Báo cáo Y học: Functional assignment of motifs conserved in b1,3-glycosyltransferases A mutagenesis study of murine UDP-galactose:b-N-acetylglucosamine b1,3-galactosyltransferase-I pptx

Functional assignment of motifs conserved
in b1,3-glycosyltransferases
A mutagenesis study of murine UDP-galactose:b-
N
-acetylglucosamine
b1,3-galactosyltransferase-I
Martine Malissard, Andre
Â
Dinter, Eric G. Berger and Thierry Hennet
Institute of Physiology, University of Zu
È
rich, Switzerland
The b1,3-glycosyltransferase enzymes identi®ed to date
share several conserved r egions and c onserved c ysteine res-
idues, all being located in t he putative catalytic d omain. To
investigate the importance of these m otifs and cysteines for
the e nzymatic act ivity, 1 4 m utants of the m urine b1,3-
galactosyltransferase-I gene were constructed and expressed
in Sf9 insect cells. Seven mutations abolished t he galacto-
syltransferase act ivity. Kinetic analysis of the other seven
active mutants revealed that t hree of them showed a three-
fold to 21-fold high er apparent K
m
with regard to the donor
substrate UDP-galactose relative to the wild-type enzyme,
while two mutants had a sixfold t o 7.5-fold increase of the
apparent K
m
value for the acceptor substrate N-acetylg lu-
cosamine-b-p-nitrophenol. Taken together, our results
indicate that the conserved residues W101 and W162 are

involved in the b inding of the UDP-galactose donor, t he
residue W315 in the binding of the N-acetylglucosamine-b-p-
nitrophenol acceptor, and the domain including E264
appears t o participate in the binding of both substrates.
Keywords: Gal transferase; GlcNAc transferase;
mutagenesis; gene family.
Glycosyltransferase enzymes account for the structural
diversity of glycoconjugates found in all organisms. Based
on amino-acid sequence similarity, glycosyltransferases can
be classi®ed into at l east 27 different families [1]. I n contrast
to the common c lassi®cation based on t he reaction
catalyzed and the substrate s peci®city, the association by
structural similarity allows one to putatively assign a
glycosyltransferase function to proteins not previously
suspected to catalyze such a reaction [2,3]. Also, the
grouping by similarity may bring together glycosyl-
transferases with a distinct s ubstrate speci®city, thereby
providing some insight into the possible evolution from
common ancestral genes. The latter i s true f or the family of
b1,3-glycosyltransferases (b3GT), which comprises
b1,3 -galactosylt ransferases (b3GalTs) [4±10], b1,3-N-acetyl-
glucosaminyltransferases [11±13] and a b1,3-N-acetylgalac-
tosaminyltransferase [14]. Within this g lycosyltransferase
family, some e nzymes are c apable of using two donor
substrates such as b3GalT-III, which accepts the donors
UDP-Gal and UDP-GalNAc [5,14] or the Neisseria
meningitidis lgtA enzyme that functions as both a b1,3-N-
acetylglucosaminyltransferase and a b1,3-N-acetylgalactos-
aminyltransferase [15]. Similarly, polyspeci®city towards
acceptor substrates has been described for the b3GalT-V

enzyme, which transfe rs G al to GlcNAc-based acceptors
[8,9] and to th e GalNAc residue o f the g loboside Gb4 [16].
Structurally, other than the retention of a type-II trans-
membrane topology, b3GTs do not show any similarity
with the families of b1,4- [17] and a1,3-GalTs [18,19]. Within
the b3GT family, the compar ison between the d ifferent
proteins revealed several domains and amino-acid residues
that are strongly conserved [11]. However, it is unclear
whether this conservation re¯ects an evolutionary feature,
where parts of the protein sequences are maintained
primarily due to a late gene duplication event. Alternatively
and more likely, the motifs may be conserved because they
are involved in either the catalytic s ite and/or maintenance
of conformation of the enzymes. To address the importance
of these conserved motifs i n the enzymatic p roperties of
b3GTs, a site-directed mutagenesis s tudy of the b3GT-
speci®c motifs was performed using the full-length murine
b3GalT-I gene as a model. To this end, a Staphylococcus
aureus protein A (protA)-tagged f usion protein was gener-
ated and expressed in insect cells taking advantage of the
absence o f endogeneous b3GalT a ctivity in this host cell. We
investigated the putative role of eight conserved motifs as
well as the r ole of the six cysteines in the catalytic activity of
murine b3GalT-I. Our results allowed a functional assign-
ment of four domains an d s uggested that four cysteines m ay
be involved in the formation of two disul®de bonds.
MATERIALS AND METHODS
Generation of mutant b3GalT-I genes
Site-directed mutagenesis of the murine b3GalT-I g ene was
carried out by an overlapping PCR method described

