Báo cáo khoa học: Selecting cells with different Alzheimer’s disease c-secretase activity using FACS Differential effect of presenilin exon 9 deletion on c- and e-cleavage doc

Selecting cells with different Alzheimer’s disease c-secretase activity
using FACS
Differential effect of presenilin exon 9 deletion on c- and e-cleavage
M. Fleur Sernee
1
, Genevie
`
ve Evin
1
, Janetta G. Culvenor
1
, Jose
´
A. Villadangos
2
, Konrad Beyreuther
3
,
Colin L. Masters
1
and Roberto Cappai
1
1
Department of Pathology, The University of Melbourne and The Mental Health Research Institute, Parkville, Victoria,
Australia;
2
The Walter and Eliza Hall Institute of Medical Research, Parkville, Victoria, Australia;
3
Center for Molecular Biology,
ZMBH, University of Heidelberg, Heidelberg, Germany
The ultimate step in Alzheimer’s disease Ab generation

involves c-secretase, which releases Ab from its membrane-
bound precursor. A similar presenilin-dependent proteolytic
activity is implicated in the release of the Notch intracellular
domain. We have developed a novel assay for c-secretase
activity based on green fluorescent protein detection. This
involves cotransfection of a substrate-activator based on the
amyloid precursor protein or the Notch sequence and a
fluorescent reporter gene. Stable fluorescent cell populations
were selected by fluorescent activated cell sorting and char-
acterized. This assay enabled the identification and sorting of
populations, which differ in their levels of c-secretase acti-
vity, with high fluorescent cells producing more Ab than low
fluorescent cells. Specific c-secretase inhibitors, L-685,458
and MW167, reduced cell fluorescence in a dose-dependent
manner that paralleled inhibition of Ab secretion. Overex-
pression of presenilin 1 increased the cell fluorescence. Cells
expressing presenilin with different aspartate mutations
(D257A, D385A and D257A/D385A) or exon 9 deletion
mutation showed reduced fluorescence. The single aspartate
mutations showed a concomitant reduction in Ab secretion,
whereas the D257A/D385A and DE9 mutations had no
effect on Ab secretion.
Keywords: secretase; amyloid precursor protein; Notch;
presenilin; fluorescence-assay.
b-Amyloid (Ab) is the major constituent of Alzheimer’s
disease (AD) amyloid plaques and plays a key role in the
pathogenesis of AD. The 4.5-kDa Ab peptide, is derived
from the type I integral membrane amyloid precursor
protein (APP) [1–3]. Several groups have identified the
b-secretase activity that releases the N-terminus of Ab,asa

membrane-anchored aspartyl protease termed b-site-APP-
cleaving enzyme (BACE) [4]. Cleavage of APP by BACE
generates a sAPPb ectodomain and a 99 amino acid
C-terminal fragment containing Ab (termed bCTF, C99 or
A4CT) that remains anchored in the membrane. This bCTF
is cleaved by c-secretase, to produce Ab and the APP
intracellular domain (AICD or eCTF) that is released into
the cytosol [5–8]. c-Secretase has a loose sequence specificity
as it can cleave its substrate at various sites to produce Ab
peptides of different lengths [9–11]. c-Secretase activity is
associated with a high-molecular weight complex that
includes presenilin 1 (PS1) or presenilin 2 (PS2), nicastrin
and PEN-2 [12–14]. APH-1 is also required for c-secretase
activity and may be part of the complex [15–17]. Cells
expressing PS1 with artificial mutations of the aspartate
residues, amino acids 257 and 385, within the predicted
transmembrane domains 6 and 7 show reduced c-secretase
activity [18,19]. This has led to the suggestion that PS’s are
unusual aspartyl proteases. The Notch family of type I
membrane proteins are also processed within their trans-
membrane domains, at site 3 (S3) and site 4 (S4) by a
c-secretase-like activity that requires presenilin expression
[20–24]. Cleavage of Notch transmembrane domain releases
the Notch intracellular domain (NICD), which traffics to
the nucleus. This event is critical for the function of Notch in
the regulation of cellular proliferation and differentiation
[25], therefore therapeutic approaches based on c-secretase
inhibition will have to be selective for APP and should not
alter Notch signaling.
c-Secretase assays have generally been based on the

detection of Ab secreted from cell culture media. Recently,
several groups have developed cell-free assays in which
c-secretase activity was measured by detecting Ab with an
enzyme-linked immunosorbent assay or by visualizing Ab
and the corresponding 7-kDa CTF by immunoblotting. In
this report, we describe the development of a GFP-based
cell fluorescence assay that is specific for c-secretase
cleavages of either APP or Notch. This assay involves
cotransfection of eukaryotic cells with a substrate-activator
Correspondence to Dr Roberto Cappai, The University of Melbourne,
Parkville, Victoria 3010, Australia.
Fax: + 61 38344 4004, Tel.: + 61 38344 5882,
E-mail:
Abbreviations: AD, Alzheimer’s disease; APP, amyloid precursor
protein; Ab,amyloidb protein; BACE, b-site-APP-cleaving enzyme;
CTF, C-terminal fragment; ECL, enhanced chemiluminescence;
FAD, familial Alzheimer’s disease; FACS, fluorescence activated cell
sorter; FBS, fetal bovine serum; GFP, green fluorescent protein; IP,
immunoprecipitation; NICD, Notch intracellular domain; NP-40,
nonidet P-40; PS1, presenilin 1; PS2, presenilin 2; WT, wild type.
(Received 15 October 2002, accepted 29 November 2002)
Eur. J. Biochem. 270, 495–506 (2003) Ó FEBS 2003 doi:10.1046/j.1432-1033.2003.03405.x
and a reporter gene. The substrate-activator construct
mimics c-secretase substrates (based on Notch or APP)
fused to a transcription factor. Upon proteolytic processing
by c-secretase the activator domain is released and promotes
expression of a green fluorescent protein (GFP) reporter
gene. Thus c-secretase activity can be monitored by
measuring cell fluorescence. We show the application of
this assay to the testing of c-secretase inhibitors and PS1

mutants. This assay allows for the first time the selection of
cell populations and single cells by FACS based on their
differences in c-secretase activity that correlates with their
level of fluorescence. Therefore this assay could be applied
to the screening of cDNA libraries to identify genes that
modulate c-secretase activity.
Experimental procedures
DNA constructs
The APP-based substrate-activator plasmids: pcDNA3.1+/
SP-A4DCT-GV and pIRESpuro2/SP-A4DCT-GV. Both
constructs consisted of the signal peptide (SP) of APP and
the APP
695
(amino acids 597–653) sequence (A4DCT)
in frame with the GAL4 (G) and VP16 (V) sequences.
SP-A4DCT (259 bp) was PCR amplified from pCEP4/
SP-A4CT (gift from S. F. Lichtenthaler, ZMBH, Germany),
using primer 1 (5¢-CCCAAGCTTGGGTGCCCCGCGC
AGGGTCGCG-3¢) and primer 2 (5¢-GTACTGTTTCTT
CTTCAGCATCACC-3¢). The GAL4-VP16 DNA frag-
ment (678 bp) was produced by PCR from pGAL4-VP16
[26] (a gift from G. E. O. Muscat, University of Queensland,
St Lucia, Australia) with primer 3a (5¢-GGTGATGCTG
AAGAAGAAACAGTACATGAAGCTACTGTCTTC
TATCG-3¢) and primer 4 (5¢-GCTCTAGAGCTTCAC
GGATGCATTATCGATGGGCTC-3¢). Both DNA
fragments were mixed in equal molar concentrations
for splice-overlap PCR and cloned into pCDNA3.1+
(Invitrogen) or into pIRESpuro2 (Clontech) to enable the
control of gene transcription by adjusting the concentration

of puromycin.
The Notch-based substrate-activator plasmid:
pCDNA3.1+/SP-NOTL-GV. PCR was performed with
primer 3b (5¢-CCCAAGCTTATGAAGCTACTGTC
TTCTATCG-3¢) and primer 4 to amplify the GV-DNA
from the pCDNA3.1/SP-A4D CT-GV activator construct.
The GV-DNA fragment was cloned into pBS-SP-NOTL, a
Notch construct in pBS(SK
+
) that consisted of the signal
peptide of APP and amino-acids 1648–1927 of human
Notch-1 (containing the S1 and S2 cleavage sites, but not the
entire N-terminal domain). This construct was kindly
provided by C. Bergmann and T. Hartmann (ZMBH,
Germany). The resulting SP-NOTL-GV was subsequently
cloned into pCDNA3.1+.
The reporter plasmid: pSP72/5GAL-E1b-EGFP. The
p5Gal-E1b-CAT plasmid ([27], kindly provided by G. E.
O. Muscat) served as a PCR template to obtain the 5GAL-
E1b-TATA promotor region (214 bp) using primer 5
(5¢-CCCAAGCTTGGGCATGCCTGCAGGTCGGAG-3¢)
and primer 6 (5¢-TTTAGCTTCCTTAGCTCCTGA-3¢).
The EGFP-DNA (750 bp) was amplified from pSP64TK-
EGFP (obtained from H. Clarris, University of Melbourne,
Parkville, Australia) with primer 7 (5¢-TCAGGAGCTAA
GGAAGCTAAAATGGTGAGCAAGGGCGAG-3¢)and
primer 8 (5¢-CCGCTCGAGTTACTTGTACAGCTCGT
CCATGCC-3¢). The splice-overlap PCR-product was
cloned into pUC18 (NEB) and subsequently cloned into
pSP72. The hygromycin resistance gene was amplified

