture of
LdEcR-A and LdUSP disappeared. Drosophila hsp27

EcRE [59] probe gave the same results as pal1 (data
not shown). These results indicate that LdEcR-A and
LdUSP form the complex (LdEcR-A ⁄ LdUSP) and
bind to the EcRE. Addition of 20E to the reaction
mixture enhanced the probe-binding (data not shown)
as observed in D. melanogaster [3], B. mori [60], Choris-
toneura fumiferana [15] and Chironomus tentans [17],
although EcR alone did not show binding to EcRE in
those studies.
Ligand binding assay
The specific binding of in vitro translated proteins to
PonA was calculated by the difference between total
binding and nonspecific binding as we previously
reported [45]. The dissociation equilibrium constant,
K
D
, of PonA was calculated from the saturation curve
of the specific binding and the Scatchard plot (Fig. 5).
The K
D
values of LdEcR-A and LdEcR-A ⁄ LdUSP cal-
culated from saturation curves were 72.6 and 2.8 nm,
respectively.
Receptor-binding affinity of ecdysone agonists to
LdEcR-A ⁄ LdUSP is shown in Table 2. The binding
affinity of DBHs tested in this study was relatively low
(< 6.00 in terms of pIC
50
) compared to that against
C. suppressalis. The SARs for binding affinities of

Fig. 3. SDS ⁄ PAGE of in vitro translated LdEcR-A and LdUSP pro-
teins pET-23a (+) vector (lane 1), in vitro translated LdEcR-A (lane
2), LdUSP (lane 3) and LdEcR-A ⁄ LdUSP translated simultaneously
in the same tube (lane 4) with [
35
S]methionine were separated on
10% SDS ⁄ PAGE gel.
Fig. 4. Binding of LdEcR-A ⁄ LdUSP complex to the ecdysone
response element (EcRE). In vitro translated LdEcR-A and ⁄ or
LdUSP protein were incubated with
32
P-labeled pal1 EcRE and then
applied for nondenaturing polyacrylamide gel electrophoresis. Water
(lane 1), a reaction mixture using pET-23a(+) vector substitute to
LdEcR-A or LdUSP construct (negative control, lane 2), LdEcR-A
(lane 3), LdUSP (lane 4) and LdEcR-A and LdUSP translated simulta-
neously in the same tube (lane 5 and 6) were mixed with probes
and loaded. In the lane 6, 100-fold excess of the same EcRE oligo-
nucleotide was added for competition experiment.
Molting hormone receptors of L. decemlineata T. Ogura et al .
4118 FEBS Journal 272 (2005) 4114–4128 ª 2005 FEBS
ecdysteroids were linearly correlated between L. decem-
lineata and C. suppressalis, whereas those of DBHs were
not (Fig. 6A). No positive correlation was observed
between receptor-binding and larvicidal activity against
L. decemlineata with respect to DBHs (Fig. 6B) [52,55].
Discussion
The comparison of EcRs and USPs
Three cDNAs encoding LdEcR-A, LdEcR-B1 and
LdUSP were obtained, and they had high amino acid

identity with EcR-A, EcR-B1 and USP of other
insects, respectively. It is known that many insect spe-
cies have two or three EcR isoforms (EcR-A, EcR-B1
and EcR-B2), and their functions are different depend-
ing on tissues, developmental stages and species
[5,12,14,22,61,62]. In D. melanogaster, it was reported
that EcR-B1 is predominantly expressed in larval
tissues, and expression of EcR-A is predominant in
imaginal discs [5]. In B. mori, C. fumiferana, C. sup-
pressalis and M. sexta, EcR-B1 was observed as the
major isoform in larval stage, although expression pat-
terns of EcR isoforms appeared to be diverse among
these lepidopteran insects [12,14,61,62]. Thus, functions
of EcR isoforms in larval stage might be different
between lepidopteran and dipteran insects. In this
study, we showed that L. decemlineata also possesses
two isoforms, and the expression of LdEcR-A was
much stronger than LdEcR-B1 (Fig. 2A). Expression
of EcR-A was also predominant in larval tissue of
coleopteran T. molitor [22]. These facts also indicate
that the dominant isoform of EcR in larval develop-
ment is different depending on tissues and insect
orders. Furthermore, LdEcR-A transcripts in the
integument increased steeply at day 4 of 4th instar lar-
vae (Fig. 2A). We previously reported that the molting
hormone titer in the hemolymph during 4th instar
development of L. decemlineata was constant until day
6 except for a small peak at day 4, and rapidly
increased to the major peak between day 8 and day 9
[63]. Thus, EcR-A transcripts in integument are pro-

bably induced by the small peak of ecdysteroid on day
4, prior to the major hemolymph ecdysteroid peak.
The strong expression of EcR transcripts prior to the
peak of ecdysteroid titer in hemolymph was also repor-
ted in various insects such as D. melanogaster and
M. sexta [5,10,12,14,22,61]. Therefore, expression of
EcR mRNA could be up-regulated by the rising of
ecdysteroid titer in hemolymph to secure sufficient
responsibility to the peak of ecdysteroid titer. Further
studies for the mechanism of their transcriptional regu-
lation would support the elucidation of different roles
of EcR isoforms in Coleoptera.
Although we have obtained only one isoform from
L. decemlineata, two USP isoforms, MsUSP-1 and
MsUSP-2, were cloned from lepidopteran M. sexta ,
and their different role on MHR3 promoter activation
was shown [21,64]. Dipteran Aedes aegypti and C. ten-
tans also possess two USP isoforms (USP-A and USP-
B) [17,65]. Therefore, other USP isoforms might exist
and contribute to the development of L. decemlineata.
LdUSP showed higher conservation with two USP
isoforms of the tick Amblyomma americanum
(AamUSP-1 and AamUSP-2 [28]) than USPs of
A. aegypti, C. tentans and D. melanogaster, but no
significant difference was observed between homologies
to two USP isoforms. LdUSP as well as T. molitor
Fig. 5. The binding affinity of ponasterone A (PonA) to in vitro
translated proteins. In vitro translated LdEcR-A or LdEcR-A ⁄ LdUSP
were incubated with various concentration of [
3