previously [20] using a pBluescript SKII
+
/b3GalT-I con-
struct [5] as template. The mutant forms of b3GalT-I are
Correspondence to T. Hennet, Institute of Physiology, Winter-
thurerstrasse 190, 8057 Zu
È
rich, Switzerland. Fax: + 4 1 1635 6814,
Tel.: + 41 1635 5080, E-mail:
Abbreviations: b3GT, b1,3-glycosyltransferase; b3GalT,
b1,3-galactosyltransferase; pNP, p-nitrophenol; protA, protein A.
(Received 24 July 2001, revised 25 October 2001, accepted 30 October
2001)
Eur. J. Biochem. 269, 233±239 (2002) Ó FEBS 2002
named according to the amino-acid residues substituted b y
alanine and their respective position in the polypeptide
sequence where the start methionine is number one. The
mutagenic s ense oligonucleotides are listed in Table 1. A
mutagenic primer was used in a PCR reaction with primer
containing a SalIsiteatthe5¢ termini or primer c ontaining
a s top codon ¯anked by a XbaIsiteatthe3¢ termini,
whichever was appropriate. The two overlapping PCR Ôhalf-
fragmentsÕ were puri®ed, combined, ®lled with the T
4
DNA
polymerase and used as template for the second-round PCR
with the two external restriction site-containing primers.
PCR c onditions were 20 cycles of 30 s a t 9 4 °C, 30 s at 55±
58 °Cand90sat72°C. The restriction site-containing
primers were a s follows 5¢-TAGTCGACGCTTCAAAG

ATCTCCTGCCTCTA-3¢ and 5¢-ATATCTAGACTAA
CATCTCAGATGCTTCTTGCTTGAC-3¢ introducing a
SalIandXbaI site, respectively. The W315A and C326A
mutants were generated through s ingle PCR reactions using
the 5¢ restriction site-containing primer and an antisense
oligonucleotide i ntroducing t he desired mutation (Table 1).
After puri®cation, mutated full-length fragments were
subcloned into pBluescript SKII
+
and veri®ed by DNA
sequencing.
Cloning of recombinant baculoviruses
and expression in Sf9 cells
Wild-type and mutant full-length b3GalT-I cDNAs in
pBluescriptSKII
+
were released by SalIandXbaIand
subcloned into a pFmel±protA vector [21] opened with SalI
and XbaI. The recombinant baculoviruses were generated
by transposon-mediated recombination [22] as des cribed
previously [5]. Sf9 i nsect cells were infected at a multiplicity
of 10 and f urther incubated at 27 °C before a ssaying for
b3GalT-I a ctivity and Western blotting.
b3GalT activity assays
Baculovirus-infected Sf9 cells were washed with NaCl/P
i
and lysed in 2% Triton X-100 for 15 min on i ce. Nuclei
were removed f rom the lysates by centrif ugation at 500 g.
Galactosyltransferase activity w as assayed by incubating
10 lL of Sf9 cell lysate for 3 0 min at 37 °Cin50lL

reactions of 50 m
M
cacodylate buffer, pH 6.6, 10 m
M
MnCl
2
,0.5m
M
UDP-Gal, 10 m
M
GlcNAc-b-p-nitrophe-
nol (pNP) and 1% Triton X-100. UDP-[
14
C]Gal
(10
5
c.p.m., Amersham Pharmacia B iotech) were a dded
to standard assays, whereas 2.5 ´ 10
5
c.p.m. of UDP-
[
14
C]Gal (410 pmol) were a dded when kinetic parameters
were determined. The reaction was stopped by adding
0.5 m L of ice-cold water. Samples were puri®ed on Sep-
Pak C
18
cartridges (Waters) by washing with 15 mL of
water and eluting with 5 mL of methanol. The amount of
[

14
C]Gal transferred to the a cceptor was measured in a
b-scintillation counter (Rackbeta, Pharmacia). Apparent
Michaelis constants (K
m
) w ere determined b y nonlinear
regression analysis (
GRAPHPAD PRISM
) of double-reciprocal
plots of initial velocity vs. GlcNAcb-pNP concentration
(0±20 m
M
) a t a constant UDP-Gal concentration ( 0.5 m
M
)
or of the initial velocity vs UDP-Gal c oncentration
(0±15 m
M
) at a constant concentration of GlcNAcb-pNP
(10 m
M
).
Western blot analysis
Sf9 cell lysate was diluted 1 : 750 in Laemmli buffer [23],
denatured 5 min at 95 °Cand15lL were analyzed by 10%
SDS/PAGE. After blotting onto n itrocellulose membrane
(Millipore) according to Towbin et al. [24], staining was
performed with 1 : 3000-diluted biotinylated anti-ProtA Ig
(Sigma) f ollowed b y streptavidin±horseradish peroxidase
(diluted 1 : 5000; Fluka). The protA±b3GalT-I fusion

