Báo cáo Y học: Interaction of the anterior fat body protein with the hexamerin receptor in the blowfly Calliphora vicina pot

Interaction of the anterior fat body protein with the hexamerin
receptor in the blowfly
Calliphora vicina
Immo A. Hansen, Susanne R. Meyer, Ingo Scha¨ fer and Klaus Scheller
Department of Cell and Developmental Biology, Biocenter of the University, Wu
¨
rzburg, Germany
In late larvae of the b lowfly, Calliphora v icina, a rylphorin and
LSP-2 p roteins, which belong t o the class of hexamerins, are
selectively t aken up by the fat body from the h aemolymph.
Hexamerin e ndocytosis is mediated by a specific membrane-
bound receptor, the arylphorin-binding protein (ABP).
Using the two-hybrid technique, we found that the anterior
fat bodyprotein ( AFP) interacts with the hexamerin receptor.
AFP, a homologue of the m ammalian c alcium-binding liver
protein regucalcin ( sene scence marker protein-30), exhibits a
strong binding affinity for a naturally occurring C-terminal
cleavage fragment of the hexamerin receptor precursor (the
P30 p eptide) and other receptor c leavage products that
contain P30. Expression of AFP mRNA and protein is
restricted to the anterior part of the fat b ody tissue and to
haemocytes in last-instar larvae. AFP mRNA occurs in all
postembryonic developmental stages. Our r esults suggest
that AFP p lays a r ole in t he r egulation of hexamerin uptake
by fat body cells along the a nterior–posterior axis.
Keywords: anterior f at body protein; Calliphora v icina;
cDNA sequence; he xamerin r eceptor; yeast t wo-hybrid
system.
The construction of adult tissues during the metamorphosis
of holometablous insects requires large amounts of energy
and building blocks. Before formation of the puparium, fat

body cells reabsorb proteins and other macromolecules t hat
have accumulated in the haemolymph during t he larval
feeding period. The major fraction of incorporated proteins
consists of arylphorins a nd LSP-2 which belong to the class
of hexamerins, haemocyanin-related proteins, named
according to their composition of six identical or closely
related subunits [1]. Although some studies suggest that a
nonspecific, general protein uptake mechanism is responsi-
ble for the incorporation of hexamerins [2], the se lectivity of
this process has been demonstrated unambiguously by the
differential clearing of distinct proteins from the haemol-
ymph [3–6]. Transport of h examerins t hrough f at body cell
membranes is controlled by ecdysteroids and mediated by a
specific receptor (for review, see [7]). The hexamerin
receptor of Calliphora vicina was c loned and its post-
translational processing studied in detail. Two c leavage
steps, which d etach a 45-kDa and a 30-kDa peptide from
the h examerin-bin ding N- terminus of the receptor p recursor
(Fig. 1 ), have been shown to be connected to activation of
the receptor and initiation o f hexamerin endocyto sis [8,9].
The principal cell type of the fat body is the trophocyte,
which is morphologically uniform and has long been thought
to have equivalent functions. Almost all experiments dealing
with protein expression a nd sequestration by this tissue have
been performed using the entire fat body [10,11]. However, in
both Diptera and Lepidoptera, data are accumulating that
show regional differences in fat body function. In the corn
earworm, Helicoverpa zea, storage proteins are synthesized
by the peripheral fat body fraction, but are taken up and
stored only by the perivisceral f at body [12]. In the silkworm,