H]-labeled PonA, in
the presence or absence of excess PonA. Saturation radioligand-
binding curves and Scatchard plots are shown.
T. Ogura et al. Molting hormone receptors of L. decemlineata
FEBS Journal 272 (2005) 4114–4128 ª 2005 FEBS 4119
and L. migratoria USP showed higher homology to
RXR of human and mouse than USP isoforms of dip-
teran and lepidopteran insects. Thus, the functions of
USP of L. decemlineata, T. molitor and L. migratoria
might have the similar function to RXR, being differ-
ent from those of Diptera and Lepidoptera. The
LdUSP transcript showed similar developmental and
spatial expression profiles as LdEcR-A. USP tran-
scripts also changed with the hemolymph ecdysteroid
titer in T. molitor, C. fumiferana and M. sexta,
although their expression profiles were different from
the case of L. decemlineata [15,21,23]. On the contrary,
USP mRNA expression in the epidermis of C. suppres-
salis and B. mori was ubiquitous throughout the last
larval instar [13,66]. Such a difference suggests that
hormonal regulatory mechanisms of USP transcription
are different among insect species.
Previously, it was pointed out that there is a con-
served motif (motif-1) between T. molitor EcR-A (amino
acids 29–39) and D. melanogaster EcR-A (143–153).
The presence of conserved motif-2 between M. sexta
EcR-A (60–79) and D. melanogaster EcR-A (177–196)
was also pointed out in A ⁄ B region of EcRs [22]. The
sequence of amino acids 108–118 of LdEcR-A is homo-
logous to the motif-1, and this was also the case for

EcR-A of coleopteran T. molitor. Interestingly, the
sequence of amino acids 143–162 of LdEcR-A also has
a striking homology with the motif-2. It is different from
T. molitor EcR-A, but consistent to EcR-A of lepidop-
teran M. sexta and C. suppressalis. EcR-A sequences of
lepidopteran insects showed relatively lower homology
to LdEcR-A in comparison with EcR-A homologies
between insects of other orders and coleopteran L. de-
cemlineata. Thus, each of these two conserved motifs in
Table 2. Binding affinity of ecdysone agonists. Binding affinity
(pIC
50
: M) of steroidal and nonsteroidal ecdysone agonists to the
receptor of L. decemlineata (LdEcR-A ⁄ LdUSP) is shown. Com-
pound 9: RH-5849, 10: halofenozide (RH-0345), 11: tebufenozide
(RH-5992), 12: methoxyfenozide (RH-2485), 13: chromafenozide
(ANS-118).
No.
N
N
H
O
O
Xn
Yn
Binding affinity
L. decemlineata
X
n
Y

n
pIC
50
(M)
1 2-Cl 3-Cl 5.33
2 2-Cl 4-NO
2
4.33
3 2-Cl 2,4-Cl
2
4.58
4 2-OCH
3
H 5.42
5 2-O
sec
C
3
H
7
H 3.88
6 4-CF
3
H 3.27
7 2,5-Cl
2
3-CF
3
5.51
8 3,5-(CH

3
)
2
H 4.35
9 H H 4.97
10 H 4-Cl 5.23
11 3,5-(CH
3
)
2
4-C
2
H
5
5.18
12 3,5-(CH
3
)
2
2-CH
3
-3-OCH
3
5.94
13 3,5-(CH
3
)
2
2-CH
3

-3,4-(CH
2
)
3
O- 5.77
14 PonA 8.13
15 20E 6.36
16 Ecdysone 4.98
17 Makisterone A 5.76
18 Cyasterone 6.29
A
B
Fig. 6. Relationships among biological activities. (A) Receptor-bind-
ing affinity (pIC
50
: M) of ecdysone agonists against the receptor of
L. decemlineata is compared to that of C. suppressalis. Triangles:
ecdysteroids. Circles: DBHs. (B) Receptor-binding affinity (pIC
50
:M)
and larvicidal activity (pLD
50
:mM ⁄ insect) of DBHs against
L. decemlineata [52,55] were compared.
Molting hormone receptors of L. decemlineata T. Ogura et al .
4120 FEBS Journal 272 (2005) 4114–4128 ª 2005 FEBS
A ⁄ B region might play different roles and be important
for determining the function of the EcR-A, which is dif-
ferent among insect species.
The functional analysis of LdEcR-A and LdUSP

The gel mobility shift assay showed that the complex
of in vitro translated LdEcR-A and LdUSP proteins
bound to EcREs, indicating that cDNAs cloned in this
study encode functional EcR and USP. LdEcR-A
alone also bound to EcREs, although the binding was
much weaker than that of LdEcR-A ⁄ LdUSP. The
binding experiment of EcR and USP proteins to
EcREs was also conducted in dipteran D. melanogaster
[2], A. aegypti [65] and C. tentans [17], and lepidopteran
B. mori [60], C. suppressalis [13] and C. fumiferana
[15]. In those experiments, EcR alone did not bind to
EcRE, which is different from the result of this study.
The degree of mobility shift of a band which is caused
by monomeric binding of LdEcR-A alone should be
much smaller than that by LdEcR-A ⁄ LdUSP. How-
ever, the degree of band retardation by addition of
LdEcR-A alone was a little larger than that of LdEcR-
A ⁄ LdUSP. Therefore LdEcR-A alone appeared to
bind to EcREs as a homodimer. Homodimeric binding
to DNA sequences is reported for vertebrate THR,
which shows similar characteristics to EcR [67,68].
Furthermore, it is concerned that the determinant of
the binding type of nuclear receptors to its response
element, namely monomer, homodimer and heterodi-
mer, is the nucleic acid sequence of the hormone
response element [69]. Thus, perhaps pal1 and hsp27
probes, which are not intrinsic EcREs of L. decemlin-
eata, enable LdEcR-A to form a homodimer.
From the ligand binding assays using [
3

H]PonA, the
K
D
value of ponA for LdEcR-A ⁄ LdUSP is 2.8 nm.
The K
D
value was close to that for CsEcR-B1 ⁄ CsUSP
(C. suppressalis) and DmEcR ⁄ DmUSP (D. melanogas-
ter), which have been reported to be about 1.0 nm
[3,45]. Thus, it was shown that in vitro translated
LdEcR-A ⁄ LdUSP heterodimers are capable of inter-
acting with ligands with high affinity, and possess a
required ability for a receptor.
The ligand binding affinity of LdEcR-A/LdUSP
As shown in Fig. 6A, receptor-binding affinities of
ecdysteroids were well correlated between LdEcR-
A ⁄ LdUSP and CsEcR ⁄ CsUSP, whereas this is not
the case for DBHs. As shown in Table 1, sequence
homology of ligand binding domains between
LdEcR-A and lepidopteran CsEcR-A is considerably
lower than those between LdEcR-A and coleopteran
TmEcR-A. Therefore, the difference between struc-
tures of ligand binding domain is most likely respon-
sible for the difference in receptor-binding affinities
of DBHs among different insect orders. On the other
hand, the ligand binding domain should have a sub-
stantial conservation in the structure which is neces-
sary for ecdysteroid binding regardless of insect
orders, because 20E is believed to be the most active
form of molting hormone in all insects. The crystal