protein was then detected by electrochemiluminescence
(Amersham Pharmacia Biotech).
RESULTS
The multiple sequence alignment of members of the b3GT
protein family highlighted several conserved regions that
were located in t he predicted luminal domain (Fig. 1). These
motifs are spread across the polypeptide chain and are not
clustered in d istinct regions as observed for example i n
sialyltransferases [25]. It is of note t hat the Drosophila
melanogaster protein B rainiac [26] shares the same con-
Table 1. Sense strand oligonucleotides used for site-directed mutagenesis. Sequences are shown for the sense strand oligonucleotides of each
complementary pair of primers used for site-directed mutagenesis. Underlined bases represent the mutations introduced. For the W 315A and
C326A mutations, the an tisense primers were used in com bination with the 5¢ restriction s ite-containing primer.
Mutation Oligonucleotide sequence (5¢)3¢)
C73A AAATGAGCCCAACAAAG
CCGAGAAAAACATT
I97A-R98A AATTTGATGCTCGACAGGCT
GCCGCGGAGACATGG
W101A CAATCCGGGAGACA
GCTGGTGATGAAAA
F116A-L117A-L118A-G119A TAGCCACACTTG
CAGCCGCGGCCAAAAATG
W162A TTAATGGGGATGAGAGCGGTT
GCCACTTTCT
C167A AGATGGGTTGGCAACTTTC
GCTTCAAAA
D177A-D179A-F181A TGAAAACC
GCCAGTGCTATTGCTGTGAACA
P233A-P234A CCTGACAGCAACTACG
CAGCGTTCTGTTCAG

C236A AGCAACTATCCACCGTTC
GCTTCAGGGACTG
E264A TGCTTCATCTTG
CTGACGTGTACGTGGGACT
C271A ATGTGTACGTGGGACTGGCACTTCGAAAGC
C295A AAAATGGCCTACAGTTTA
GCTCGGTACC
W315A CAGAATC
GCCAATGACATGTCAAGGAAGAAGCATCTGAGATGTTAGTCTAGATAT
C326A GTCAAGGAAGAAGCATCTGAGA
GCCTAGTCTAGATAT
234 M. Malissard et al. (Eur. J. Biochem. 269) Ó FEBS 2002
served domains as b3GT proteins, suggesting that this
protein may represent a member of this glycosylt ransferase
family [2]. None of the conserved s tretches, except one
motif, the so called DXD motif, found in b3GT enzymes
were present in a1,3- and b1,4-GalTs [27]. To elucidate the
functional relevance of several conserved residues f ound in
b3GT proteins, we constructed 14 mutants of the murine
b3GalT-I enzyme, where the amino acids of interest were
changed to alanine. We ®rst chose to substitute the six
cysteine residues of b3GalT-I a s four of them (C1, C2, C 5
and C6 in Fig. 1) were strictly conserved in all known b3GT
proteins. S econdly, we modi®ed the boxes AIR (position
96), FLLG (position 116), DXD (position 177), PPX
(position 233) and EDV (position 264). In addition, three
tryptophan residues at positions 101, 162 and 315 were
found in all b3GT proteins a s well as i n B rainiac. As
tryptophan residues have previou sly been imp licated in the
binding of UDP-Glc in a glycosyltransferase [28], we also

mutated conserved tryptophans in our survey. The wild-
type and mutant forms of the full-length murine b3GalT-I
gene were fused with protA to enable the detection of the
protein produced. The b3GalT-I constructs were expressed
as recombinant b aculovirus in Sf9 insect cells. Western blot
analysis con®rmed that all protA±mutant b3GalT-I were
expressed at similar levels a nd exhibited the same molecular
mass as the prot A-wild-type b3GalT-Iproteins(Fig.2).
The wild-type an d mutant recombinant protA full-length
b3GalT-I proteins remained localized intracellularly. There-
fore, the galact osyltransferase activity was assayed in t he
lysate of Sf9 cells harvested 7 2 h after infection. When
assayed in presence of 10 m
M
GlcNAcb-pNP, t he wild-type
protA±b3GalT-I c onstruct yielded an avera ge galactosyl-
transferase a ctivity of 11.6 nmolámin
)1
ámg protein
)1
,which
is in the range of the activity measured w ith the untagged
enzyme [5]. A ctivity assays performed w ith t he mutant
forms of b3GalT-I revealed two groups. The mutations
C73A, I97A-R98A, F116A-L117A-L118A-G119A, C167A,
D177A-D179A-F181A, C295A and C326A abolished t he
enzymatic activity of b3GalT-I. In contrast, residual activity
was detected with the seven mutations W101A, W162A,
P233A-P234A, C236A, E264A, C271A and W315A, which
yielded 22, 15, 53, 98, 1 9, 20 and 12% of the wild-type