Bombyx mori, it has been demonstrated that dorsal and
ventral perivisceral f at body contains the most competent
cells for sequestering h aemolymph proteins c ompared with
peripheral and hind-gut associated fat body tissue [ 13].
In dipteran insects, differences in both composition and
fate of the anterior and posterior fat body have been
reported. The larval fat body of the fruitfly, Drosophila
melanogaster, a nd the blue b lowfly, Calliphora vicina,is
organized into a lobed tissue of  2000–3000 polytene cells,
which become dissociated from each other during meta-
morphosis. Roughly half of the cell population survives
metamorphosis, indicating a specific degree of differentia-
tion during postembryonic life [ 14,15]. An increase in the
number of storage protein granules found along the
anterior–posterior axis has been described in the fruitfly
Drosophila [16], and rapid degradation of the anterior part
of the fat body tissue after pupariation has been reported in
the fleshfly Sarcophaga peregrina [17]. The authors report
the specific expression of anterior fat body protein (AFP) in
the trophocytes of the anterior fat body of S. peregrina,
demonstrating one of the biochemical differences in dipteran
fat body tissue.
Here we report t he tissue-specific expression of AFP and
its interaction with the h examerin receptor. This is the first
demonstration of a protein–protein i nteraction of the
hexamerin receptor with a nonh exameric partner.
EXPERIMENTAL PROCEDURES
Experimental animals
AstrainofC. vicina that has been maintained in our
laboratory for several decades was used. T he flies were

Correspondence to I. A. Hansen, Medizinische Polyklinik der
Universita
¨
t, Endokrinologie, Josef-Schneider-Str. 2, D-97080
Wu
¨
rzburg, Germany. E-mail:
Abbreviations: ABP, arylphorin-binding protein; AFP, anterior fat
body protein; NBT/BCIP, nitroblue tetrazolium chloride/5-bromo-
4-chloro-3-indonyl phosphate
(Received 22 June 2001, revised 22 October 2001, accepted 7 December
2001)
Eur. J. Biochem. 269, 954–960 (2002) Ó FEBS 2002
reared o n bovine meat a t 25 °C and relative humidity of
65% as previously described [18].
Preparation of fat body tissue and haemocytes
Third-instar larvae were washed in insect saline and anaes-
thetized by cooling on ice for a few minutes. The larvae were
dissected by a medial cut, washed with cold insect saline, and
the fat body tissues excised. For the isolation of haemocytes,
anaesthetized larvae were dried a nd tr ansferred t o a cold
microscope slide. From a small cut in the abdomen,
haemolymph (5–10 lL per larva) was collected by pipette
and transferred to a 1.5-mL Eppendorf t ube on ice. After
centrigugation at 3000 r.p.m. at 4 °C, the supernatant was
removed and the pellet containing the h aemocytes w as
washed twice with ice-cold insect saline and re-centrifuged.
Two-hybrid library construction
Total RNA was isolated from dissected fat body tissues of
third-instar larvae (6–7-day-old larvae) using Trizol reagent

(Gibco) following the supplier’s instructions for fatty tissues.
One microgram of total RNA was used for cDNA synthesis
with the SMART
TM
PCR cDNA Library Construction Kit
(Clontech, Heidelberg, Germany). T he cDNA obtained
included two different SfiI rest riction sites at the 5¢ and 3¢
ends (SfiI/A, Sfi I/B). The two-hybrid library vector pJG4-5
(GenBank accession number U89961) was modified b y
introducing the Sfi I/A and Sfi I/B r estriction sites i nto its
multiple colo ning site allowing directed cloning of the
cDNA. The ligation reaction was c arried out overnight at
16 °C. The library plasmids were transformed in Escherichia
coli XL1-Blue cells via electroporation and grown on Luria–
Bertani plates containing ampicillin. A total of 1.2 · 10
6
independent bacterial clones were obtained and subjected to
plasmid isolation using the QIAfilter Plasmid Mega Kit
(Qiagen, Hilden, Germany). One milligram of library
plasmids was isolated. The cDNA library contains
 3.8 · 10
5
individual clones in the correct reading frame.
The average insert size was 1 kbp.
Construction of hexamerin receptor bait proteins
for two-hybrid screening
Three h examerin receptor bait plasmids wer e constructed
according t o t he natural receptor cleavage products
ABP130, ABP96, ABP64 described previously [9] (Fig. 1).
Using a pBluescript S K+ vec tor bearing t he complete