structure analysis of EcR of lepidopteran H. virescens
indicated the amino acid residues which are import-
ant for the binding with PonA and a DBH analog
BYI06830 [44]. We examined the conservation of
these amino acid residues among several insects by
comparing the sequences of the ligand binding
domain of EcRs (Fig. 7). As expected, amino acids
which have been shown to be important for ecdyster-
oids-binding are highly conserved among all insects.
Thus, probably the structure of EcR ligand binding
domain is also conserved among insects for arran-
ging these amino acid residues in proper location to
accommodate an ecdysteroid molecule. However,
amino acids which have been shown to be important
for binding with BYI06830 are also well conserved
among EcRs. The difference in receptor-binding
affinity of DBHs among insect orders might rather
be attributed to the amino acid residues which are
considered to be involved in binding to both types
of ligands. Amino acids which are corresponding to
Met429 and Thr451 of LdEcR-A represent the pos-
sibility, as they are different between EcR-As of lepi-
dopteran and other insects. Further studies such as
point mutation and X-ray crystal structure analysis
of various EcRs will elucidate the factors responsible
for difference of the binding of DBHs to EcRs
among insects.
We previously reported that larvicidal activity and
receptor-binding of DBHs are correlated very well in C.
suppressalis, suggesting that receptor-binding affinity of

DBHs is concerned to rule the strength of their larvicid-
al activity [45]. Among DBHs, it was reported that halo-
fenozide (RH-0345) has a high insecticidal activity
against coleopteran field pests such as Popillia japonica
and L. decemlineata, but tebufenozide (RH-5992), meth-
oxyfenozide (RH-2485) and chromafenozide (ANS-118)
were not so potent against these insects [43]. Thus, based
on the case of DBHs in C. suppressalis, the receptor-
binding affinity of RH-0345 was expected to be high in
L. decemlineata. However, the receptor-binding affinity
of RH-0345 and the other three DBHs to LdEcR-
A ⁄ LdUSP was low (Table 2). Furthermore, the binding
affinity of RH-2485 and ANS-118 was higher than that
of RH-0345. This means that the receptor-binding
T. Ogura et al. Molting hormone receptors of L. decemlineata
FEBS Journal 272 (2005) 4114–4128 ª 2005 FEBS 4121
affinity of DBHs is not a major factor to determine the
larvicidal activity in L. decemlineata. To make this
point clear, we tested the receptor-binding affinity of
other DBHs against LdEcR-A ⁄ LdUSP (Table 2). The
measured binding affinity of 12 DBHs (1–12; Table 2)
did not show any correlation to the larvicidal activity
(Fig. 6B). Furthermore, our previous SAR study
demonstrated that hydrophobicity of compounds is
important to larvicidal activity of DBHs against C. sup-
pressalis; thus the hydrophobicity is important for
receptor-binding affinity. However, the hydrophobicity
of DBHs was not correlated to their receptor-binding
activity to LdEcR-A ⁄ LdUSP, although existence of
optimal hydrophobicity for larvicidal activity of DBHs

against L. decemlineata was shown in our previous
study [52,55]. Therefore, other factors such as absorp-
tion through the membrane and metabolism in the
insect body might play a very important role. Otherwise,
although DBHs are considered to show potency as
agonists of 20E in C. suppressalis by binding to
EcR ⁄ USP, there is a possibility that different mecha-
nisms, such as neurotoxicity and the existence of other
receptors, give influence on the larvicidal activity of
DBHs in L. decemlineata. Further study such as X-ray
crystal structure analyses of EcR ⁄ USP and metabolic
analyses of DBHs in various insects would confer new
knowledge of the mode of action of DBHs.
A recent study of phylogenic analysis suggests that
EcR and USP have coevolved during diversification
of insects [70], which is supported by the result of
this study (Table 1). It was also suggested that EcRs
and USPs of lepidopteran and dipteran insects are
under a strong acceleration of evolutionary rate in
comparison with those of insects in other orders.
This raises a possibility that the results of studies for
EcRs and USPs of lepidopteran and dipteran insects
are not necessary applicable for those of insects in
other orders. Therefore, although a number of stud-
ies has been conducted in lepidopteran and dipteran
insects, more detailed studies on EcR and USP of
insects in other orders and other ecdysozoan
are necessary for precise understanding of their
physiology.
In conclusion, we successfully performed cDNA

cloning of EcR and USP of L. decemlineata, and
in vitro translation of corresponding receptor proteins.
The translated proteins could bind to EcREs and
ecdysone agonists as heterodimers, indicating that
they are functional molting hormone receptors of
L. decemlineata.AsL. decemlineata is a major pest in
agriculture world-wide, the receptor proteins isolated
in this study can be very helpful to develop effective
compounds in high throughput assays and SAR stud-
ies. Furthermore, although EcR and USP proteins
have been isolated from various insects, the down-
stream of the ecdysone signaling pathway which is
triggered by their activation function of transcription
still remains to be elucidated. The isolated genes and
Fig. 7. Comparison of the ligand binding domain sequence of EcRs. Amino-acid sequences are compared for ligand binding domain of EcRs.
LdEcR: L. decemlineata EcR, TmEcR: T. molitor EcR, LmEcR: L. migratoria EcR, D. melanogaster EcR, CcEcR: Ceratitis capitata EcR (Gen-
Bank accession number AJ224341), AaeEcR: A. aegypti EcR (P49880), CtEcR: Chironomus tentans EcR (P49882), CsEcR: C. suppressalis
EcR, CfEcR: C. fumiferana EcR (U29531), HvEcR: H. virescens EcR (O18473), BmEcR: B. mori EcR (P49881). Sequences are separated in
three groups according to insect orders. The upper three sequences are EcRs of insects belonging to orders other than Diptera and Lepidop-
tera. The middle four (shaded with light gray) are EcRs of dipteran insects, and the lower four are that of lepidopteran insects. Amino-acid
residues which are important for the binding with PonA are shaded with dark gray, and that of BYI06830 are boxed [47]. The position of
LdEcR-A Met429 and Thr451 are shown by arrow heads. Activation function 2 (AF-2) is indicated with dots. Amino acids which correspond
to a-helical structures are also indicated.
Molting hormone receptors of L. decemlineata T. Ogura et al .
4122 FEBS Journal 272 (2005) 4114–4128 ª 2005 FEBS
proteins will also be available to study protein–pro-
tein interactions in such hormonal regulatory path-
ways, and be helpful to understand the complicated
physiology of insects.
Experimental procedures