from the pCEP4 plasmid (Invitrogen) with primer 9
(5¢-GGACCAGACCCCACGCAACG-3¢)andprimer10
(5¢-GCCCTGCTTCATCCCCGTGG-3¢) and cloned into
the pSP72/5GAL-E1bEGFP construct at the NdeIsite.
The presenilin constructs, pIRESpuro2/PS1 WT, PS1
D257A, PS1 D385A, PS1 D257A/385 A and PS1
DE9. All PS1 constructs were cloned into the pIRESpuro2
plasmid. To obtain PS1 WT, RNA was extracted from
SH-SY5Y cells with TRIzol (Life Technologies), cDNA was
produced with the RNA PCR Core kit from Perkin Elmer
(Roche) and primers 11 (5¢-CTAGCTAGCATGACAGA
GTTACCTGCACC-3¢)and12(5¢-ATAGTTTAGCG
GCCGCTAGATATAAAATTGATGGAATGC-3¢)were
used to amplify presenilin DNA. DNA sequencing revealed
that some clones contained the sequence for the four amino
acids (VRSQ) in exon 3 while some did not. We used the
PS1 WT containing the VRSQ sequence. We used this
construct to create the D385A mutation using the Quik-
Change
TM
XL Site-Directed Mutagenesis Kit (Stratagene).
PS1 D257A and PS1 D257A/D385A, were obtained from
A. Weidemann and F. Reinhard (ZMBH, Heidelberg,
Germany) [8] and transferred from pCEP4 into pIRE-
Spuro2. The PS1 DE9 DNA, was PCR amplified with
primers 11 and 12 from pCDNA3.1/PS1 DE9 with an
N-terminal flag sequence (kindly provided by F. Reinhard)
and was cloned into pIRESpuro2. We thereby removed the
N-terminal flag sequence. The last three mutations did not
contain the VRSQ-sequence and therefore their mutations

would be at position D253A and D381A, but we have kept
the nomenclature similar to what is published in the
literature to avoid confusion.
Cell culture and transfection
COS-7 cells were maintained in DMEM with high glucose
(Life Technologies), and CHO cells were grown in RPMI-
1640 (ICN), supplemented with 10% (w/v) fetal bovine
serum (FBS) (CSL, Parkville, Australia) and penicillin
(50 UÆmL
)1
)/streptomycin (50 lgÆmL
)1
) (Life Technol-
ogies). Substrate-activator and reporter plasmids were
transfected in a 1 : 2 ratio, respectively, into COS-7 or
CHO cells using Lipofectamine 2000 reagent (Life Technol-
ogies) according to the manufacturer’s protocol. Stable
transfected cell lines were obtained after selection with
Hygromycin B (300 lgÆmL
)1
), Geneticin (500 lgÆmL
)1
)
(Life Technologies) or Puromycin (2.5–12.5 lgÆmL
)1
)
(Sigma).
Antibodies
The mouse monoclonal antibodies 1E8 [28], WO2, G2-10
(specific for Ab

40
)andG2-11(Ab
42
)[29]wereusedfor
immunoprecipitation and Western blotting of Ab.The
rabbit polyclonals anti-Gal4 DNA binding region (Upstate
496 M. F. Sernee et al. (Eur. J. Biochem. 270) Ó FEBS 2003
Biotechnology) and the anti-PS1 98/1 [30], were used for
immunoprecipitation of lysates. Sheep anti-mouse–horse-
radish peroxidase conjugate (Amersham) was used as
secondary antibody in the blotting procedure. Rabbit anti-
mouse Igs (Dako, CA, USA) were used to link the 1E8
and G210 mAbs to the protein A Sepharose CL-4B
(Pharmacia).
Radiolabeling, immunoprecipitation, gel electrophoresis
and Western blotting
To analyze protein expression and processing, cells were
starved for 45 min in methionine- and cysteine-free medium
(ICN), pulsed for 30 min in medium containing
1mCiÆmL
)135
S translabel mix (ICN) and chased for
60 min. Cell lysis and immunoprecipitation were performed
as described [31], with the modification that the samples
were equalized for their radioactive incorporation and pre-
cleared twice with 100 lL formalin-fixed, heat-inactivated
Staphylococcus aureus Cowan strain bacteria (Staph A,
10% v/v) before immunoprecipitation to reduce the back-
ground signal. Proteins were separated on 12% Tris-Tricine
gels and transferred to polyvinylidene fluoride membranes

(Millipore). The membrane was either exposed to a
phosphorimaging screen and analyzed with the
MACBAS V
2.0 imaging software (Fuji) or exposed to BioMax MR-1
film (Kodak) and the density of the bands quantified using
the
NIH
-
IMAGE
1.60 software. For Ab–Western blotting, the
cell culture medium (1 mL) was harvested from 10 cm
dishes seeded with similar number of cells (approximately
90% confluent) and Ab was immunoprecipitated with mAb
WO2, 1E8, G210 and G211. The immunoprecipitates were
resolved on 10–20% Tris-Tricine gels (Novex, Invitrogen)
and transferred to nitrocellulose. The membranes were
boiled for 5 min, blocked with 0.5% (w/v) casein, incubated
with primary antibody WO2, and developed by chemi-
luminescence reaction (ECL, Amersham). Ab release from
cells treated with inhibitors was determined from radio-
labeled cells. Cells were grown in 24 well plates and
preincubated with the c-secretase inhibitors in starvation
medium. After one hour incubation the medium was
replaced with labeling medium containing the inhibitors as
described above and incubated for 17 h.
FACS analysis and sorting
Cells were trypsinized and resuspended in NaCl/P
i
contain-
ing 10 m

M
EDTA and 1–2% FBS. Propidium iodide
(50 lgÆmL
)1
) was added to stain dead cells. Cells were kept
on ice until analysis with FACScan, or sorting using MoFlo,
Facs Star or FACS-II (Becton Dickinson). Analysis was
performed using the computer software program
WAESEL
1.2.1 (F. Battye, Walter and Eliza Hall Institute, Parkville,
Australia).
Analysis of presenilin 1 transfections
Cells stable transfected with PS1 were plated in triplicate (in
12-well plates). After 24 h medium was immunoprecipitated
with WO2 antibody to analyze Ab-secretion by Western
blotting as described above. Cells were washed and
prepared for FACS analysis as described above. The density
of the Ab-bands was quantitated and Ab-secretion was
calculated relative to the protein concentration of the lysates
prepared from the cells in each well, as determined by BCA
protein assay (Pierce).
Protease inhibitor treatment
Cells were plated into 12- or 24-well plates and incubated
for 72 h with various concentrations of inhibitor in a final
dimethylsulfoxide concentration of 0.5%. After 24 h the
medium was replaced with fresh medium containing
inhibitor. Inhibition of c-secretase activity was determined
by FACS analysis of the cells, using fluorescence as an
indication of GFP expression, and by immunoprecipita-
tion of radiolabeled-Ab from the culture media (as

described above). L-685,458 [32,33] and compound 2 were
obtained from M. Shearman (Merck Sharp and Dohme,
Terlings Park, UK) and MW167 [34] was purchased from
Calbiochem. E-64d (2S,3S)-trans-epoxysuccinyl-
L
-leucyl-
amido-3-methyl-butane ethyl ester and lactacystin were
from Sigma. Calpain inhibitor I, N-acetyl-Leu-Leu-nor-
leucinal (ALLN) and the caspase inhibitors Boc-D-FMK
and z-DEVD-FMK were purchased from Calbiochem.
The signal peptide peptidase inhibitor (Z-LL)
2
ketone [35],
was kindly provided by M. Bogyo (UCSF, San Francisco,
CA, USA).
Results
Assay design
This novel c-secretase assay involves cotransfection of a
substrate-activator and a reporter gene into mammalian
cells, as outlined in Fig. 1A. The substrate-activator
construct mimics c-secretase substrates, either based on
the APP or on the Notch sequence that are fused to the
transcription activator factor Gal4-VP16. It is expressed
with a signal peptide to ensure correct insertion and
orientation into the membrane. Proteolytic processing of
the substrate-activator protein by c-secretase releases the
activator domain into the cytosol, allowing it to promote
expression of the enhanced green fluorescent protein
(EGFP) reporter gene (Fig. 1A). Therefore, cells cotrans-
fected with the substrate-activator and reporter constructs