protA±b3GalT-I activity, respectively (Fig. 3). No galacto-
syltransferase activity was detected in the supernatant of Sf9
cells expressing the wildtype and mutant protA±b3GalT-I
proteins indicating that the decrease or loss of activity found
with some mutant forms was not caused by increased
secretion (data not shown). T he mutant forms o f b3GalT-I,
which retained a signi®cant galactosyltransferase activity,
were u sed for comparative kinetic a nalysis. The K
m
values
for e ach f usion protein were determined for the donor
substrate UDP-Gal and for the a cceptor substrate Glc-
NAcb-pNP. The apparent K
m
values obtained for the
protA±b3GalT-I c onstruct were s imilar to those d etermined
Fig. 1. Alignment of b3GT protein sequences. The protein sequences of the m urine b1,3-GalTs b3GalT-I (GenBank a ccession AF029790), b3GalT-II
(AF029791), b3GalT-III (AF029792), b3GalT-IV (AF082504), b3GalT-V (AF254738), murine b1,3-N-acetylglucosaminyltransferases b3GnT-I
(AF092050), b3GnT-III (AY037785), b3GnT-IV (AY037786) and D. me lanogaster Brainiac (U41449) were aligned using the
CLUSTALW
algorithm
[38]. Similar amino acids conserved in all proteins are shaded in black while the similarities found in at least seven proteins are shaded in gray. The
positions of the am ino acids mutated in the present study are marked with white arrows. The positions of the six c ysteines of b3GalT-I (C1 to C6)
are marked with b lack arrows.
Ó FEBS 2002 Mutagenesis of b3GalT-I (Eur. J. Biochem. 269) 235
for the full-length b3GalT-I enzyme without the protA tag
[5], indicating that the fusion with protA has no effect on the
catalytic properties of b3GalT-I (Table 2). We found that
the K
m

values for the donor substrate UDP-Gal were
signi®cantly altered with the mutations W101A, W162A
and E 264A, which increased t he K
m
value by about 3.7-, 8-
and 21.6-fold, respectively. Similarly, t he mutations E26 4A
and W315A caused a respective 7 .5- and 6-fold increase of
the K
m
values for the acceptor s ubstrate G lcNAcb-pNP.
Considering the dual substrate speci®city of some b3GT
proteins [15,16], we also analyzed the donor and acceptor
preference of the b3GalT-I m utants. T o exclude a switch i n
substrate speci®city as a cause of the loss of galactosyl-
transferase activity detected with some m utations, we tested
Sf9 cell lysates in presence of the donor substrates UDP-
GlcNAc and UDP-GalNAc, as well as the acceptor
substrates GalNAcb-pNP and Galb1,4GlcNAcb-pNP. Do-
nors and acceptors were assayed at concentrations of
0.5 m
M
and 10 m
M
, respectively. We failed to detect any
novel substrate s peci®city due to the mutations introduced
in the b3GalT-I enzyme (Table 3).
DISCUSSION
Comparison between glycosyltransferase enzymes with
similar activities often bring to light several conserved
residues. In assigning a f unctional signi®cance t o these

amino a cids, site-directed mutagenesis represents the ®rst
logical method of choice. In the present study, we have
investigated in the murine b3GalT-I enzyme [5] the
relevance of 14 positions, which are conserved among
known b3GTproteinsaswellasintheDrosophila signaling
protein Brainiac ( see Fig. 1). First, our study revealed that
four of the six cysteine residues are essential for the
galactosyltransferase activity. C ysteine is one of the most
versatile amino acids in e nzymes as i t can be used for
substrate binding, be part of the catalytic mechanism and be
used for the mainten ance of proper c onformation. The loss
of the galactosyltransferase activity in the C73A, C 167A,
C295A and C326A mutants indicated that these cysteines
may be implicated in the catalytic activity of b3GalT-I or in
the formation of disul®de bridges. Similar results were
obtained f or the b1,4-GalT-I enzyme, where it was shown
that the rigidity of the protein core is maintained by two
disul®de bridges [29]. Note that the two cysteines t hat show
the l east conservation among b3GT proteins, i.e. C236 and
C271 in b3GalT-I, are not absolutely required for enzymatic
activity. The fact that the four essential cysteines are not
surrounded by other conserved residues supports their
involvement in disul®de b ridge formation rather than a
direct participation in the catalytic activity. Mutations of the
conserved motifs A IR, FLLG and DXD also abolished t he
enzymatic a ctivity indicating that these stretches are impor-
tant for the catalytic reaction. However, the exact role of
these motifs in possible binding sites requires further
investigations. The AIR a nd FLLG motifs are found in
b1,3-GalTs and b1,3-N-acetylglucosaminyltransferases,

thereby suggesting that they are more likely involved in
mediating the b1,3-linkage speci®city r ather than in t he
direct binding of the substrates. The loss of activity seen in
the DXD mutant (D177A-D179A-F181A) did not com e as
a surprise. In the past, site-directed mutagenesis o f aspartate
residues in other DXD-containing enzymes, such as the
yeast MNN1 mannosyltransferase [30] and the yeast chitin
synthetase-2 [31], demonstrated that they are essential for
the catalytic activity. In the large clostridial glucosyltrans-
Fig. 2. Western blot analysis of wild-type
protA±b3GalT-I and its m utants. The e xpres-
sion of the p ro tA±b3GalT-I proteins was
detected us ing a biotinylated antiprotA
antibody. La ne 1, Sf9 cells; Lane 2, mock
transfected Sf9; Lane 3 , protA±b3GalT-I;
Lanes 4±17, mutants of protA±b3GalT-I with
C73A, I 97A-R98A, W101A, F116A-L117A-
L118A-G119A, W 162A, C167A, D 177A-
D178A-F181A, P 233A-P234A, C236A,
E264A, C2 71A, C295A, W315A and C326A,
respectively. The muta nts of protA±b3GalT-I
migrated si milarly to t he wild-type enzyme in
the SDS/polyacrylamide gel.
Fig. 3. b3GalT-I activity o f protA± b3GalT-I and its mutan ts. The
activity detected for the mutant enzymes is i ndicated i n percentage o f
the a ctivity measured w ith the wild-type b3GalT-I (11 665 pmoles of
galactose tran sferred per min per mg protein).
236 M. Malissard et al. (Eur. J. Biochem. 269) Ó FEBS 2002
ferase toxin [32], using photoaf®nity labeling, the DXD
motif h as been implicated in the binding of UDP-Glc a nd