Chemicals
Ecdysone and 20E were purchased from Sigma Chemical
Co. (St Louis, MO, USA) and PonA was from Invitrogen
Corp. (Carlsbad, CA, USA). Tritiated ponasterone A
([
3
H]PonA, 150 CiÆmm
)1
) was purchased from American
Radiolabeled Chemicals Inc. (St. Louis, MO, USA). Ecdy-
steroids (cyasterone and makisterone A) and all DBHs were
from our stock samples [52,55].
Isolation of RNA from L. decemlineata
Larvae and adults of L. decemlineata were reared as des-
cribed previously [63]. A L. decemlineata cell line (BCIRL-
Lepd-SL1), which was established from female pupae, was
routinely maintained as described previously [71]. Total
RNA was isolated from the whole bodies and tissues of last
instar (4th) larvae and adults using TRIzolÒ (Gibco BRL,
Grand Island, NY, USA) as described previously [13].
BCIRL-Lepd-SL1 was also used for isolation of total
RNA. Poly (A)-rich RNA was purified from the total RNA
using mRNA Purification Kit (Amersham Bioscience Corp.,
Piscataway, NJ, USA).
RT-PCR
Reverse-transcription was conducted using ReadyÆToÆ
Go
TM
T-Primed First-Strand Kit (Amersham Bioscience
Corp.) for total RNA isolated from the fat body and

integument of last instar larvae. Three forward and
reverse degenerate primers were designed for EcR based
on amino acid sequences conserved in C-E regions of
other EcRs (Table 3). In the same way, two forward and
one reverse degenerate primers were designed for USP
using the homology in C region of other USPs (Table 3).
The first PCR for EcR was conducted using LdEcR-F1
and LdEcR-R1 primers (annealing temperature: 48 °C).
Subsequently, the second and the third nested PCR were
performed with LdEcR-F2 and LdEcR-R2 primers
(52 °C) and with LdEcR-F3 and LdEcR-R3 primers
(46 °C), respectively. The first PCR with LdUSP-F1 and
LdUSP-R1 primers and the second nested PCR with
LdUSP-F2 and LdUSP-R1 primers were conducted for
USP. Annealing was performed at 48 °C and 46 °C,
respectively.
Rapid amplification of cDNA ends
Poly (A)-rich RNA extracted from L. decemlineata cells
was subjected to the 5¢- and 3¢- rapid amplification of
cDNA ends (RACE) with SMART
TM
RACE cDNA
amplification kit (Clontech, Palo Alto, CA, USA). For
both of EcR and USP, two reverse primers for 5¢-RACE
and two forward primers for 3¢-RACE were designed
(Table 3). 5¢-RACE for EcR was executed by PCR with
primer LdEcR-RR1, and 3¢-RACE for EcR was per-
formed with LdEcR-RF1, respectively, according to manu-
facturer’s instructions. 5¢-RACE and 3¢-RACE were
followed by nested PCR using LdEcR-RR2 (annealing

temperature: 66 °C), LdEcR-RF2 (66 °C), respectively. In
the same way, 5¢-RACE for USP was executed with
LdUSP-RR1, and 3¢-RACE for USP with LdUSP-RF1.
Each RACE reactions were followed by nested PCR
Table 3. Primers used in this study. Degenerate primers and 5¢-and3¢-RACE primers are shown. The term N means a mixture of A, T, G
and C. In the same way, D (A, G, T), H (A, C, T), K (G, T), M (A, C), R (A, G), S (C, G), W (A, T) and Y (C, T) means a mixture of deoxynucleo-
side.
L. decemlineata EcR L. decemlineata USP
Degenerate primers
LdEcR-F1 WSNGGNTAYCAYTAYAAYGC LdUSP-F1 ATHTGYGGNGAYMGNGC
LdEcR-F2 GARGGNTGYAARGGNTTYTT LdUSP-F2 GGNAARCAYTAYGGNGTNTA
LdEcR-F3 TGMGNMGNAARTGYCARGARTG LdUSP-R1 TCYTCYTGNACNGCYTC
LdEcR-R1 TCNSWRAADATNRCNAYNGC
LdEcR-R2 CATCATNACYTCNSWNSWNSWNGC
LdEcR-R3 AAYTCNACDATNARYTGNACNGT
5¢-RACE
LdEcR-RR1 GGTGATATAGGCTTGACTCCGTTGA LdUSP-RR1 GGCATCTGTTTCTTTGTCGCTTGTC
LdEcR-RR2 ACACACTCTGCCCTCATTCCTACGG LdUSP-RR2 CTCCCGGCAAGCGTAAGACAAATC
3¢-RACE
LdEcR-RF1 CCGTAGGAATGAGGGCAGAGTGTGT LdUSP-RF1 GATTTGTCTTACGCTTGCCGGGAG
LdEcR-RF2 CATTCATCGTCTCGTGTATTTCCAG LdUSP-RF2 GACAAGCGACAAACAGATGCC
T. Ogura et al. Molting hormone receptors of L. decemlineata
FEBS Journal 272 (2005) 4114–4128 ª 2005 FEBS 4123
using LdUSP-RR2 (68 °C) and LdUSP-RF2 (68 °C),
respectively.
DNA sequencing and sequence analysis
PCR products were purified by agarose gel electrophoresis
and cloned into the pGEM-T Easy vector (Promega
Corp., Madison, WI, USA). These cloned cDNAs were se-
quenced using a CEQ 2000 Dye Terminator Cycle Sequen-

cing Quick Start Kit (Beckman Coulter, Inc., Fullerton,
CA, USA) via an automatic sequencer CEQ 2000 DNA
Analysis System (Beckman Coulter, Inc.). Sequencing of
some cDNA fragments was requested to Shimadzu Corp.
(Kyoto, Japan). Sequences were analyzed using genetyx-
win version 5.1.0 (Software Development Co., Tokyo,
Japan).
Northern hybridization
Northern hybridization analysis was performed for total
RNA prepared from tissues of L. decemlineata and
BCIRL-Lepd-SL1. Total RNA (20 lg) in modified Mops
buffer solution (25.3 mm Mops, 18.4% v ⁄ v formaldehyde,
57.5% v ⁄ v deionized formamide, 9.2% v ⁄ v glycerol,
0.18 mgÆmL
)1
bromophenol blue, 0.18 mgÆmL
)1
xylene
cyanole and 0.4 mm EDTA) was denatured at 65 °C for
15 min and immediately transferred on ice. This RNA
sample was separated on 1% agarose gel (20 mm Mops,
5mm sodium acetate, 0.5 mm EDTA and 18% deionized
formaldehyde) and hydrolyzed in 50 mm NaOH solution
for 25 min. After neutralization with 0.2 m acetic acid
solution for 20 min · 2, separated RNA was transferred
to a Hybond–XL nylon membrane (Amersham Bioscience
Corp.). The blotting buffer was 20· SSPE (3 m NaCl,
173 mm NaH
2
PO