can be distinguished for their c-secretase activity by their
fluorescent appearance.
The APP substrate consists of the APP signal peptide
followed by two extra amino acids, leucine and glutamate
(LE), and the b-secretase C-terminal fragment of APP
(A4CT) minus the cytoplasmic domain. It has been shown
that the SP-LE-A4CT construct is a suitable c-secretase
substrate [36,37]. Our rationale behind the design of the
substrate-activator construct was to develop an assay to
screen specifically for the modulators of c-secretase activity.
The cytoplasmic domain of APP was shown to be sensitive
to caspase cleavage [38–40], thus we deleted most of the
cytoplasmic domain from the SP-LE-A4CT construct but
we retained the triple lysine, glutamine and tyrosine motif
(KKKQY) [41]. The Gal4-VP16 (GV) transcription factor
[42] binds to the reporter construct that contains five Gal4
binding sites. The herpes simplex virus protein VP16
promotes the expression of the EGFP reporter gene through
Ó FEBS 2003 Cell fluorescence c-secretase assay (Eur. J. Biochem. 270) 497
the E1b viral transcription initiation codon [27]. This APP-
based substrate-activator construct was named SP-A4DCT-
GV. A similar Notch-construct, termed SP-NOTL-GV, was
prepared that includes the APP signal peptide followed by
the human Notch 1 sequence (residues 1648–1927; including
the S1, S2 and S3 cleavage sites for furin, TACE and
c-secretase-like activity, respectively [21,23,43,44], fused to
the GV domain.
Co-transfection of both substrate-activator (SP-A4DCT-
GV) and reporter (5Gal-E1b-EGFP) DNA constructs into
COS-7 and CHO cells resulted in the expression of GFP

positive cells. Figure 1B shows phase (panels 1 and 3) and
fluorescence microscopy (panels 2 and 4) of COS-7 cells
transfected with both constructs (panels 3 and 4) or with an
empty pCDNA3.1+ plasmid plus the reporter (panels 1
and 2). Control cells that were mock-transfected with the
empty plasmid and the reporter construct did not express
GFP (Fig. 1B, panel 2) whereas cells expressing
SP-A4DCT-GV plus the reporter expressed GFP and were
fluorescent (Fig. 1B, panel 4). This demonstrates that
expression of GFP is totally dependent upon the release
of the activator domain (GV) from the SP-A4DCT-GV
substrate. Similarly, cells transfected with both SP-NOTL-
GV and the reporter displayed green fluorescence, indica-
ting release of the activator domain into the cytosol (data
not shown).
c-Secretase activity correlates with GFP expression
Correct membrane orientation and signal peptide cleavage
of the SP-A4DCT-GV construct was confirmed using
in vitro transcription/translation of the DNA constructs
according to Bunnell et al. [45] (data not shown). To
characterize the expression of the SP-A4DCT-GV substrate-
activator construct, metabolically labeled cells stably trans-
fected with the SP-A4DCT-GV plus reporter plasmids were
lysed and the proteins were immunoprecipitated with WO2
(anti-Ab) and anti-Gal Igs. Both antibodies showed reac-
tivity for a protein migrating at approximately 36 kDa, a
molecular mass consistent with that expected for expression
of the full length protein with glycosylation of the Gal4
binding domain (Fig. 2A; lanes 2–4). Immunoprecipitation
with WO2 depleted the anti-Gal4 reactive protein species

from the lysate, as shown by a marked reduction of the
signal in subsequent anti-Gal4 immunoprecipitation. This
result confirms that both antibodies target the same protein
(compare Fig. 2A; lanes 2–4). The 36 kDa protein was not
immunoprecipitated from control cells that do not express
the A4DCT-GV protein (Fig. 2A; lanes 1, 5 and 6).
Immunoprecipitation with anti-Gal yielded an additional
band of 31 kDa that was not detected by WO2 and is thus
N-terminally truncated. From its electrophoretic mobility,
this would correspond to the C-terminal fragment produced
by c-ore-secretase cleavage (Fig. 2A; lanes 3 and 4). The
31 kDa band was subjected to automated Edman degra-
dation. Counting of the fractions revealed a radioactive
signal in fractions 1 and 2, suggesting the presence of Met at
cycle 1 or/and 2 (data not shown). This data is consistent
with recent reports showing that eCTF starts with Val50
and is sensitive to amino peptidase degradation [7,8,46–48].
Immunoprecipitation of conditioned media from these cells
with WO2 and 1E8 mAbs showed Ab secretion. Immuno-
precipitation with Ab C-terminal specific antibodies dem-
onstrated that the predominant species secreted was Ab
40
(immunoreactive to G2-10) whereas Ab
42
(immunoreactive
to G2-11) was undetectable (Fig. 2B). Therefore correct
metabolism of the A4DCT-GV construct into Ab was
occurring. Anti-Gal immunoprecipitations of lysates of cells
stably transfected with Notch substrate-activator and
reporter constructs detected full-length NOTL-GV as a

64-kDa species and a cleavage product migrating at 49-kDa,
as expected for a site-3/c-secretase cleavage product
(Fig. 2A; lane 7).
The doubly transfected cells that expressed GFP showed
heterogeneity in their fluorescence intensity. Therefore
preparative FACS was used to sort stable low and high
fluorescent populations for use in further experiments
(Fig. 2C). At least three rounds of FACS sorting were
Fig. 1. The fluorescent reporter c-secretase assay. (A) Principle of the
assay. Cells are cotransfected with a substrate-activator and a reporter
cDNA constructs. The substrates are based on APP and Notch1
sequences genetically fused to Gal4-VP16 transcription activators.
c-Secretase cleavage releases the activator domain in the cytosol, which
can then traffic to the nucleus to initiate the transcription of the green
fluorescence protein (GFP) gene by binding to the 5Gal-E1b domain
of the GFP reporter construct. (B) Transfection of COS-7 cells with
both substrate-activator and reporter genes yielded fluorescent cells.
Double-transfected COS-7 cells were fixed and observed by phase
(panels 1 and 3) and fluorescence microscopy (panels 2 and 4). Phase
microscopy showed similar images of cells transfected with mock (1) or
SP-A4DCT (3) activator constructs. Fluorescence was observed in cells
transfected with the c-secretase substrate (4) but not in cells containing
the empty control plasmid (2).
498 M. F. Sernee et al. (Eur. J. Biochem. 270) Ó FEBS 2003
performed to obtain cell populations with a GFP expression
level that remained stable over time, as determined by
measurement of fluorescence intensity. To determine if the
fluorescence intensity paralleled Ab secretion we immuno-
precipitated Ab from the medium of metabolically labeled
cells expressing low and high levels of GFP. Figure 2C

shows that cells with a high level of fluorescence (as
determined by FACS) secrete more Ab than cells with
low fluorescence. This clearly shows that fluorescence is
dependent on c-secretase cleavage and correlates with Ab
production.
c-Secretase inhibitors decrease cell fluorescence
To confirm further the specificity of our assay, we tested the
effect of specific c-secretase inhibitors on the doubly
transfected cells. After incubation for 72 h in the presence
of inhibitors, the cells were analyzed by FACS for GFP
expression. Propidium iodide staining was used to gate for
live cells. In each sample we gated for the same number of
live cells. Quantitation was performed using the mean values
of the fluorescence intensity of the gated cells and converted
to percentages, to allow comparison between individual
experiments. Mock-transfected cells were considered as
nonfluorescent (0%) and the test cells treated with 0.5%
dimethylsulfoxide were regarded as 100% fluorescent (see
Fig. 3A).
A dose-dependent reduction of GFP expression was
observed with L-685,458, a potent inhibitor of c-secretase
activity [32,33]. Treatment of COS-7 cells expressing the
APP substrate with 1 l
M
L-685,458 resulted in a nearly total
loss of fluorescence (Figs 3B–D). A concentration of 5 l
M
of inhibitor was required to achieve similar results in the
same cell line expressing the Notch substrate (Fig. 3D). The
control inactive compound 2 had no effect. A marked

reduction of fluorescence was also observed when COS-7
cells expressing either substrate were incubated with the
difluoroketone inhibitor MW167 [34], at 50 l
M
concentra-
tion (Fig. 3D).
To confirm that c-secretase inhibition paralleled the loss
of fluorescence, the cell media were analyzed for Ab
production. Each inhibition experiment was initiated with
the same number of cells, but we observed that after 72 h
incubation the cells treated with MW167 were less confluent
than the control cells or those incubated with L-685,458.
Microscopic examination at 66 h confirmed that MW167
(‡ 50 l
M
) had a growth inhibiting/toxic effect on the cells as
judged by their morphology and density (data not shown).
Therefore, the effects of the inhibitors on Ab secretion and
substrate cleavage were determined by immunoprecipitation
after 17 h incubation in the presence of
35
Slabel.Ab
secretion was decreased in a dose-dependent manner upon
treatment with L-685,458 and was almost totally abolished
at 1 l
M
concentration (Fig. 3B). MW167 also had a
pronounced effect on Ab secretion at 50 l
M
,thesame