hexamerin receptor cDNA sequence (GenBank accession
number X79100) as a template, three cDNA fragments were
amplified via PCR u sing different primer combinations:
(1) ABP130: ABP130-5¢(CTCGAGGGTGTTATAATGG
ATCGAGGTGGACGAGT)/ABP130-3¢ (CTC GAG
ATTCAATTATTTAGTACAAATGGCTAAGAGG
CATTT);
(2) ABP96: ABP130-5¢/ABP96-3¢ (CTCGAGAGGCAAC
AACAGACGATGAGGCAACTTA);
(3) ABP64: ABP130-5¢/ABP64-3¢(CTCGAGACCAGA
GATCTCATCATTATCATTGTAATT).
XhoI restriction sites were attached at the 5¢ ends of the
primers. PCR was carried out using P fuTurboÒ DNA
Polymerase (Stratagene, La Jolla, CA, USA) following the
manufacturer’s protocol. The P CR products were sub-
cloned in p CR-Script Amp vector (PCR-Script
TM
Amp
Cloning Kit; Stratagene), excised with XhoI, and finally
ligated in the two-hybrid bait vector p EG202 ( Origene,
Rockville, MD, USA). The orientation and correct insertion
were checked by sequencing u sing the pEG202-seq primer.
Two-hybrid screening
This was c arried out f ollowing a s tandard protocol for
LexA-based two-hybrid systems [ 19]. Thirty-one library
plasmids that interacted with the b aits were isolated from
the yeast and transferred into E. coli XL1-blue cells and
sequenced from the 3 ¢ and 5¢ endonaPerkin–Elmer310
sequencer using the BigDye Terminator Cycle Sequencing
Ready Reaction Kit (P erkin–Elmer).

5¢ RACE
5¢ RACE was p erformed using the SMART
TM
RACE
cDNA Amplification Kit (Clontech, Alameda, CA, USA)
following the manufacturer’s instructions. Two specific
primers were u sed (P1: 5 ¢-GCCATCGGGCAACAAAT
GATCCTTGGGGCTGGTCTTG-3¢;P2:5¢-GATCGG
TTGTACCTTCGACGGGCACAGCAAAACCA-3¢,see
Fig. 3).
Northern-blot hybridization
Total RNA was extracted from freshly prepared t issues
using the TriFast Kit (Peqlab, Erlangen, Germany) and
subjected to electrophoresis in a 0.8% agarose gel. North-
ern-blot analysis was performed according t o standard
procedures [20]. A s a hybridization probe, we u sed a
digoxygenin-labeled antisense R NA, s ynthesized from
Fig. 1. S cheme of the post-translational cleavage pattern of the Calli-
phora h examerin r eceptor [7,9]. The primary translation product con-
tains a 17-amino-acid N -termin al signal p eptide which is removed
immediately after translation. Before reaching the cell membrane, the
receptor precursor is cleaved a second time: a 429-amino-acid C-ter-
minal fragment is removed, giving rise to P45 and ABP96 (807 amino
acids) which comprises the active receptor. The onse t of arylphorin
reabsorption by the fat bo dy coincides with a third receptor cleavage
which generates ABP64 (554 amino acids) and P30 (253 amino acids).
Only ABP 130, ABP96 and P30 are able to b ind hexamerins.
Ó FEBS 2002 Calliphora anterior fat body protein (Eur. J. Biochem. 269) 955
linearized A FP cDN A as template using t he DIG-RNA-
Labeling Kit (T7; Roc he Molecular Biochemicals, Mann -

heim, G ermany). Immunodetection w as carried out using
antibodies to DIG coupled with peroxidas e. The blots w ere
developed b y the nitroblue tetrazolium chloride/5-bromo-
4-chloro-3-indonyl phosphate (NBT/BCIP) metho d.
In situ
hybridization on cryosections
Seven-day-old anaesthetized larvae received injections of
5 lL 4% paraformaldehyde in NaCl/P
i
(7 m
M
Na
2
HPO
4
,
3m
M
NaH
2
HPO
4
, 130 m
M
NaCl) a nd were fixed overnight
in paraformaldehyde/NaCl/P
i
at 4 °C. The fixed larvae were
incubated at 4 °C f or 24 h i n Ringer solution (130 m
M