4
,25mm EDTA, pH ¼ 7.4). Three anti-
sense RNA probes for LdEcR were prepared by in vitro
transcription reaction with [
32
P]UTP[aP] (15 TBqÆmm
)1
,
Institute of Isotopes Co., Budapest, Hungary) using
Strip-EZ
TM
RNA kit (Ambion Inc., Austin, TX, USA).
These probes were designed from a region which is
shared by LdEcR-A and LdEcR-B1 (LdEcR common
probe, position 1142–2306; DDBJ ⁄ EMBL ⁄ GenBank nuc-
leotide sequence database accession number AB211191), a
region which is specific to LdEcR-A (LdEcR-A probe,
position 431–995; AB211191) and a region specific to
LdEcR-B1 (LdEcR-B1 probe, position 89–429;
AB211192). In the same way, an antisense RNA probe
for LdUSP (LdUSP probe) was prepared (position 368–
1524; AB211193). After prehybridization of the blotted
membrane at 65 °C for 2 h, hybridization was conducted
for 18 h at 65 °C in phosphate buffer (0.25 m disodium
hydrogenphosphate, 1 mm EDTA, 7% w ⁄ v SDS). The
membrane was then washed successively at 65 °C with
2· SSPE (0.1% SDS), 1· SSPE (0.1% SDS) and
0.1· SSPE (0.1% SDS). Signals were detected using a
bioimaging analyzer BAS-2000 (Fuji Photo Film Co. Ltd,
Tokyo, Japan).

In vitro transcription ⁄ translation and gel mobility
shift assay
Full length DNA fragments of LdEcR and LdUSP were
amplified by PCR and cloned into the pET-23a(+) vector
(Novagen, Darmstadt, Germany). Using these constructs,
LdEcR and LdUSP proteins were in vitro transcribed and
translated by T
N
TÒ T7 Coupled Reticulocyte Lysate
Systems (Promega) according to manufacturer’s instruction.
In vitro translated proteins, which contained [
35
S]methion-
ine (> 30 TBqÆ mm
)1
, Institute of Isotopes Co.), were sep-
arated in 10% SDS ⁄ polyacrylamide gel and analyzed using
BAS-2000.
Gel mobility shift assay was conducted with in vitro
translated LdEcR and LdUSP as described previously in
the presence or absence of 20E (40 lm) [12]. The synthetic
Pal1 was labeled with [
32
P]dCTP (111 TBqÆmm
)1
, Institue
of Isotopes Co.) using Megaprime
TM
DNA labeling systems
(Amersham Bioscience Corp.) and used as a probe. In com-

petition experiments, 100-fold excess of unlabelled Pal1 was
included in the reaction mixture.
Ligand binding assay
Ligand binding assay was performed as described previ-
ously [45]. Briefly, in vitro translated LdEcR and ⁄ or
LdUSP proteins were incubated with [
3
H]PonA
(5.55 TBqÆmm
)1
) for 90 min at 25 °C. 1000-fold excess of
unlabeled PonA was added to measure nonspecific bind-
ing, and dimethylsulfoxide (DMSO) was for total bind-
ing. After incubation, entire reaction mixtures were
filtered through NC45 nitrocellulose membrane filters
(0.45 lm, Schleicher & Schuell, Dassel, Germany) or GF-
75 glass filters (0.30 lm, Advantec, Dublin, CA, USA).
There was no difference between assays using these two
filters. Filters were washed and transferred to the vial
with 3 mL of Aquasol-2 (PerkinElmer Inc., Wellesley,
MA, USA) to measure the radioactivity by a liquid scin-
tillation counter, Aloka LSC-1000 (Aloka Co., Ltd,
Tokyo, Japan). The same procedure was used to deter-
mine the receptor-binding affinity of ecdysone agonists
listed in Table 2, by adding various concentrations
of these compounds to reaction mixtures with 5 nm
[
3
H]PonA. For each compound, the concentration-
response curve for the binding of [

3
H]PonA was derived
from 8 concentrations, including an excess concentration
(11 lm) of PonA (positive control) and DMSO (negative
control), respectively, to evaluate IC
50
values, the concen-
tration required for 50% inhibition of binding of 5 nm
[
3
H]PonA. pIC
50
s, reciprocal logarithmic values of IC
50
,
were used as an index of receptor-binding affinity.
Molting hormone receptors of L. decemlineata T. Ogura et al .
4124 FEBS Journal 272 (2005) 4114–4128 ª 2005 FEBS
Acknowledgements
We express our sincere gratitude to Sankyo Agro Co.,
Ltd. and Nippon Kayaku Co., Ltd. for the gift of
chromafenozide. Dr Cynthia Goodman and Art McIn-
tosh are acknowledged for the BCIRL-Lepd-SL1 cell
line (USDA-ARS, Missouri, MO, USA). We also
would like to thank Dr Taiji Nomura (Division of
Applied Bioscience, Department of Agriculture, Kyoto
University) for his very important technical advice.
Part of this study was performed in the RI center of
Kyoto University. This study was supported, in part,
by a grant-in-aid for Scientific Research (09660117,

10161207) and the 21st century COE program for
Innovative Food and Environmental Studies Pioneered
by Entomomimetic Sciences, from the Ministry of
Education, Culture, Sports, Science and Technology
of Japan. Dr Guy Smagghe acknowledges the support
of Research Grant 1.5.161.05 of the Fund for Scienti-
fic Research-Flanders (FWO, Brussels, Belgium).
Dr Chieka Minakuchi is a recipient of a Research
Fellowship from the Japan Society for the Promotion
of Science for Young Scientists.
References
1 Riddiford LM, Cherbas P & Truman JW (2001) Ecdy-
sone receptor and their biological actions. In Vitamins
and Hormones (Litwack, G, ed.), pp. 1–73. Academic
Press, San Diego, CA, USA.
2 Yao TP, Segraves WA, Oro AE, McKeown M & Evans
RM (1992) Drosophila ultraspiracle modulates ecdysone
receptor function via heterodimer formation. Cell 71,
63–72.
3 Yao TP, Forman BM, Jiang Z, Cherbas L, Chen JD,
McKeown M, Cherbas P & Evans RM (1993) Func-
tional ecdysone receptor is the product of EcR and
Ultraspiracle genes. Nature 366, 476–479.
4 Koelle MR, Talbot WS, Segraves WA, Bender MT,
Cherbas P & Hogness DS (1991) The Drosophila EcR
gene encodes an ecdysone receptor, a new member of
the steroid receptor superfamily. Cell 67, 59–77.
5 Talbot WS, Swyryd EA & Hogness DS (1993) Droso-
phila tissues with different metamorphic responses to
ecdysone express different ecdysone receptor isoforms.