concentration that dramatically reduced the cell fluores-
cence. As expected, an accumulation of APP substrate,
which corresponds to bCTF, was observed upon inhibitor
treatment (data not shown).
The effect of the c-secretase inhibitors was also studied in
CHO cells to confirm our findings in a different cell line. The
inhibitors were 2–10 times less potent in CHO cells
Fig. 2. Characterization of the assay. (A) The substrate-activator
constructs are correctly expressed and proteolytically processed in
mammalian cells. COS-7 cells stably transfected with empty vector
(–, lanes 1, 5 and 6), SP-A4DCT-GV (A, lanes 2–4) or SP-NOTL-GV
(N, lane 7) constructs were pulsed for 30 min and chased for 1 h. Cell
lysates were analyzed by immunoprecipitation (IP) with anti-Gal
(lanes 1–3, and 5 and 7) or anti-Ab (WO2, lanes 4 and 6) Igs. Both
antibodies recognized the expected 36-kDa glycosylated protein
A4DCT-GV (lanes 2–4), while anti-GAL4 also recognized the 31-kDa
cleaved C-terminal fragment of A4DCT-GV (CTFc-GV) (lanes 2 and
3). Lanes 3 and 5 correspond to cell lysates immunoprecipitated
sequentially (seq-IP) with anti-Gal Ig after WO2; lanes 4 and 6 cor-
respondtotheWO2IPs.Asexpected,NOTL-GVisexpressedasa
64-kDa protein and the anti-GAL4 reactive fragment of 49-kDa has
the correct size to represent the N-terminally truncated NICD-GV
product from site-3 cleavage (lane 7). (B) IP of the conditioned medium
from cells transfected with SP-A4DCT-GV with anti-Ab Igs followed
by Western blotting with WO2 detected the presence of Ab peptide
(lanes 5–7). G2-10 (Ab
40
; lane 7) but not G2-11 (Ab
42
;lane8)immu-

noprecipitated the 4-kDa species, indicating that the cells secreted
mostly Ab40. Ab was undetectable in medium from mock-transfected
cells (lanes 1–4). (C) Fluorescence intensity varied between individual
cells, reflecting different levels of GFP expression. Low and high GFP-
expressing populations were isolated by preparative FACS. A typical
histogram is shown. The dotted line are mock-transfected cells, the
grey solid line represents the population sorted for low expression of
GFP, while the black solid line are the cells expressing high levels of
GFP. Levels of secreted Ab were analyzed from these low and high
fluorescent populations, which were grown overnight in six-well plates
in medium containing 1 mCiÆmL
)135
SusingWO2.
Ó FEBS 2003 Cell fluorescence c-secretase assay (Eur. J. Biochem. 270) 499
transfected with the APP substrate than in COS-7 cells.
5 l
M
L-685,458 reduced the fluorescence levels nearly to
zero, independent of the eukaryotic expression plasmid used
(Fig. 3C). MW167 also reduced the GFP expression, but
was5timeslesspotentthanL-685,458.
Effect of c-secretase inhibitors on the fluorescence
of cells expressing the Notch substrate
Although it has been shown that a similar cleavage releases
the intracellular domains of APP and Notch, it remains
unclear whether the same proteolytic activity is involved.
Therefore we compared the effect of c-secretase inhibitors
on both substrates. The effect of the L-685,458 and MW167
was less pronounced on cells expressing the Notch substrate
than on the cells expressing the APP substrate but the

relative order of potency was conserved, i.e. L-685,458 was
fivefold more potent than MW167 (Fig. 3D). A fivefold
higher concentration of L-685,458 was required to reduce
the level of fluorescence in the Notch-substrate transfected
cells to the same level as in APP substrate transfected
cells. At all concentrations tested (0.1 l
M
,0.5l
M
and
1 l
M
), L-685,458 caused a significant decrease in relative
fluorescence, whereas the control inactive compound 2, had
a very marginal effect (Fig. 3D).
Effect of cysteine protease, proteasome, caspase, and
signal peptide peptidase inhibitors on GFP-expression
The level of GFP expression could not be reduced to zero
even after a 72-h incubation with the potent c-secretase
inhibitor, L-685,458. This may reflect the stability of the
GFP protein, which has a 24-h half-life. Alternatively the
activator domain could be released by more than one
Fig. 3. Specific c-secretase inhibitors abolish cell fluorescence. Stable
populations of green-fluorescent cells expressing substrate-activator
and reporter genes were incubated for 72 h in the presence of 0.5%
dimethylsulfoxide containing various concentrations of c-secretase
inhibitors then analyzed by FACS. (A) Relative fluorescence was
calculated as the ratio of mean linear fluorescence (MLF) of inhibitor-
treated cells (grey solid line) to the MLF of DMSO treated cells (black
solid line) after subtraction of the MLF of the mock-transfected cells

(dotted line). (B) Comparison of the effect of the c-secretase inhibitors
on Ab secretion (open bars) and cell fluorescence (grey bars). Cells
were metabolically labeled for 17 h in the presence of inhibitors. Ab
was immunoprecipitated from the media with WO2, resolved on
10–20% Tris-Tricine gels and analyzed by phosphoimaging using
MACBAS
2.0 software. Relative c-secretase activity (Ab-secretion) was
calculated for each experiment towards the signal obtained for cells
treated with 0.5% dimethylsulfoxide only, after subtraction of the
Ab-signal obtained for mock-transfected cells. Relative fluorescence
(relative c-secretase activity) was calculated as described in panel A.
(C) Effect of c-secretase inhibitors on fluorescence of CHO cells stably
transfected with SP-A4DCT-GV cloned in pcDNA3.1 (open bars) or
in pIRESpuro2 plasmids (grey bars). (D) Comparison of the effect of
c-secretase inhibitors on APP c-secretase (AICD-release) (open bars)
and Notch S3 cleavage (NICD-release) (grey bars) in the fluorescent
reporter assays. *P < 0.05, **P < 0.005, ***P <0.001;n represents
the number of individual experiments analyzed.
500 M. F. Sernee et al. (Eur. J. Biochem. 270) Ó FEBS 2003
proteolytic activity [31]. To test the latter hypothesis other
inhibitors were also applied in the COS-7 cell fluorescence
assay, including in particular proteasome and caspase
inhibitors. The inhibitors lactacystin (0.5 l
M
and 1 l
M
),
ALLN (10 l
M
)andMG132(10l

M
and 100 l
M
)hada
toxic effect on the cells as determined by microscopic
examination. The dead cells were stained with propidium
iodide and were excluded during FACS analysis. Table 1
summarizes the results of the inhibitor treatments. Among
the inhibitors tested only the caspase inhibitor DEVD-
FMK showed a significant, but very slight (7%) decrease in
fluorescence in cells expressing the APP substrate. Lacta-
cystin and the other inhibitors did not decrease the
fluorescence in cells transfected with the Notch substrate,
confirming that the fluorescence observed was mostly due to
c-secretase cleavage. The cysteine protease inhibitor E-64d
significantly increased the fluorescence, particularly in the
cells expressing the Notch substrate. As c-secretase cleavage
resembles the cleavage of signal peptides by signal peptide
peptidases (SPP), an inhibitor of SPP was also tested in our
assay. Both c-secretase and SPP cleave their substrates
within the middle of the transmembrane region. It was
recently shown that a gene identified for its homology to
presenilin and termed presenilin homologue 3 (PSH3) [49]
corresponds to SPP. Thus the inhibitor of signal peptide
peptidase-activity (Z-LL)
2
ketone, was tested in our assay
[35,50]. This inhibitor showed no significant effect on the cell
fluorescence at 1, 2 and 10 l
M

on both APP and Notch
substrates (Table 1) and did not affect Ab-secretion (data
not shown).
Effect of presenilin 1 expression on fluorescence
and Ab-secretion
Presenilin is required for 40–42 cleavage, or c cleavage (for
the release of Ab
40)42
), and 49 cleavage, or e cleavage, of
APP. The precise cleavage mechanism is unknown and data
using PS1 dominant-negative aspartate mutations have
been controversial. We determined the effect of transfecting
wild type (WT) PS1 and PS1 mutants (PS1 D257, PS1
D385A, PS1 D257/385) on the cell fluorescence in our APP-
based assay. We also tested the effect of the PS1 exon-9
deletion mutation (PS1 DE9). This mutation prevents PS1
endoproteolysis and causes an aggressive form of early
onset AD with abundance of amyloid positive cotton-wool
plaques [51,52]. We compared the effect of these mutations
on cell fluorescence and Ab-secretion. For each PS1 mutant
several transfections were performed and stable cell lines
were obtained. The cell lines with a high level of expression
of PS1 were selected for the study (Fig. 4A). Results of nine
individual experiments show that transfection with PS1 WT
resulted in a 2.2-fold increase in fluorescence as compared to
mock (Fig. 4B), which was similar to the effect seen on
Ab-secretion (a 2.8-fold increase in Ab-secretion compared
to mock) (Fig. 4D). Transfection of cells with PS1 bearing
the single (PS1 D257A or PS1 D385A) or the double
aspartate mutations (PS1 D257A/D385A) caused a decrease