NaCl, 4.7 m
M
KCl, 0.74 m
M
KH
2
HPO
4
,0.35m
M
Na
2
HPO
4
,1.8m
M
MgCl
2
, p H 7.0) c ontaining 25%
sucrose. Longitudinal cryosections (10 lm) were incubated
for 5 min in 0.1
M
glycine/Tris/HCl buffer (pH 7.0) and
successively for 15 min at room temperature in NaCl/P
i
containing 0.3% Triton X-100. After three wash s teps with
NaCl/P
i
, the sections were fixed for 2 min in 2% paraform-
aldehyde and then for 10 min in 10 m

M
Tris/HCl/1 m
M
EDTA (pH 7.4). After a 1-h prehybridization, the heat-
denatured DIG-labeled AFP-antise nse RNA probe was
added for hybr idization overnight at 42 °C. The slides were
washed according to the following scheme: 3 · 10 min with
4 · NaCl/Cit; 2 · 10minwith2· NaCl/Cit; 1 0 min
with 0.1 · NaCl/Cit; 10 min with 0.05 · NaCl/Cit; 5 min
with NaCl/Tris. After incubation for 30 m in in nonfat dried
milk-saturated NaCl/P
i
, the slides were incub ated for 2 h at
37 °C with antibodies to DIG. After three washes with
NaCl/Tris, the reactive structures were visualized by the
NBT/BCIP method. The specimens were mounted in
Mowiol and analyzed under t he microscope.
Whole-mount
in situ
hybridization
Last-instar larvae were dissected in ice-cold insect saline by a
cut at the posterior end and upending the c omplete larvae.
The gut was removed and the preparations promptly fixed
in MEMFA (0.1
M
Mops, 2 m
M
EGTA, 1 m
M
MgSO

4
,
3.7% formaldeh yde) for 2 h at room temperature. The
tissues were dehydrated with methanol and s tored at )20 °C
until used for whole-mount in situ hybridization [21].
Immuno-coprecipitiation with AFP and ABP antibodies
The anti-ABP IgG recognizes the hexamerin (arylphorin)
receptor of C. vicina [5]. The anti-AFP IgG was provided by
Dr Nakajima and recognizes a 34-kDa AFP in S. peregrina
[17]. Protein A–Sepharose CL-4B (Ph arma Biotech, F rei-
burg, Germany) was s uspended in NaCl/P
i
. The resulting
gel was centrifuged at 1000 g and resuspended in 1 vol.
NaCl/P
i
(SL). Anterior fat body tissue from 8-day-old
larvae was homogenize d in NaCl/P
i
containing 0.05%
phenylthiourea and centrifuged for 5 min at 8000 g at 4 °C.
The s upernatant was used for immunoprecipitation. SL
(50 lL) was incu bated in an Eppendorf cap with 5 lganti-
ABP IgG at 4 °C for 4 h. Then, 500 lL fat body
supernatant or 500 lL haemocytes was added a nd incuba-
ted at 4 °C overnight. As controls, anti-(rabbit LexA) IgG
was a dded as an antibody or NaCl/P
i
was u sed instead of
homogenate. The incubation mixtures were centrifuged and

the pe llet washed eight times with NaCl/P
i
. The last pellet
was suspended in 30 lL s ample buffer, heated at 95 °Cfor
2 min, and centrifuged. The s upernatant ( 15 lL) was
subjected to SDS/PAGE.
Western-blot analysis
For i mmunoblots, the heat-denatured proteins were trans-
ferred to poly(vinylidene difluoride) membranes (Millipore
Corp., Bed ford, MA, USA). The membranes were blocked
with 10% nonfat dried milk/0.3% Tween 20 in NaCl/Tris
and incubated with anti-AFP IgG (0.5 lgÆmL
)1
in NaCl/
Tris containing 1% BSA) for 2 h at room temperature.
After three washes in NaCl/Tris, the secondary antibody
(goat an ti-rabbit IgG conjugated with alkaline phosphatase,
diluted 1 : 7500; Promega, Heidelberg, Germany) was
added and the blots were incubated for 1 h. After three
washes, the blots were developed with NBT/BCIP system as
described under Northern-blot hybridization.
Immunofluorescence analysis
Longitudinal cryosections (10 lm) from the same larvae as
used for in situ hybridization were blocked at room
temperature for 2 h with 3% normal g oat s erum in
0.5 · PAT ( 1 · NaCl/P
i
, 1% albumin, 0.5% Triton X-100)
and then incubated overnight at 4 °C with anti-AFP IgG
(10 lgÆlL