Cell 73, 1323–1337.
6 Oro AE, McKeown M & Evans RM (1990) Relation-
ship between the product of the Drosophila ultraspiracle
locus and the vertebrate retinoid X receptor. Nature
347, 298–301.
7 Cho WL, Kapitskaya MZ & Raikhel AS (1995)
Mosquito ecdysteroid receptor: analysis of the cDNA
and expression during vitellogenesis. Insect Biochem
Mol Biol 25, 19–27.
8 Kapitskaya M, Wang S, Cress DE, Dhadialla TS &
Raikhel AS (1996) The mosquito ultraspiracle homolo-
gue, a partner of ecdysteroid receptor heterodimer: clon-
ing and characterization of isoforms expressed during
vitellogenesis. Mol Cell Endocrinol 121, 119–132.
9 Swevers L, Drevet JR, Lunke MD & Iatrou K (1995)
The silkmoth homolog of the Drosophila ecdysone
receptor (B1 isoform): cloning and analysis of expres-
sion during follicular cell differentiation. Insect Biochem
Mol Biol 25, 857–866.
10 Kamimura M, Tomita S & Fujiwara H (1996) Molecu-
lar cloning of an ecdysone receptor (B1 isoform) homo-
logue from the silkworm, Bombyx mori, and its mRNA
expression during wing disc development. Comp Bio-
chem Physiol 113B, 341–347.
11 Tzertzinis G, Malecki A & Kafatos FC (1994) BmCF1,
a Bombyx mori RXR-type receptor related to the Droso-
phila ultraspiracle. J Mol Biol 238, 479–486.
12 Minakuchi C, Nakagawa Y, Kiuchi M, Tomita S &
Kamimura M (2002) Molecular cloning, expression ana-
lysis and functional confirmation of two ecdysone recep-

tor isoforms from the rice stem borer Chilo suppressalis.
Insect Biochem Mol Biol 32, 999–1008.
13 Minakuchi C, Nakagawa Y, Kiuchi M, Seino A,
Tomita S & Kamimura M (2003) Molecular cloning
and expression analysis of ultraspiracle (USP) from the
rice stem borer Chilo suppressalis. Insect Biochem Mol
Biol 33, 41–49.
14 Perera SC, Ladd TR, Dhadialla TS, Krell PJ, Sohi SS,
Retnakaran A & Palli SR (1999) Studies on two
ecdysone receptor isoforms of the spruce budworm,
Choristoneura fumiferana . Mol Cell Endocrinol 152,
73–84.
15 Perera SC, Palli SR, Ladd TR, Krell PJ & Retnakaran A
(1998) The ultraspiracle gene of the spruce budworm,
Choristoneura fumiferana: cloning of cDNA and develop-
mental expression of mRNA. Dev Genet 22, 169–179.
16 Imhof MO, Rusconi S & Lezzi M (1993) Cloning of a
Chironomus tentans cDNA encoding a protein (cEcRH)
homologous to the Drosophila melanogaster ecdysteroid
receptor (dEcR). Insect Biochem Mol Biol 23, 115–124.
17 Vogtli M, Imhof MO, Brown NE, Rauch P, Spindler-
Barth M, Lezzi M & Henrich VC (1999) Functional
characterization of two ultraspiracle forms (CtUSP-1
and CtUSP-2) from Chironomus tentans. Insect Biochem
Mol Biol 29, 931–942.
18 Saleh DS, Zhang J, Wyatt GR & Walker VK (1998)
Cloning and characterization of an ecdysone receptor
cDNA from Locusta migratoria. Mol Cell Endocrinol
143, 91–99.
19 Hayward DC, Bastiani MJ, Trueman JW, Truman JW,

Riddiford LM & Ball EE (1999) The sequence of
Locusta RXR, homologous to Drosophila ultraspiracle,
and its evolutionary implications. Dev Genes Evol 209,
564–571.
T. Ogura et al. Molting hormone receptors of L. decemlineata
FEBS Journal 272 (2005) 4114–4128 ª 2005 FEBS 4125
20 Fujiwara H, Jindra M, Newitt R, Palli SR, Hiruma K &
Riddiford LM (1995) Cloning of an ecdysone receptor
homolog from Manduca sexta and the developmental
profile of its mRNA in wings. Insect Biochem Mol Biol
25, 845–856.
21 Jindra M, Huang JY, Malone F, Asahina M & Riddi-
ford LM (1997) Identification and mRNA develop-
mental profiles of two ultraspiracle isoforms in the
epidermis and wings of Manduca sexta. Insect Mol Biol
6, 41–53.
22 Mouillet JF, Delbecque JP, Quennedey B & Delacham-
bre J (1997) Cloning of two putative ecdysteroid
receptor isoforms from Tenebrio molitor and their
developmental expression in the epidermis during meta-
morphosis. Eur J Biochem 248, 856–863.
23 Nicolai M, Bouhin H, Quennedey B & Delachambre J
(2000) Molecular cloning and expression of Tenebrio
molitor ultraspiracle during metamorphosis and in vivo
induction of its phosphorylation by 20-hydroxyecdy-
sone. Insect Mol Biol 9, 241–249.
24 Dhadialla TS & Tzertzinis G (1997) Characterization
and partial cloning of ecdysteroid receptor from a cot-
ton boll weevil embryonic cell line. Arch Insect Biochem
Physiol 35, 45–57.