in cell fluorescence as compared to cells transfected with PS1
WT (n ¼ 7) (Fig. 4C). The level of fluorescence was below
the level of mock-transfected cells, indicating displacement
of endogenous PS1. The PS1 DE9 mutation caused an
increase in fluorescence, but not to the same level as PS1 WT
(n ¼ 7) (Fig. 4C). We observed a significant reduction in
Ab-secretion from the cells transfected with PS1 D257A and
PS1 D385A as compared to those transfected with PS1 WT
(Fig. 4E). Expression of PS1 D257A/D385A and PS1 DE9
mutations did not change Ab-secretion significantly as
compared to expression of PS1 WT (results from 4
individual experiments) (Fig. 4E).
Discussion
We have developed a novel GFP-based assay to character-
ize c-secretase. The advantage of this assay over existing
systems is that it allows the isolation of cells with stable
differences in c-secretase activity. We established that the
differences in fluorescence correlated with Ab production
with the high fluorescent cells expressing more Ab than the
low fluorescent cells. Therefore the release of the GAL4-
VP16 domain provides a direct measure of c-secretase
activity. This assay has a definite advantage over traditional
Ab-antibody based assays, such as ELISA and immuno-
precipitation, for measuring c-secretase activity by allowing
a direct measure of c-secretase activity. The Ab-antibody
assays would be affected by factors which affect Ab
turnover and clearance. An alternative assay has recently
been described that uses luciferase as the reporter molecule
[53,54]. The luciferase-based assay has the advantage over
the GFP assay of being more quantitative, but it cannot

compensate for dead cells that would clearly affect the
Table 1. Comparative effect of various protease inhibitors on the fluor-
escence of cells transfected with SPA4DCT-GAL-VP or SP-NOTL-
GVP plus the GFP reporter. The number of independent experiments is
indicated by n.
Inhibitor
Relative fluorescence (%)
A4DCT-GV NOTL-GV
E-64d
10 l
M
123 ± 10 (n ¼ 4)* 150 ± 16 (n ¼ 3)*
5 l
M
116 ± 19 (n ¼ 5) 137 ± 34 (n ¼ 3)
N-Acetyl-Leu-Leu-norleucinal
10 l
M
113 ± 7 (n ¼ 4) 149 ± 27 (n ¼ 3)
5 l
M
106 ± 10 (n ¼ 4) 114 ± 12 (n ¼ 4)
Lactacystin
1 l
M
62 ± 20 (n ¼ 4) 110 ± 39 (n ¼ 4)
0.5 l
M
76 ± 24 (n ¼ 4) 97 ± 34 (n ¼ 4)
0.1 l

M
115 ± 23 (n ¼ 2) 95 ± 20 (n ¼ 3)
Boc-D-FMK
10 l
M
96 ± 3 (n ¼ 2) 97 ± 1 (n ¼ 2)
5 l
M
97 ± 3 (n ¼ 2) 97 ± 2 (n ¼ 2)
DEVD-FMK
10 l
M
93 ± 1 (n ¼ 2)* 97 ± 4 (n ¼ 2)
5 l
M
93 ± 0 (n ¼ 2)*** 96 ± 3 (n ¼ 2)
(Z-LL)
2
10 l
M
132 ± 13 (n ¼ 2) 98 ± 7 (n ¼ 2)
2 l
M
105 ± 0 (n ¼ 2)*** 109 ± 6 (n ¼ 3)
1 l
M
155 ± 26 (n ¼ 2) 110 ± 6 (n ¼ 2)
*P < 0.05, ***P < 0.001.
Ó FEBS 2003 Cell fluorescence c-secretase assay (Eur. J. Biochem. 270) 501
readout. Furthermore, proteasome inhibitors can interfere

directly with luciferase reporter enzymes [55].
The GFP-assay was adapted for studying c-secretase
cleavage of Notch. Both cleavages of APP- and Notch-based
substrates were modulated by known c-secretase inhibitors.
We found that inhibition of Ab secretion correlated with the
observed decrease in fluorescence determined by FACS
analysis, but they were never identical (see Fig. 3B). This
discrepancy may reflect the different experimental condi-
tions used (17 h vs. 72 h incubation with inhibitors) and/or
different methods of measurement (fluorescence assay,
which measures expression of the GFP, as compared to
immunoprecipitation of Ab secreted in the culture media).
Our results suggest that the proteolytic activity required for
cleavage at position Leu49 is not identical to that cleaving at
position Val40. The fluorescent assay measures the release of
the cytoplasmic domain into the cytosol, which we have
shown is cleaved at Leu49 whereas the Ab assay measures a
species that is cleaved at position 40. However, both
methods clearly measured a dose-dependent decrease in
c-secretase cleavage with specific c-secretase inhibitors and
the relative potency of L-685,458 and MW167 (over 50-fold)
was the same for both assays. This is consistent with
previous reports [32–34] and suggests that the same proteo-
lytic machinery produces Ab and the C-terminal cytosolic
fragment.
Differences in potency of the inhibitors in the alternative
cell types might reflect differences in processing between cell
lines as observed by other groups [32,56]. Our results show
an approximately 50-fold difference in potency between
L-685,458 and MW167 which is consistent with a previous

report using a luciferase reporter assay [53]. These effective
concentrations of both inhibitors on c-secretase activity also
correspond to their potency as determined from Ab
secretion [32,56,57]. We observed a difference in potency
of inhibition between Notch and APP substrates. The
effective concentrations from our data did not correspond
to those obtained by Taniguchi and coworkers in HEK293
cells using a luciferase-based assay [54]. This might reflect
differences in cell lines and substrates, because they observed
different effects of the L-685,458 inhibitor depending on the
Notch substrate used (greater inhibition with Notch 3 than
Notch 1). Furthermore, they show that there is a Notch
receptor cleavage that depends on, but is not directly
executed by presenilins, and cannot be inhibited by
Fig. 4. Effects of presenilin 1 mutations on fluorescence and Ab-secre-
tion. Greenfluorescentcells(transfectedwiththeAPP-basedsubstrate-
activator and reporter) were transfected with PS1 WT or mutants. (A)
Stable cell populations were produced and cell-lysates were analyzed
for PS1 expression with the 98/1, anti-PS1-NTF, Igs. (B) Analysis by
FACS shows that transfection with PS1 WT increases the fluorescence
by an average of 2.2-fold as compared to mock-transfection (n ¼ 9).
(C) Results of seven individual experiments show that each PS1
mutation tested decreases the fluorescence significantly as compared to
PS1 WT (right panel). (D) PS1 WT transfection increased the Ab
secretion to 2.8-fold as compared to mock (average of five experi-
ments). (E) PS1 D257A and PS1 D385A caused a significant reduction
in Ab secretion as compared to PS1 WT. PS1 D257A/D385A and PS1
DE9 had no significant effect on Ab secretion. Conditioned medium
was removed from the cells prior to FACS analysis and immunopre-
cipitated with WO2. Densitometry values were determined for each

Ab band and standardized for amount of protein in each well. The
results of four individual experiments are shown. **P <0.005,
***P < 0.001.
502 M. F. Sernee et al. (Eur. J. Biochem. 270) Ó FEBS 2003
c-secretase inhibitors and by immunoprecipitation with
anti-PS Igs.
The signal peptide peptidase inhibitor (Z-LL)
2
-ketone,
was unable to inhibit c-secretase activity when tested at 1, 2
and 10 l
M
concentrations. This could reflect the opposite
membrane orientation of the active-site motifs YD and
LGLGD in the predicted transmembrane 6 and 7 of this
protein compared to these motifs in PS [50]. The slight
inhibitory effect of the caspase inhibitor DEVD-FMK
shows that its contribution to the cell fluorescence is minor.
This result could explain why we never observed total loss of
fluorescence of the cells even when Ab secretion was nil. The
increase in fluorescence observed with the E64-d inhibitor
suggests that a cysteine protease degrades the Notch
substrate, making less protein available for c-secretase
cleavage. The Notch substrate contains the entire cytosolic
domain whereas the APP does not, thus it is likely that the
protease inhibited by E-64d processes the Notch construct
within the cytosolic domain. Furthermore cysteine protease
activity has been reported to remove PS1 fragments that are
not incorporated into the complex as well as the holoprotein
itself [58] and therefore inhibition of this activity could