)1
in 0.5 · PAT). A fter three washes with
NaCl/P
i
, t he sections were incubated for 2 h at room
temperature with a Cy2 (cyanine 2-OSu bisfunctional)-
conjugated affinity-purified goat anti-rabbit IgG (1 : 50;
Rockland, Gilbertsville, PA, USA) in 0.5 · PAT. After
being thoroughly washed, the sections were analyzed under
a Leica fluorescent microscope and photographed with a
Pixera CCD camera. The specificity of the AFP immuno-
reaction was verified by omitting the primary antibody.
RESULTS
Screening for interaction with hexamerin receptor
Using the yeast two-hybrid s ystem and ABP 130, as well as
ABP 96 (Fig. 1) as a bait, we isolated 27 Ôinteraction positiveÕ
yeast clones. The library (prey) plasmids of these clones was
isolated. S equence analysis of the cDNAs revealed that 17
were hexamerin cDNAs ( 14 arylphorin and three LSP-2),
confirming the ability of the experimental system to identify
proteins that interact with the hexamerin receptor. Thirteen
of the library plasmids contained cDNAs that encoded
nonhexamerin interactors. In our database search using
BLAST X
analysis, nine showed no homology to a ny known
protein. We identified three cDNAs that encoded a protein
with 93% identity in the deduced amino-acid sequence with
the A FP of S. peregrina (GenBank accession number
BAA99282). Because of the high sequence identity with
the Sarcophaga AFP, we named our clone Calliphora AFP

(GenBank accession number AY028616). The AFP clones
were identified by screening the prey library with ABP130
(once) or ABP96 (twice) as baits.
We also examined the ability of AFP to interact with
ABP130, ABP96, and ABP64 in the two-hybrid assay. We
found a strong interaction between AFP and ABP130 and
ABP96, but no interaction with ABP64 (Table 1).
956 I. A. Hansen et al.(Eur. J. Biochem. 269) Ó FEBS 2002
Immuno-coprecipitation of AFP and hexamerin receptor
To confirm the results d emonstrating the interaction of
AFP with different cleavage products of the hexamerin
receptor, w e used immuno-coprecipitation as an indepen-
dent method. AFP could be precipitated w ith anti-ABP IgG
and the receptor (ABP) with anti-AFP IgG. A s can be seen
from Fig. 2, anti-AFP IgG precipitated the receptor
cleavage f ragment P 30, whereas anti-ABP IgG precipitated
AFP.
Isolation and sequence analysis of full-length AFP cDNA
The deduced peptide sequences of the isolated AFP cDNAs
did not contain a start methionine and were lacking 40
amino acids at the N-terminus compared with the AFP of
S. peregrina (GenBank accession number BAA99282).
5¢-RACE PCR led to an overlapping fragment of 288 bp.
The complete 1 150-bp AFP cDNA obtained (GenBank
accession number AY028616) had an O RF of 921 bp
starting with an ATG c odon at postion 42 and ending with
a TAA codon at position 962 (Fig. 3). The predicted protein
is composed of 306 amino acids, with a calculated molecular
mass of 34.3 kDa and a pI of 5.72. Similar searches with the
deduced amino-acid sequence of f ull-length Calliphora