25 Martinez A, Scanlon D, Gross B, Perara SC, Palli SR,
Greenland AJ, Windass J, Pongs O, Broad P & Jepson I
(1999) Transcriptional activation of the cloned Heliothis
virescens (Lepidoptera) ecdysone receptor (HvEcR)
by muristeroneA. Insect Biochem Mol Biol 29, 915–930.
26 Chung AC, Durica DS, Clifton SW, Roe BA &
Hopkins PM (1998) Cloning of crustacean ecdysteroid
receptor and retinoid-X receptor gene homologs and
elevation of retinoid-X receptor mRNA by retinoic acid.
Mol Cell Endocrinol 139, 209–227.
27 Guo X, Harmon MA, Laudet V, Mangelsdorf DJ &
Palmer MJ (1997) Isolation of a functional ecdysteroid
receptor homologue from the ixodid tick Amblyomma
americanum (L.). Insect Biochem Mol Biol 27, 945–962.
28 Guo X, Xu Q, Harmon MA, Jin X, Laudet V, Mangels-
dorf DJ & Palmer MJ (1998) Isolation of two functional
retinoid X receptor subtypes from the Ixodid tick,
Amblyomma americanum (L.). Mol Cell Endocrinol 139,
45–60.
29 Ashburner M, Chihara C, Meltzer P & Richards G
(1974) Temporal control of puffing activity in polytene
chromosomes. Cold Spring Harbor Symp Quant Biol 38,
655–662.
30 Thummel CS (1997) Dueling orphans – interacting nuc-
lear receptors coordinate Drosophila metamorphosis.
Bioessays 19, 669–672.
31 Sedkov Y, Cho E, Petruk S, Cherbas L, Smith ST,
Jones RS, Cherbas P, Canaani E, Jaynes JB & Mazo A
(2003) Methylation at lysine 4 of histone H3 in ecdy-
sone-dependent development of Drosophila. Nature 426,

78–83.
32 Bai J, Uehara Y & Montell DJ (2000) Regulation of
invasive cell behavior by taiman, a Drosophila protein
related to AIB1, a steroid receptor coactivator amplified
in breast cancer. Cell 103, 1047–1058.
33 Tsai CC, Kao HY, Yao TP, McKeown M & Evans
RM (1999) SMRTER, a Drosophila nuclear receptor
coregulator, reveals that EcR-mediated repression is
critical for development. Mol Cell 4, 175–186.
34 Zhu J, Miura K, Chen L & Raikhel AS (2000) AHR38,
a homolog of NGFI-B, inhibits formation of the func-
tional ecdysteroid receptor in the mosquito Aedes
aegypti. EMBO J 19, 253–262.
35 Lan Q, Wu Z & Riddiford LM (1997) Regulation of
the ecdysone receptor, USP, E75 and MHR3 mRNAs
by 20-hydroxyecdysone in the GV1 cell line of the
tobacco hornworm, Manduca sexta. Insect Mol Biol 6,
3–10.
36 Riddiford LM, Hiruma K, Zhou X & Nelson CA
(2003) Insights into the molecular basis of the hormonal
control of molting and metamorphosis from Manduca
sexta and Drosophila melanogaster. Insect Biochem Mol
Biol 33, 1327–1338.
37 Langelan RE, Fisher JE, Hiruma K, Palli SR & Riddi-
ford LM (2000) Patterns of MHR3 expression in the
epidermis during a larval molt of the tobacco hornworm
Manduca sexta. Dev Biol 227, 481–494.
38 Kamimura M, Takahashi M, Tomita S, Fujiwara H
& Kiuchi M (1999) Expression of ecdysone receptor
isoforms and trehalase in the anterior silk gland of

Bombyx mori during an extra larval molt and
precocious pupation induced by 20-hydroxyecdysone
administration. Arch Insect Biochem Physiol 41,
79–88.
39 Eystathioy T, Swevers L & Iatrou K (2001) The orphan
nuclear receptor BmHR3A of Bombyx mori: hormonal
control, ovarian expression and functional properties.
Mech Dev 103, 107–115.
40 Jones G & Sharp PA (1997) Ultraspiracle: an inverte-
brate nuclear receptor for juvenile hormones. Proc Natl
Acad Sci USA 94, 13499–13503.
41 Jones G, Wozniak M, Chu Y, Dhar S & Jones D (2001)
Juvenile hormone III-dependent conformational changes
of the nuclear receptor ultraspiracle. Insect Biochem
Mol Biol 32, 33–49.
42 Maki A, Sawatsubashi S, Ito S, Shirode Y, Suzuki E,
Zhao Y, Yamagata K, Kouzmenko A, Takeyama K &
Kato S (2004) Juvenile hormones antagonize ecdysone
actions through co-repressor recruitment to EcR ⁄ USP
heterodimers. Biochem Biophys Res Commun 320, 262–
267.
43 Dhadialla TS, Carlson GR & Le DP (1998) New insec-
ticides with ecdysteroidal and juvenile hormone activity.
Annu Rev Entomol 43, 545–569.
44 Billas IM, Iwema T, Garnier J-M, Mitschler A,
Rochel N & Moras D (2003) Structural adaptability in
Molting hormone receptors of L. decemlineata T. Ogura et al .
4126 FEBS Journal 272 (2005) 4114–4128 ª 2005 FEBS
the ligand-binding pocket of the ecdysone hormone
receptor. Nature 426, 91–96.

45 Minakuchi C, Nakagawa Y, Kamimura M & Miyagawa
H (2003) Binding affinity of nonsteroidal ecdysone ago-
nists against the ecdysone receptor complex determines
the strength of their molting hormonal activity. Eur J
Biochem 270, 4095–4104.
46 Oikawa N, Nakagawa Y, Soya Y, Nishimura K, Kuri-
hara N, Ueno T & Fujita T (1993) Enhancement of
N-acetylglucosamine incorporation into the cultured
integument of Chilo suppressalis by molting hormone
and dibenzoylhydrazine insecticides. Pestic Biochem
Physiol 47, 165–170.
47 Oikawa N, Nakagawa Y, Nishimura K, Ueno T &
Fujita T (1994) Quantitative structure-activity studies of
insect growth regulators. X. Substituent effects on larvi-
cidal activity of 1-tert-butyl-1-(2-chlorobenzoyl)-2-(sub-
stituted benzoyl) hydrazines against Chilo suppressalis
and design synthesis of potent derivatives. Pestic Bio-
chem Physiol 48, 135–144.
48 Oikawa N, Nakagawa Y, Nishimura K, Ueno T &
Fujita T (1994) Quantitative structure-activity analysis
of larvicidal 1-(substituted benzoyl)-2-benzoyl-1-tert-
butylhydrazines against Chilo suppressalis. Pestic Sci 41,
139–148.
49 Nakagawa Y, Nishimura K, Oikawa N, Kurihara N &
Ueno T (1995) Activity of ecdysone analogs in enhan-
cing N-acetylglucosamine incorporation into the cul-
tured integument of Chilo suppressalis. Steroids 60,
401–405.
50 Nakagawa Y, Soya Y, Nakai K, Oikawa N, Nishimura
K, Ueno T, Fujita T & Kurihara N (1995) Quantitative