increase the levels of PS1 and therefore increase c-secretase
activity.
To test whether the assay could identify differences in
c-secretase activity due to changes in components of the
c-secretase complex, we overexpressed WT PS1 and some
PS1 mutations. The original data by Wolfe and coworkers
[18] that the aspartate residues were critical for PS-mediated
cleavage of APP were reproduced in our GFP-based assay.
We were able to decrease the fluorescence levels below those
of the mock-transfected cells, indicating some displacement
of the endogenous PS. However, we were unable to achieve
complete inhibition of cell fluorescence by these mutants, as
we were unable to replace all the endogenous PS with the
exogenously expressed PS1. In PS1 D257A/D385A trans-
fected cells we observed a decrease in fluorescence and
therefore a decrease in AICD release, while the Ab levels
remain unchanged. Kim and coworkers [59] observed a
similar decrease in intracellular domain release and no effect
on Ab-secretion when they expressed PS1 D257A/D385A in
N2A cells. Together with Yu and coworkers [60,61] they
also showed that aspartate mutations alter APP-trafficking.
Overexpression of PS1 DE9 resulted in only a 40% increase
of fluorescence as compared to PS1 WT, but did not
significantly alter Ab-levels. Chen and coworkers recently
reported that expression of PS1 DE9 increased Ab
42
levels,
but inhibited cleavage at the e-site and the release of AICD
[62]. Therefore our data provide further evidence that c-and
e-cleavage can be differentially affected by PS1 mutations.

This strengthens the hypothesis that the c-secretase complex
could have multiple active sites, multiple conformations or
one active site and at least two different substrate binding
sites for c-ande-cleavage [63,64]. The PS1 DE9 deletion
mutation, like the single aspartate mutations, affects the
maturation of the high molecular weight complex compo-
nents that constitute the c-secretase activity [60]. These
mutations could thus affect the components present in the
complex. PS1 DE9 overexpression results in normal Ab
secretion, but reduced fluorescence, indicating reduced CTF
release from the membrane even in the presence of Ab
production. This suggests that c-cleaved CTF remains
anchored in the membrane and can therefore not activate
the reporter gene transcription. We are currently investi-
gating the presence of membrane-anchored c-cleaved CTF
in brain cortex of PS1 DE9 carriers, PS1 DE9 lympho-
cytes and other cell-models. Alternatively the intracellular
domain could be released in a different compartment,
because of altered trafficking of the substrate caused by the
PS1 mutation, and is either rapidly degraded or unable to
reach the reporter gene.
In conclusion, these results show that our GFP reporter
assays based on APP or Notch c-secretase substrates can be
used to specifically study modulation of c-secretase activity
in parallel in various cell types. Results of the inhibitor study
suggest possible differences in the proteolytic activities or
pathways that cleave the APP and Notch constructs. The
use of these parallel assays could facilitate the search for
compounds that target APP processing and have a lesser
effect on Notch. The variations we observed between cell

types might reflect physiological differences in protein
processing and should be taken into account during the
development of therapeutics. Our GFP assay allows for
direct readout of c-secretase activity without the use of
antibodies and could be further developed into high
throughput screens. These can also be applied to the study
of other membrane protein substrates with cleavages
regulated by presenilins, such as Erb-B4 [65,66], E-cadherin
[67], LRP-receptor [68] and CD44 [69]. An advantage of the
GFP-based assay is that it facilitates the selection of
different cell populations by FACS that vary in their
fluorescence intensity. This can be used to screen cDNA
libraries for genes that modulate c-secretase activity.
Complete identification and further characterization of this
activity is required for a better understanding of the
development of Alzheimer’s disease in early and late onset
cases.
Acknowledgments
This study was supported by grants from the National Health and
Medical Research Council of Australia, the Clive and Vera Ramaciotti
Foundation and Merck Sharp and Dohme. We thank Drs
S. Lichtenthaler, G. Muscat, H. Clarris, C. Bergmann, T. Hartmann,
F. Reinhard and A. Weidemann for providing DNA-constructs and
advice, and Ms. F. Katsis for protein sequencing. We thank Dr
M. Shearman and Dr M Bogyo for providing inhibitors. We thank Drs
S. Mok, A. Hill and N. Williamson for helpful discussions.
References
1. Nunan, J. & Small, D.H. (2000) Regulation of APP cleavage by a-,
b-andc-secretases. FEBS Lett. 483, 6–10.
2. Selkoe, D.J. (2001) Alzheimer’s disease: genes, proteins, and

therapy. Physiol. Rev. 81, 741–766.
3. Evin, G. & Weidemann, A. (2002) Biogenesis and metabolism of
Alzheimer’s disease Ab amyloid peptides. Peptides 23, 1285–1297.
4. De Strooper, B. & Konig, G. (1999) Alzheimer’s disease. A firm
base for drug development. Nature 402, 471–472.
5. McLendon, C., Xin, T., Ziani-Cherif, C., Murphy, M.P., Findlay,
K.A., Lewis, P.A., Pinnix, I., Sambamurti, K., Wang, R., Fauq,
A. & Golde, T.E. (2000) Cell-free assays for c-secretase activity.
FASEB J. 14, 2383–2386.
6. Pinnix, I., Musunuru, U., Tun, H., Sridharan, A., Golde, T.,
Eckman, C., Ziani-Cherif, C., Onstead, L. & Sambamurti, K.
Ó FEBS 2003 Cell fluorescence c-secretase assay (Eur. J. Biochem. 270) 503
(2001) A novel c-secretase assay based on detection of the putative
C-terminal fragment-c of amyloid b protein precursor. J. Biol.
Chem. 276, 481–487.
7. Yu, C., Kim, S.H., Ikeuchi, T., Xu, H., Gasparini, L., Wang, R. &
Sisodia, S.S. (2001) Characterization of a presenilin-mediated
amyloid precursor protein carboxyl-terminal fragment c. Evidence
for distinct mechanisms involved in c-secretase processing of the
APP and Notch1 transmembrane domains. J. Biol. Chem. 276,
43756–43760.
8. Weidemann, A., Eggert, S., Reinhard, F.B., Vogel, M., Paliga, K.,
Baier, G., Masters, C.L., Beyreuther, K. & Evin, G. (2002) A novel
epsilon-cleavage within the transmembrane domain of the Alz-
heimer amyloid precursor protein demonstrates homology with
Notch processing. Biochemistry 41, 2825–2835.
9. Lichtenthaler,S.,Wang,R.,Grimm,H.,Uljon,S.,Masters,C.L.
& Beyreuther, K. (1999) Mechanism of the cleavage specificty of
alzheimer’s disease c-secretase identified by phenylalanine-scan-
ning mutagenesis of the transmembrane domain of the amyloid

precursor protein. Proc. Natl Acad. Sci. USA 96, 3053–3058.
10. Golde, T.E., Eckman, C.B. & Younkin, S.G. (2000) Biochemical
detection of Ab isoforms: implications for pathogenesis, diagnosis,
and treatment of Alzheimer’s disease. Biochim. Biophys. Acta
1502, 172–187.
11. Murphy, M.P., Hickman, L.J., Eckman, C.B., Uljon, S.N., Wang,
R. & Golde, T.E. (1999) c-Secretase, evidence for multiple pro-
teolytic activities and influence of membrane positioning of sub-
strate on generation of amyloid b peptides of varying length.
J. Biol. Chem. 274, 11914–11923.
12. Fortini, M.E. (2001) Notch and presenilin: a proteolytic mech-
anism emerges. Curr. Opin. Cell Biol. 13, 627–634.
13. Esler, W.P., Kimberly, W.T., Ostaszewski, B.L., Ye, W., Diehl,
T.S., Selkoe, D.J. & Wolfe, M.S. (2002) Activity-dependent iso-
lation of the presenilin-c-secretase complex reveals nicastrin and a
c substrate. Proc. Natl Acad. Sci. USA 99, 2720–2725.
14. Steiner, H., Winkler, E., Edbauer, D., Prokop, S., Basset, G.,
Yamasaki, A., Kostka, M. & Haass, C. (2002) PEN-2 is an
integralcomponentofthec-secretase complex required for
coordinated expression of presenilin and nicastrin. J. Biol. Chem.
277, 39062–39065.
15. Goutte, C., Tsunozaki, M., Hale, V.A. & Priess, J.R. (2002) APH-
1 is a multipass membrane protein essential for the Notch sig-
naling pathway in Caenorhabditis elegans embryos. Proc. Natl
Acad. Sci. USA 99, 775–779.
16. Francis, R., McGrath, G., Zhang, J., Ruddy, D.A., Sym, M.,
Apfeld, J., Nicoll, M., Maxwell, M., Hai, B., Ellis, M.C., Parks,
A.L.,Xu,W.,Li,J.,Gurney,M.,Myers,R.L.,Himes,C.S.,Hie-
bsch, R., Ruble, C., Nye, J.S. & Curtis, D. (2002) aph-1 and pen-2
are required for Notch pathway signaling, c-secretase cleavage of