AFP, tested against the SwissProt database, showed a
93% pairwise amino-acid identity and 97% positivity with
the AFP of S. peregrina, and, furthermore, a 75% identity
and 85% positivity with the AFP o f D. melanogaster
(GenBank accession number JC7250).
The presence of a stop codon at position 33 in the AFP
cDNA ()9 from t he start c odon) explains why we were not
able to isolate a full-length cDNA by two-hybrid screening.
A stop codon at this position interrupts the synthesis of a
two-hybrid fusion protein, if the f ull-lenth c DNA is ligated
in the library plasmid.
Stage-specific and tissue-specific appearance of AFP
We tested the Sarcophaga antibody to AFP for its ability t o
recognize a similar protein in Calliphora by immunoblot
analysis. As s hown in F ig. 4, a 34-kDa protein w as
recognized in the a nterior as w ell as the central, but not
the posterior, part of the fat body (Fig. 4 B). A clear signal
was also detected in the haemocytes. The apparent molec-
ular mass of the detected AFP band (34 kDa) corresponds
well to that calculated from the a mino-acid sequence
(34.4 kDa).
Northern-blot analysis confirms th e presence o f strongly
enriched AFP mRNA (1.2 kbp) in the anterior part of t he
fat body of last-instar larvae (Fig. 5B). The mRNA was also
present in pupae and adults (Fig. 5 A), as well a s in
haemocytes of last-instar larvae (Fig. 5B).
The r esults obtained by i mmunoblot and Northern-
blot analysis were confirmed b y immunofluorescence
(Fig. 6 A–C), in situ hybridization of cryosections (Fig. 6D),
and whole-mount in situ hybridization (Fig. 6E,F). A sharp

border could b e detected b etween flu orescent cells of the
anterior fat body lobe and nonfluorescent cells of the central
lobe in the immunofluorescence experiment (Fig. 6 A). The
whole-mount in situ hybridization revealed that the AFP
mRNA transcription in the fat body is almost exclusively
restricted to the anterior lobes in l ast-instar larvae
(Fig. 6E,F). Haemocytes were sho wn to express the AFP
mRNA (Fig. 6D) and t o synthesize t he AFP protein
(Fig. 6C).
Western b lots, using an antibody that recognizes the
receptor fragments ABP96, ABP64, P45 and P30, showed
that the h examerin receptor is pr esent in a ll fat body
fractions but not in the haemocytes (Fig. 4A).
Fig. 2. Immuno-coprecipitation o f AFP and the Calliphora hexamerin receptor by a ntibodies to ABP and AFP demonstrated by Western b lotting.
(A) Proteins were separated by SDS/PAGE (10% ge l), transferred to membrane filters, and probed with a polyclonal anti-AFP I gG. Fat b ody
extract from 7-day-old larva (H). Fat body proteins after immunoprecipitation with hexamerin receptor antibody (anti-ABP IgG); proteins derived
from p osterior fat body (pF), or anterior fat b ody (aF). Controls: K1 ¼ aF, omitting anti-ABP IgG precipitation; K 2 ¼ a F using anti-(LexA)
IgG instead of anti-AFP IgG; K3 ¼ buffer instead of fat bo dy homogenate. The stained 34-kDa band represents AFP. AB ¼ anti-ABP or anti-
LexA (K2), r espectively. (B) The separate d proteins were probed with a polyclo nal anti-ABP IgG. a F ¼ p roteins from anterior fat body after
immunoprecipitation with anti-AFP IgG. The stained 30-kDa band represents P30. AB ¼ anti-AFP. Visualization of the bands was with a
secondary anti-rabbit antibody coupled with alkaline phosphatase followed by NBT/BCIP colour reaction.
Table 1. I nteraction of AFP with different fragments of the hexamerin
receptor (see Fig. 1) in a two-hybrid experiment. AFP binds to ABP130
and ABP96 but not ABP64. The hexamerin, arylphorin, used as a
positive control, binds to all receptor fragments.
Bait
Library plasmid
(Prey)
Reporter gene
Leu2 lacZ