structure-activity studies of insect growth regulators. XI.
Stimulation and inhibition of N-acetylglucosamine
incorporation in a cultured integument system by substi-
tuted N-tert-butyl-N,N¢-dibenzoylhydrazines. Pestic Sci
43, 339–345.
51 Nakagawa Y, Hattori K, Shimizu B, Akamatsu M,
Miyagawa H & Ueno T (1998) Quantitative structure-
activity studies of insect growth regulators. XIV. Three
dimensional quantitative structure-activity relationship
of ecdysone agonists including dibenzoylhydrazine ana-
logs. Pestic Sci 53, 267–277.
52 Nakagawa Y, Smagghe G, Kugimiya S, Hattori K,
Ueno T, Tirry L & Fujita T (1999) Quantitative struc-
ture-activity studies of insect growth regulators. XVI.
Substituent effects of dibenzoylhydrazines on the insecti-
cidal activity to Colorado potato beetle Leptinotarsa
decemlineata. Pestic Sci 55, 909–918.
53 Nakagawa Y, Hattori K, Minakuchi C, Kugimiya S
& Ueno T (2000) Relationships between structure and
molting hormonal activity of tebufenozide, methoxy-
fenozide, and their analogs in cultured integument
system of Chilo suppressalis walker. Steroids 65,
117–123.
54 Nakagawa Y, Minakuchi C & Ueno T (2000) Inhibition
of [
3
H]ponasterone a binding by ecdysone agonists in
the intact Sf-9 cell line. Steroids 65, 537–542.
55 Nakagawa Y, Smagghe G, Van Paemel M, Tirry L &
Fujita T (2001) Quantitative structure-activity studies

of insect growth regulators. XVIII. Effects of substitu-
ents on the aromatic moiety of dibenzoylhydrazines on
larvicidal activity against the Colorado potato beetle
Leptinotarsa decemlineata. Pest Manag Sci 57,
858–865.
56 Nakagawa Y, Minakuchi C, Takahashi K & Ueno T
(2002) Inhibition of [
3
H]ponasterone A binding by
ecdysone agonists in the intact Kc cell line. Insect Bio-
chem Mol Biol 32, 175–180.
57 Minakuchi C, Nakagawa Y & Miyagawa H (2003)
Validity analysis of a receptor binding assay for ecdy-
sone agonists using cultured intact insect cells. J Pestic
Sci 28, 55–57.
58 Antoniewski C, Mugat B, Delbac F & Lepesant JA
(1996) Direct repeats bind the EcR ⁄ USP receptor and
mediate ecdysteroid responses in Drosophila melanogas-
ter. Mol Cell Biol 16, 2977–2986.
59 Riddihough G & Pelham HRB (1987) An ecdysone
response element in the Drosophila hsp27 promoter.
EMBO J 6, 3729–3734.
60 Swevers L, Cherbas L, Cherbas P & Iatrou K (1996)
Bombyx EcR (BmEcR) and Bombyx USP (BmCF1)
combine to form a functional ecdysone receptor. Insect
Biochem Mol Biol 26, 217–221.
61 Kamimura M, Tomita S, Kiuchi M & Fujiwara H
(1997) Tissue-specific and stage-specific expression of
two silkworm ecdysone receptor isoforms Ecdysteroid-
dependent transcription in cultured anterior silk glands.

Eur J Biochem 248, 786–793.
62 Jindra M, Malone F, Hiruma K & Riddiford LM
(1996) Developmental profiles and ecdysteroid regula-
tion of the mRNAs for two ecdysone receptor isoforms
in the epidermis and wings of the tobacco hornworm,
Manduca sexta. Dev Biol 180, 258–272.
63 Smagghe G, Bohm G-A, Richter K & Degheele D
(1995) Effect of nonsteroidal ecdysteroid agonists on
ecdysteroid titer in Spodoptera exigua and Leptinotarsa
decemlineata. J Insect Physiol 41, 971–974.
64 Lan Q, Hiruma K, Hu X, Jindra M & Riddiford LM
(1999) Activation of a delayed-early gene encoding
MHR3 by the ecdysone receptor heterodimer EcR-B1-
USP-1 but not by EcR-B1-USP-2. Mol Cell Biol 19,
4897–4906.
65 Wang SF, Li C, Zhu J, Miura K, Miksicek RJ &
Raikhel AS (2000) Differential expression and regula-
tion by 20-hydroxyecdysone of mosquito ultraspiracle
isoforms. Dev Biol 218, 99–113.
66 Hirai M, Shinoda T, Kamimura M, Tomita S & Shiot-
suki T (2002) Bombyx mori orphan receptor, BmHR78:
cDNA cloning, testis abundant expression and putative
T. Ogura et al. Molting hormone receptors of L. decemlineata
FEBS Journal 272 (2005) 4114–4128 ª 2005 FEBS 4127
dimerization partner for Bombyx ultraspiracle. Mol Cell
Endocrinol 189, 201–211.
67 Lazar MA, Berrodin TJ & Harding HP (1991) Differen-
tial DNA binding by monomeric, homodimeric, and
potentially heteromeric forms of the thyroid hormone
receptor. Mol Cell Biol 11, 5005–5015.

68 Glass CK (1994) Differential recognition of target genes
by nuclear receptor monomers, dimers, and hetero-
dimers. Endocr Rev 15, 391–407.
69 Forman BM, Casanova J, Raaka BM, Ghysdael J &
Samuels HH (1992) Half-site spacing and orientation
determines whether thyroid hormone and retinoic acid
receptors and related factors bind to DNA response ele-
ments as monomers, homodimers, or heterodimers. Mol
Endocrinol 6, 429–442.
70 Bonneton F, Zelus D, Iwema T, Robinson-Rechavi M
& Laudet V (2003) Rapid divergence of the ecdysone
receptor in Diptera and Lepidoptera suggests coevolu-
tion between ECR and USP-RXR. Mol Biol Evol 20,
541–553.
71 Long SH, McIntosh AH, Grasela JJ & Goodman CL
(2002) The establishment of a Colorado potato beetle
(Coleoptera: Chrysomelidae) pupal cell line. Appl Ento-
mol Zool 37, 447–450.
Molting hormone receptors of L. decemlineata T. Ogura et al .
4128 FEBS Journal 272 (2005) 4114–4128 ª 2005 FEBS