bAPP, and presenilin protein accumulation. Dev. Cell 3, 85–97.
17. Lee,S.F.,Shah,S.,Li,H.,Yu,C.,Han,W.G.&Yu,G.(2002)
Mammalian APH-1 interacts with presenilin and nicastrin, and
is required for intramembrane proteolysis of APP and Notch.
J. Biol. Chem. 277, 45013–45019.
18. Wolfe, M.S., Xia, W., Ostaszewski, B.L., Diehl, T.S., Kimberly,
W.T. & Selkoe, D.J. (1999) Two transmembrane aspartates in
presenilin-1 required for presenilin endoproteolysis and c-secretase
activity. Nature 398, 513–517.
19. Steiner, H., Duff, K., Capell, A., Romig, H., Grim, M.G., Lincoln,
S. & Hardy, J., Yu, X., Picciano, M., Fechteler, K., Citron, M.,
Kopan, R., Pesold, B., Keck, S., Baader, M., Tomita, T., Iwat-
subo, T., Baumeister, R. & Haass, C. (1999) A loss of function
mutation of presenilin-2 interferes with amyloid b-peptide pro-
duction and notch signalling. JBiolChem.274, 28669–28673.
20. Levitan, D. & Greenwald, I. (1995) Facilitation of lin-12-mediated
signalling by sel-12, a Caenorhabditis elegans S182 Alzheimer’s
disease gene. Nature 377, 351–354.
21. De Strooper, B., Annaert, W., Cupers, P., Saftig, P., Craessaerts,
K., Mumm, J.S., Schroeter, E.H., Schrijvers, V., Wolfe, M.S.,
Ray, W.J., Goate, A. & Kopan, R. (1999) A presenilin-1-depen-
dent gamma-secretase-like protease mediates release of Notch
intracellular domain. Nature 398, 518–522.
22. Chan, Y.M. & Jan, Y.N. (1999) Presenilins, processing of beta-
amyloid precursor protein, and notch signaling. Neuron 23,
201–204.
23. Kopan, R. & Goate, A. (2000) A common enzyme connects
notch signaling and Alzheimer’s disease. Genes Dev. 14, 2799–
2806.
24. Okochi, M., Steiner, H., Fukumori, A., Tanii, H., Tomita, T.,

Tanaka, T., Iwatsubo, T., Kudo, T., Takeda, M. & Haass, C.
(2002) Presenilins mediate a dual intramembranous gamma-
secretase cleavage of Notch-1. EMBO J. 21, 5408–5416.
25. Mumm, J.S. & Kopan, R. (2000) Notch signaling: from the out-
side in. Dev. Biol. 228, 151–165.
26. Muscat, G.E., Downes, M. & Dowhan, D.H. (1995) Regulation of
vertebrate muscle differentiation by thyroid hormone: the role of
the myoD gene family. Bioessays 17, 211–218.
27. Lillie, J.W. & Green, M.R. (1989) Transcription activation by the
adenovirus E1a protein. Nature 338, 39–44.
28. Christie, G., Markwell, R.E., Gray, C.W., Smith, L., Godfrey, F.,
Mansfield, F., Wadsworth, H., King, R., McLaughlin, M., Coo-
per, D.G., Ward, R.V., Howlett, D.R., Hartmann, T., Lichtent-
haler, S.F., Beyreuther, K., Underwood, J., Gribble, S.K., Cappai,
R., Masters, C.L., Tamaoka, A., Gardner, R.L., Rivett, A.J.,
Karran, E.H. & Allsop, D. (1999) Alzheimer’s disease: correlation
of the suppression of beta-amyloid peptide secretion from cultured
cells with inhibition of the chymotrypsin-like activity of the pro-
teasome. J. Neurochem. 73, 195–204.
29. Ida, N., Hartmann, T., Pantel, J., Schroder, J., Zerfass, R., Forstl,
H., Sandbrink, R., Masters, C.L. & Beyreuther, K. (1996) Ana-
lysis of heterogeneous A4 peptides in human cerebrospinal fluid
and blood by a newly developed sensitive Western blot assay.
J. Biol. Chem. 271, 22908–22914.
30. Culvenor, J.G., Evin, G., Cooney, M.A., Wardan, H., Sharples,
R.A.,Maher,F.,Reed,G.,Diehlmann,A.,Weidemann,A.,
Beyreuther, K. & Masters, C.L. (2000) Presenilin 2 expression in
neuronal cells: induction during differentiation of embryonic car-
cinoma cells. Exp. Cell Res. 255, 192–206.
31. Nunan, J., Shearman, M.S., Checler, F., Cappai, R., Evin, G.,

Beyreuther, K., Masters, C.L. & Small, D.H. (2001) The
C-terminal fragment of the Alzheimer’s disease amyloid protein
precursor is degraded by a proteasome-dependent mechanism
distinct from c-secretase. Eur. J. Biochem. 268, 5329–5336.
32. Shearman, M.S., Beher, D., Clarke, E.E., Lewis, H.D., Harrison,
T., Hunt, P., Nadin, A., Smith, A.L., Stevenson, G. & Castro, J.L.
(2000) L-685,458, an aspartyl protease transition state mimic, is a
potent inhibitor of amyloid b-protein precursor c-secretase acti-
vity. Biochemistry 39, 8698–8704.
33. Li, Y.M., Xu, M., Lai, M.T., Huang, Q., Castro, J.L., DiMuzio-
Mower, J., Harrison, T., Lellis, C., Nadin, A., Neduvelil, J.G.,
Register, R.B., Sardana, M.K., Shearman, M.S., Smith, A.L., Shi,
X.P., Yin, K.C., Shafer, J.A. & Gardell, S.J. (2000) Photoactivated
c-secretase inhibitors directed to the active site covalently label
presenilin 1. Nature 405, 689–694.
34. Wolfe, M.S., Citron, M., Diehl, T.S., Xia, W., Donkor, I.O.
& Selkoe, D.J. (1998) A substrate-based difluoro ketone
selectively inhibits Alzheimer’s c-secretase activity. J. Med. Chem.
41,6–9.
35.Weihofen,A.,Lemberg,M.K.,Ploegh,H.L.,Bogyo,M.&
Martoglio, B. (2000) Release of signal peptide fragments into the
cytosol requires cleavage in the transmembrane region by a
protease activity that is specifically blocked by a novel cysteine
protease inhibitor. J. Biol. Chem. 275, 30951–30956.
504 M. F. Sernee et al. (Eur. J. Biochem. 270) Ó FEBS 2003
36. Lichtenthaler, S.F., Multhaup, G., Masters, C.L. & Beyreuther,
K. (1999) A novel substrate for analyzing Alzheimer’s disease
c-secretase. FEBS Lett. 453, 288–292.
37. Lichtenthaler, S.F., Beher, D., Grimm, H.S., Wang, R., Shear-
man, M.S., Masters, C.L. & Beyreuther, K. (2002) The intra-

membrane cleavage site of the amyloid precursor protein depends
on the length of its transmembrane domain. Proc. Natl Acad. Sci.
USA 99, 1365–1370.
38. Pellegrini, L., Passer, B.J., Tabaton, M., Ganjei, J.K. &
D’Adamio, L. (1999) Alternative, non-secretase processing of
Alzheimer’s beta-amyloid precursor protein during apoptosis by
caspase-6 and -8. J. Biol. Chem. 274, 21011–21016.
39. Weidemann, A., Paliga, K., Durrwang, U., Reinhard, F.B.M.,
Schuckert, O., Evin, G. & Masters, C. (1999) Proteolytic proces-
sing of the Alzheimer’s disease amyloid precursor protein within
its cytoplasmic domain by caspase-like proteases. J. Biol. Chem.
274, 5823–5829.
40. Gervais, F.G., Xu, D., Robertson, G.S., Vaillancourt, J.P., Zhu,
Y., Huang, J., LeBlanc, A., Smith, D., Rigby, M., Shearman,
M.S., Clarke, E.E., Zheng, H., Van Der Ploeg, L.H., Ruffolo,
S.C., Thornberry, N.A., Xanthoudakis, S., Zamboni, R.J., Roy, S.
& Nicholson, D.W. (1999) Involvement of caspases in proteolytic
cleavage of Alzheimer’s amyloid-b precursor protein and amy-
loidogenic A beta peptide formation. Cell 97, 395–406.
41. Koo, E.H. & Squazzo, S.L. (1994) Evidence that production and
release of amyloid b-protein involves the endocytic pathway.
J. Biol. Chem. 269, 17386–17389.
42. Sadowski, I., Ma, J., Triezenberg, S. & Ptashne, M. (1988) GAL4-
VP16 is an unusually potent transcriptional activator. Nature 335,
563–564.
43. Brown, M.S., Ye, J., Rawson, R.B. & Goldstein, J.L. (2000)
Regulated intramembrane proteolysis: a control mechanism con-
served from bacteria to humans. Cell 100, 391–398.
44. Mumm, J.S., Schroeter, E.H., Saxena, M.T., Griesemer, A., Tian,
X., Pan, D.J., Ray, W.J. & Kopan, R. (2000) A ligand-induced