Mn
2+
. I t has been proposed that the DXD motif is involved
in the folding of a small region of the protein required for
catalysis or has a role i n the catalytic site. In this context, it is
worth noting that DXD is found in inverting and nonin-
verting transferases, which add different sugars to other
sugars, phosphates and proteins. However, these DXD-
containing glycosyltransferases all use nucleosides diphos-
phate sugars a s donors and require divalent cations, usually
manganese. In 1999, Gastinel et al. [29] resolved part of this
issue b y providing structural informations for the DXD-
containing bovine b1,4-GalT I. They showed that the
phosphate groups of UDP-Gal a re close to the DVD motif,
but they obtained no information concerning the divalent
cation. More recently, the 3-D structure of t he rabbit N-
acetylglucosaminyltransferase-I enzyme has been described
previously [33]. In this protein, the DXD motif is present in
the form of EDD and it was shown that the third position
D213 makes the only direct interaction with the bound
Mn
2+
ion. In addition, it makes a hydrogen bond with one
of the metal coordinating water molecules, which itself is
hydrogen bonded to the ®rst position of the motif E211.
These residues are further constrained by the well de®ned
octahedral geometry characteristic of Mn
2+
ion c oordina-
tion [34]. As the phosphates of the nucleotide-sugar also

coordinate the M n
2+
ion, the r elative orientation of the
nucleotide-sugar and the conserved acidic r esidues is w ell
de®ned. In the rabbit N-acetylglucosaminyltransferase-I,
this arrangement t enders the GlcNAc moiety of the sugar
donor for interaction with the ®rst position of t he motif.
Owing to this geometry, this position would also be
expected to play a Ôcarbohydrate b indingÕ role in other
sugar-nucleoside diphosphate/Mn
2+
dependent glyco-
syltransferases. Based on these results and knowing that
murine b3GalT-I uses UDP-Gal as donor and Mn
2+
ion as
cofactor [5], we may assume that the DXD motif of
b3GalT-I is implicated in the binding of UDP-Gal and
Mn
2+
. The mutants W101A, W162A, P233A-P234A,
C236A, E264A, C271A and W3 15A displayed a r educed
galactosyltransferase activity ( see F ig. 3). The decreased
activity observed with the alanine mutants of P233A-
P234A, C236 and C271 may be caused by minor alterations
of the tertiary structure. I n f act, a d irect i nvolvement of
these residues in the catalytic process or substrate binding
seems unlikely as w e observed no m odi®cations o f K
m
values for the donor UDP-Gal and acceptor GlcNAcb-

pNP. In contrast, kinetic an alysis provided evidence that
W101, W162 and E264 are involved in the binding of UDP-
Gal and that E264 and W315 are involved in the GlcNA cb-
pNP binding site. The residue E264, which is part of the
conserved EDV motif, is involved in both substrate b inding
sites, a phenomenon already observed in sialyltransferases
[35,36]. Mutagenesis analysis of the Galb1,4GlcNAc a2,6-
sialyltransferase s howed that the residues S320, G321, V335
and E339, all belonging to the S-sialyl motif [25], participate
in the binding o f the donor substrate CMP-sialic acid as well
as in the binding of the accep tor substrate a sialo a
1
-acid
glycoprotein. The involvement of aromatic residues, such as
Table 3. Donor and acceptor speci®city of the protA±b3GalT-I mutant constructs. UDP-Gal, UDP-GlcNAc and UDP-GalNAc w ere used a t
0.5 m m. GlcNAcb-pNP, GalNAcb-pNP and Gal(b1,4)Glcb-pNP (l actoseb-pNP) were used at 10 m
M
. Results re present averages of three mea-
surements. All values are glycosyltransferase activity in pmolámin
)1
ámg protein
)1
. Donors are UDP-G al, UDP-GlcNAc a nd UDP-G alNAc.
Acceptors are GlcNAcb-pNP and GalNAcb-pNP.
UDP-Gal UDP-GlcNAc UDP-GalNAc
GlcNAcb-pNP GalNAcb-pNP Lactoseb-pNP GalNAcb-pNP Lactoseb-pNP
Sf9mock 335 132 75 12 135
b3GalT-I 11 665 134 160 14 148
C73A 276 140 80 23 129
I97A-R98A 989 166 265 13 64

W101 2571 94 76 40 54
F116A-L117A-L118A-G119A 420 158 133 73 76
W162A 2073 108 166 15 125
C167A 612 151 88 26 129
D177A-D179A 541 94 76 40 60
P233A-P234A 7135 102 115 33 66
C236A 11 579 153 101 88 146
E264A 2589 108 93 22 67
C271A 3286 128 99 65 141
C295A 412 156 82 93 134
W315A 1430 166 112 12 66
C326A 208 131 77 72 129
Table 2. Kinetic p arameters for t he protA±b3GalT-I constructs.
Apparent K
m
value (m
M
)
UDP-Gal GlcNAcb-pNP
b3GalT-I 1.5 8.3
W101A 5.4 9.3
W162A 11.8 12.8
P233A-P234A 1.5 8.3
C236A 1.9 10.7
C271A 2.5 12.0
E264A 31.6 62.0
W315A 1.7 50.0
Ó FEBS 2002 Mutagenesis of b3GalT-I (Eur. J. Biochem. 269) 237
W101 and W162 of the b3GalT-I e nzyme, in the binding of
UDP-sugar donor substrates has been previou sly docu-

mented. In fact, tryptophan residues located NH
2
-proxi-
mally to the DXD motif of clostridial glucosyltransferases
have also been implicated in the binding of UDP-Glc [32].
In addition, the crystal structures of SpsA f rom Bacillus
subtilis [37] and of the bovine b1,4-GalT-I [29], two DXD-
containing glycosyltransferases, s howed an aromatic resi-
due, which is involved in the stacking of t he uracil ring of the
cosubstrate in the catalytic fold. As found for the trypto-
phan analog in the bacterial glucosyltransferase [28] and for
W101 and W162 in murine b3GalT-I, this conserved
aromatic residue is located NH
2
-proximally to t he DXD
motif, and there is no strictly de®ned d istance between this
residue and t he latter m otif. Therefore, it is tempting to
speculate that W101 and W 162 represent analogous
residues to the aromatic residues of SpsA and bovine
b1,4-GalT-I. Taken together, our results provided evidence
that several of t he conserved m otifs common t o b3GT
enzymes are required for proper enzymatic activity. Our
results also suggested the formation of possible disul®de
bonds, which hold the enzyme in a c onformation that is
required f or its catalytic activity. The conservation between
the different members of the b3GT family suggests a
common evolutionary origin; structural requirements for
the catalysis of a b1,3-glycosidic linkage probably main-
tained the motifs in t he evolving polypeptides.
ACKNOWLEDGEMENTS

We thank Bea Berger and Claudia Ruedin for their technical assistance.
This work was supported by the Swiss National Science Foundation
Grants 31-58577.99 to T. H., 5000-57797 to EGB. M. M. was
supported by a scholarship of the M arie Heim-Vo
È
gtlin Foundation.
REFERENCES
1. Campbell, J.A., Davies, G.J., Bulone, V. & Henrissat, B. (1997)
A classi®cation of nucleotide-diphospho-sugar glycosyltransfe-
rases based on amino acid sequence similarities. Biochem. J. 326,
929±939.
2. Yuan, Y.P., Schultz, J., Mlodzik, M. & Bork, P. ( 1997) Secreted
Fringe-like signaling molecules may be glycosyltransferases. Cell
88, 9±11.
3. Moloney,D.J.,Panin,V.M.,Johnston,S.H.,Chen,J.H.,Shao,L.,
Wilson, R., Wang, Y ., Stanley, P., Irvine, K.D., H altiwanger, R.S.
& V ogt, T.F. (2000) Fringe is a glycosyltransferase that modi®es
Notch. Na tu re 406, 369±375.
4. Miyazaki, H., Fukumoto , S., Okada, M ., Hasegawa, T. & Furu-
kawa, K. (1997) Expression cloning of rat cDNA encoding UDP-
galactose: G
D2
b1, 3-galactosyltransferase that determin es th e
expression of G
D1b
/G
M1
/G
A1
. J. Biol. Chem. 272, 24794±24799.

5. Hennet, T., Dinter, A., Kuhnert, P., Mattu, T.S., Rudd, P .M. &
Berger, E .G. (1998) G enomic cloning a nd expression of three
murine UDP-galactose:b-N-acetylgluco samine b1,3-galactosyl-
transferase genes. J. Bio l . Chem. 273, 5 8±65.
6. Kolbinger, F., Strei, M.B. & Katopodis, A.G. (1998) Cloning of
a human UD P-galactose:2-acetamido-2-deoxy-
D
-glucose 3b-galac-
tosyltransferase catalyzing the form ation of type 1 chains. J. Biol.
Chem. 273, 433±440.
7. Amado, M., Almeida, R., Carneiro, F., Levery, S.B., Holmes,
E.H., Nomoto, M., Hollingsworth, M.A., Hassan, H., Schwien-
tek, T., Nielsen, P.A., Bennett, E.P. & Clausen, H. (1998) A family
of h uman b-3-galactosyltransferases ± characterization of four
members o f a UDP-galactose-b-N-acetylglucosami ne/b-N-acetyl-
galactosamine b-1,3-galacto syltransferase family. J. Bio l. C he m.
273, 12770±12778.
8. Isshiki, S., Togayachi, A., Kudo, T., Nishihara, S., Watanabe, M.,
Kubota, T., Kitajima, M., Shiraishi, N., Sasaki, K., Andoh, T. &
Narimatsu, H. (1999) Cloning, expression, and characterization of
a novel UDP-galactose: b-N-acetylglucosamine b1,3-galactosyl-
transferase (b3Gal-T5) responsible for synthesis of type 1 chain i n
colorectal and pancreatic e pithelia and t umor cells derived there-
from. J. Biol. Chem. 274, 1 2499±12507.
9. Zhou, D., Berger, E.G. & Hennet, T. (1999) Molecular clonin g of
a human UDP-galactose: GlcNAcb1,3G alNAc b1,3 galactosyl-
transferase gene encoding an O-linked core3-elongation enzyme.
Eur. J. Biochem. 263, 571±576.
10. Bai, X., Zhou, D., Brown, J.R., H ennet, T. & Esko, J .D. (2001 )
Biosynthesis of the linkage region of glycosaminoglycans: c loning