extracellular cleavage regulates c-secretase-like proteolytic activa-
tion of Notch1. Mol. Cell 5, 197–206.
45. Bunnell, W.L., Pham, H.V. & Glabe, C.G. (1998) gamma-secre-
tase cleavage is distinct from endoplasmic reticulum degradation
of the transmembrane domain of the amyloid precursor protein.
J. Biol. Chem. 273, 31947–31955.
46. Gu, Y., Misonou, H., Sato, T., Dohmae, N., Takio, K. & Ihara,
Y. (2001) Distinct intramembrane cleavage of the beta-amyloid
precursor protein family resembling c-secretase-like cleavage of
Notch. J. Biol. Chem. 276, 35235–35238.
47. Sastre, M., Steiner, H., Fuchs, K., Capell, A., Multhaup, G.,
Condron, M.M., Teplow, D.B. & Haass, C. (2001) Presenilin-
dependent c-secretase processing of b-amyloid precursor protein
at a site corresponding to the S3 cleavage of Notch. EMBO Rep. 2,
835–841.
48. Kimberly, W.T., LaVoie, M.J., Ostaszewski, B.L.Ye, W., Wolfe,
M.S. & Selkoe, D.J. (2002) Complex N-linked glycosylated
Nicastrin associates with active c-secretase and undergoes tight
cellular regulation. J. Biol. Chem. 277, 35113–35117.
49. Ponting,C.P.,Hutton,M.,Nyborg,A.,Baker,M.,Jansen,K.&
Golde, T.E. (2002) Identification of a novel family of presenilin
homologues. Hum. Mol. Genet. 11, 1037–1044.
50. Weihofen, A., Binns, K., Lemberg, M.K., Ashman, K. & Mar-
toglio, B. (2002) Identification of signal peptide peptidase, a pre-
senilin-type aspartic protease. Science 296, 2215–2218.
51. Perez-Tur, J., Froelich, S., Prihar, G., Crook, R., Baker, M., Duff,
K.,Wragg,M.,Busfield,F.,Lendon,C.,Clark,R.F.&et al. (1995)
A mutation in Alzheimer’s disease destroying a splice acceptor site
in the presenilin-1 gene. Neuroreport 7, 297–301.
52. Steiner, H., Romig, H., Grim, M.G., Philipp, U., Pesold, B.,

Citron, M., Baumeister, R. & Haass, C. (1999) The biological and
pathological function of the presenilin-1 Deltaexon 9 mutation is
independent of its defect to undergo proteolytic processing. J. Biol.
Chem. 274, 7615–7618.
53.Karlstrom,H.,Bergman,A.,Lendahl,U.,Naslund,J.&
Lundkvist, J. (2002) A sensitive and quantitative assay for mea-
suring cleavage of presenilin substrates. J. Biol. Chem. 277, 6763–
6766.
54. Taniguchi, Y., Karlstrom, H., Lundkvist, J., Mizutani, T., Otaka,
A., Vestling, M., Bernstein, A., Donoviel, D., Lendahl, U. &
Honjo, T. (2002) Notch receptor cleavage depends on but is not
directly executed by presenilins, Proc. Natl Acad. Sci. USA 99,
4014–4019.
55. Deroo, B.J. & Archer, T.K. (2002) Proteasome inhibitors reduce
luciferase and b-galactosidase activity in tissue culture cells. J. Biol.
Chem. 277, 20120–20123.
56. Wolfe, M.S., Xia, W., Moore, C.L., Leatherwood, D.D.,
Ostaszewski,B.,Rahmati,T.,Donkor,I.O.&Selkoe,D.J.(1999)
Peptidomimetic probes and molecular modeling suggest that
Alzheimer’s c-secretase is an intramembrane-cleaving aspartyl
protease. Biochemistry 38, 4720–4727.
57. Beher, D., Wrigley, J.D., Owens, A.P. & Shearman, M.S. (2002)
Generation of C-terminally truncated amyloid-beta peptides is
dependent on c-secretase activity. J. Neurochem. 82, 563–575.
58. Steiner, H., Capell, A., Pesold, B., Citron, M., Kloetzel, P.M.,
Selkoe, D.J., Romig, H., Mendla, K. & Haass, C. (1998)
Expression of Alzheimer’s disease-associated presenilin-1 is con-
trolled by proteolytic degradation and complex formation. J. Biol.
Chem. 273, 32322–32331.
59. Kim, S.H., Leem, J.Y., Lah, J.J., Slunt, H.H., Levey, A.I., Thin-

akaran, G. & Sisodia, S.S. (2001) Multiple effects of aspartate
mutant presenilin 1 on the processing and trafficking of amyloid
precursor protein. J. Biol. Chem. 276, 43343–43350.
60. Yu, G., Chen, F., Nishimura, M., Steiner, H., Tandon, A.,
Kawarai, T., Arawaka, S., Supala, A., Song, Y.Q., Rogaeva, E.,
Holmes, E., Zhang, D.M., Milman, P., Fraser, P.E., Haass, C. &
George-Hyslop, P.S. (2000) Mutation of conserved aspartates
affects maturation of both aspartate mutant and endogenous
presenilin 1 and presenilin 2 complexes. J. Biol. Chem. 275, 27348–
27353.
61. Yu, G., Chen, F., Nishimura, M., Steiner, H., Tandon, A.,
Kawarai, T., Arawaka, S., Supala, A., Song, Y.Q., Rogaeva, E.,
Holmes, E., Zhang, D.M., Milman, P., Fraser, P., Haass, C. &
St George-Hyslop, P. (2000) Mutation of conserved aspartates
affect maturation of presenilin 1 and presenilin 2 complexes. Acta
Neurol. Scand. Suppl. 176, 6–11.
62. Chen, F., Gu, Y., Hasegawa, H., Ruan, X., Arawaka, S., Fraser,
P., Westaway, D., Mount, H. & St George-Hyslop, P. (2002)
Presenilin 1 mutations activate c 42-secretase but reciprocally
inhibit epsilon-secretase cleavage of APP and S3-cleavage of
notch. J. Biol. Chem. 277, 36521–36526.
63. Kulic, L., Walter, J., Multhaup, G., Teplow, D.B., Baumeister, R.,
Romig, H., Capell, A., Steiner, H. & Haass, C. (2000) Separation
of presenilin function in amyloid b-peptide generation and
endoproteolysis of Notch. Proc. Natl Acad. Sci. USA 97, 5913–
5918.
64. Tian, G., Sobotka-Briner, C.D., Zysk, J., Liu, X., Birr, C.,
Sylvester, M.A., Edwards, P.D., Scott, C.D. & Greenberg, B.D.
(2002) Linear non-competitive inhibition of solubilized human
c-secretase by pepstatin A methylester, L-685458, sulfonamides

and benzodiazepines. J. Biol. Chem. 277, 31499.
65. Ni, C.Y., Murphy, M.P., Golde, T.E. & Carpenter, G. (2001)
c-Secretase cleavage and nuclear localization of ErbB-4 receptor
tyrosine kinase. Science 294, 2179–2181.
66. Lee, H.J., Jung, K.M., Huang, Y.Z., Bennett, L.B., Lee, J.S., Mei,
L. & Kim, T.W. (2001) Presenilin-dependent c-secretase-like
intramembrane cleavage of ErbB4. J. Biol. Chem. 277, 6318–6323.
Ó FEBS 2003 Cell fluorescence c-secretase assay (Eur. J. Biochem. 270) 505
67. Marambaud, P., Shioi, J., Serban, G., Georgakopoulos, A., Sar-
ner,S.,Nagy,V.,Baki,L.,Wen,P.,Efthimiopoulos,S.,Shao,Z.,
Wisniewski, T. & Robakis, N.K. (2002) A presenilin-1/c-secretase
cleavage releases the E-cadherin intracellular domain and regu-
lates disassembly of adherens junctions. EMBO J. 21, 1948–1956.
68. May,P.,Reddy,Y.K.&Herz,J.(2002)Proteolyticprocessingof
low density lipoprotein receptor-related protein mediates regu-
lated release of its intracellular domain. J. Biol. Chem. 277, 18736–
18743.
69. Lammich, S., Okochi, M., Takeda, M., Kaether, C., Capell, A.,
Zimmer,A.K.,Edbauer,D.,Walter,J.,Steiner,H.&Haass,C.
(2002) Presenilin dependent intramembrane proteolysis of CD44
leads to the liberation of its intracellular domain and the secretion
of an Ab-like peptide. J. Biol. Chem. 277, 44754–44759.
506 M. F. Sernee et al. (Eur. J. Biochem. 270) Ó FEBS 2003