and activity of galactosyltransferase II, the sixth member of the
b1,3galactosyltransferase f amily (b3GalT6). J. Biol. Chem. DOI
M107339200.
1
11. Shiraishi, N., Natsume, A., T ogayachi, A ., E ndo, T., Akashima,
T.,Yamada,Y.,Imai,N.,Nakagawa,S.,Koizumi,S.,Sekine,S.,
Narimatsu, H. & Sasaki, K. (2000) I de nti®cation and character-
ization of three novel b1,3-N-acetylglucosaminyltransferases
structurally related to the b1,3-galactosyltransferase family. J. Biol.
Chem. 276, 3498±3507.
12. Togayachi, A ., Akashima, T., Ookubo, R ., Kudo, T., Nishihara,
S., I wasaki, H., Natsume, A., Mio, H., Inokuchi, J ., Irimura, T .,
Sasaki, K. & Narimatsu, H. (2001) Molecular c loning and c har-
acterization of UDP-GlcNAc: lactosylceramide b1,3-N-acetyl-
glucosaminlytransferase (b3Gn-T5), an essential enzyme for the
expression of th e HNK-1 an d Lewis X epitopes on g lycolip ids.
J. Biol. Chem. 276, 22032±22040.
13. Henion, T.R., Zhou, D., W olfer, D.P., Jungalwala, F.B. &
Hennet, T. (2001) Cloning of a m ouse b1,3 N-acetylglucosami-
nyltransferase GlcNAc (b1,3) Gal (b1,4) Glc±ceramide synthase
gene encoding the key regulator of lacto±series glycolipid bio-
synthesis. J. Biol. Chem. 276, 3 0261±30269.
14. Okajima, T., Nakamura, Y ., Uchikawa, M., Haslam, D.B.,
Numata, S.I., Furukawa, K., U rano, T. & Furukawa, K. (2000)
Expression cloning of h uman globoside synthase c DNAs. Identi-
®cation o f b3Gal-T3 as UDP-N-acetylgalactosamine:globotriao-
sylceramide b1,3-N-acetylgalactosaminyltransferase. J. Biol. Chem.
275, 40498±40503.
15. Blixt, O., Van D ie, I., Norberg, T. & van den Eijnden, D.H. (1999)
High-level ex pression o f the Neisseria meningitidis lgtA gene in

Escherichia coli and c haracterization of the e ncoded N-acetylglu-
cosaminyltransferase as a useful catalyst i n the synthesis of
GlcNAc b1±3Gal and GalNAc b1±3Gal linkages. Glycobiology 9,
1061±1071.
16. Zhou,D.,Henion,T.,Jungalwala,F.B.,Berger,E.G.&Hennet,T.
(2000) The b1,3-galactosyltransferase b3GalT-V is a stage-speci®c
embryonic a ntigen-3 (SSEA-3) synthase. J. Biol. Chem. 275 ,
22631±22634.
17. Lo, N.W., Shaper, J.H., Pevsner, J. & Shaper, N.L. (1998) The
expanding b4-galactosyltransferase gene family: m essages from
the databanks. Glycobiology 8, 517±526.
18. Joziasse, D.H., Shaper, J .H., van d en Eijnden, D.H., Van Tunen,
A.J. & Shaper, N.L. (1989) Bovine a1±3-galactosyltransferase:
isolation and characte rization of a cDNA clone. i de nti®cation of
homologous sequences in human genomic DNA. J. Biol. Che m.
264, 14290±14297.
19. Yamamoto, F., Clausen, H., White, T., Marken, J. & Hakomori, S.
(1990) Molecular genetic basis of t he histo-blood g ro up ABO
system. Nature 345, 229±233.
20. Higuchi, R., Krummel, B. & Saiki, R.K. (1988) A general method
of in vitro preparation and speci®c mutagenesis of DNA frag-
ments: study o f protein and DNA interactio ns. Nucleic Acids Res.
16, 7351±7367.
238 M. Malissard et al. (Eur. J. Biochem. 269) Ó FEBS 2002
21.Zhou,D.,Malissard,M.,Berger,E.G.&Hennet,T.(2000)
Secretion and pu ri®cation of recombinant b1±4 ga lactosyltrans-
ferase from insect cells using pFmel-protA, a novel tran sposition -
based baculovirus transfer vector. Arch. Biochem. Biophys. 374, 3±7.
22. Luckow, V.A., Lee, S.C., Barry, G.F. & Olins, P.O. (1993) E-
cient generation of infectious recombinant baculoviruses by site-

speci®c t ransposon- mediat ed inse rtio n o f foreign genes i nto a
baculovirus genom e propagated in Escherichia coli. J. Virol. 67,
4566±4579.
23. Laemmli, U.K. (1970) Cleavage of structural proteins d uring the
assembly of the h ead of bacteriophage T4. Nature 227, 680±685.
24. Towbin, H., Staehelin, T. & Gordon, J. (1979) Electrophoretic
transfer of proteins from polyacrylamide gels to nitrocellulose
sheets: procedure and some applications. Proc. Natl Acad. Sci.
USA 76, 4350±4354.
25. Livingston, B.D. & Paulson, J.C. (1993) Polymerase chain reac-
tion cloning of a developmentally regulated member of the
sialyltransferase g ene family. J . Biol. C hem. 268, 11504±11507.
26. Goode, S., Wright, D. & Mahowald, A.P. (19 92) The neurogenic
locus brainiac cooperates with the Dro sophila EGF r ec eptor t o
establish t he ovarian follicle and to determine its dorsal-ventral
polarity. Development 116 , 177±192.
27.Saxena,I.M.,Brown,R.M.Jr.,Fevre,M.,Geremia,R.A.&
Henrissat, B. (1995) Multidomain architecture of b-glycosyl
transferases: implications for mechanism of action. J. Bacteriol.
177, 1419±1424.
28. Busch, C., Hofmann, F., Gerhard, R. & Aktories, K. (2000)
Involvement of a conserved tryptophan residue in the UDP-
glucose binding of large clostridial cytotoxin glycosyltransferases.
J. Biol. Chem. 275, 13228±13234.
29. Gastinel, L .N., Cambillau, C. & Bourne, Y. ( 1999) Crystal
structures of the b ovine b4galactosyltransferase catalytic domain
and its complex with uridine diphosphogalac tose. EMBO J. 18,
3546±3557.
30. Wiggins, C.A. & Munro, S. (1998) Activity of the yeast MNN1
a-1,3-mannosyltransfe rase requires a motif conserved in m any

other f amilies of glycosyltransferases. Pro c. Natl Acad. Sc i. USA
95, 7945±7950.
31. Nagahashi, S., Sudoh, M., Ono, N., Sawada, R., Yamaguchi, E.,
Uchida, Y., Mio, T., Takagi, M., Arisawa, M. & Yamada-Okabe,
H. (1995) Characterization of chitin synthase 2 o f Saccha romyce s
cerevisiae. Implication of two highly conserved domains as pos-
sible c atalytic sites. J. Biol. Chem. 270, 1 3961±13967.
32. Busch, C., Hofmann, F., Selzer, J., Munro, S., Jeckel, D. &
Aktories, K . (1998) A c ommo n motif of eu karyotic glycosyl-
transferases is essent ial for the enzyme activity o f large clostridial
cytotoxins. J. Biol. Chem. 273, 19566±19572.
33. Unligil, U.M., Zhou, S., Yuwaraj, S ., Sarkar, M., Schachte r, H. &
Rini, J.M. (2000) X-ray cry stal structure of rabbit N-acetylglu-
cosaminyltransferase I: catalytic mechanism and a new protein
superfam ily. EMBO J. 19, 5 269±5280.
34. Karlin, S., Zhu, Z.Y. & Karlin, K.D. (1997) The extended envi-
ronment of mononuclear metal centers in protein structures. Proc.
Natl Acad. Sci. USA 94, 14225±14230.
35. Datta, A.K. & Paulson, J.C. (1995) The sialyltransferase Ôsialyl-
motifÕ participates in binding the donor substrate CMP-NeuAc.
J. Biol. Chem. 270, 1497±1500.
36. Datta, A.K., Sinha, A. & Paulson, J.C. (1 998) Mutation of the
sialyltransferase S-sialylmotif alters the kinetics of t he donor and
acceptor substrates. J. Biol . Chem. 27 3, 9608±9614.
37. Charnock, S.J. & Davies, G.J. (1999) Structure of the nucleotide-
diphospho-sugar transferase, SpsA from Bacillus subtilis,innative
and nucleotide-complexed f orms. Biochemistry 38 , 6380±6385.
38. Thompson, J.D., Higgins, D.G. & Gibson, T.J. (1994) Clustal W:
improving the sensitivity of progressive multiple sequence
alignment through sequence weighting, position-speci®c gap

penalties and weight matrix choice . Nucleic Acids Res. 22, 4673±
4680.
Ó FEBS 2002 Mutagenesis of b3GalT-I (Eur. J. Biochem. 269) 239