ABP130 AFP + +
ABP96 AFP + +
ABP64 AFP – –
ABP130 Arylphorin + +
ABP96 Arylphorin + +
ABP64 Arylphorin + +
Ó FEBS 2002 Calliphora anterior fat body protein (Eur. J. Biochem. 269) 957
DISCUSSION
AFP, a binding partner of the hexamerin receptor
The fat body is the biochemically most active organ in
insects, with multi ple functions such as metabolism o f
proteins, carbohydrates and lipids, particularly blood
sugar and haemolymph proteins, such as vitellogenins
and hexamerins. The fat body corresponds functionally, a t
least in p art, to the liver of verte brates. Therefore, this
insect organ is a highly suitable tissue for studies of the
stage-specific and t issue-specific expression of genes, post-
transcriptional r egulation of RNA, and post-translational
control of p rotein bio synthesis. On e of the most detailed
investigations of fat body proteins has b een the metab-
olism of the storage protein arylphorin, which belongs t o
the class of hexamerins [5–9]. These proteins are synthe-
sized in a stage-specific manner and reabsorbed by the fat
body. Hexamerin uptake has been shown to be due to
receptor-mediated endocytosis. As in all other dipteran
insects i nvestigated so far, the hexamerin receptor of
C. vicina is subjected to threefold post-translational cleav-
age, which succesively results in the active receptor
involved in endocytosis. T he last cleavage step is initiated
by ecdysteroids, the hormone acting at the post-transla-

tional l evel [7,9].
Fig. 4. Tissue-specific appearance of AFP and the hexamerin receptor. (A) Extracts of a nterior ( aF), c entral ( cF), po sterior (pF) f at b ody, hae-
mocytes (H) and cell-free ha emolyph (s) were analyzed by S DS/PAGE (8% gel) and probed with a polyclonal anti-ABP antib ody using the BCIP/
NBT colour reaction. The cleavage fragments (ABP96, ABP64, P45, P30) of the hexamerin receptor can be observed e xclusively in the fat body but
not in the haemocytes and haemolymph. (B) Same protein samples as in (A) probed with an anti-AFP IgG. Large amounts of the 34-kDa protein
(AFP) can be detected in the anterior part of t he fat body (aF); substantial l ess protein is found in the cen tral (cF) fat body and no AFP in t he
posterior fat body (pF) and within the cell-free haem olymp h (s). AFP can also be observed in the haemocytes ( H).
Fig. 3. Nucleic acid and deduced amino-acid
sequences of the cDNA encoding Calliphora
AFP. The specific primers used for RACE
PCR are underlined, and the additional
N-terminal sequence obtain ed by 5¢ RACE is
enclosed in shaded boxes. Start and termina-
tion codons are in bold letters, and the
putative polyadenylation signal is double-
underlined.
958 I. A. Hansen et al.(Eur. J. Biochem. 269) Ó FEBS 2002
Looking for binding partners of the hexamerin receptor,
we constructed and screened a cDNA library of C. vicina
RNA from fat body by two-hybrid assays. In addition to the
conversant interactors arylphorin and LSP-2, which belong
to the hexamerin family, we identified AFP as a strong
interactor. T he two-hybrid analysis and the results of t he
immuno-coprecipitation revealed that AFP i nteracts with
P30 and with all cleavage products of the hexamerin
receptor that contain this peptide (AB P130, ABP96),
whereas shorter N-terminal fragments of the receptor that
do not include P30 show no interaction with AFP (Table 1).
Thus, three cleavage products are possible interactors in vivo:
ABP130, ABP96 and P30. However, significant interaction

of AFP and peptides derived from the hexamerin receptor
precursor can only take place in the anterior l obe of the fat
body because of the large amounts of AFP in this tissue.
Expression of AFP in
C. vicina
As in almost all experiments dealing with protein expression
and sequestration, these s tudies were performed using the
entire fat body. Here we show that AFP is exclusively
expressed in the anterior pair of fat body lobes of last-instar
larvae, and the median and posterior lobes appear to be free
from AFP. This region-specific expression pattern a lso
resembles that reported for S. peregrina [17]. As the anterior
part of the fat body is in contact with the ring gland, the
ecdysteroid-producing organ, its function may be more
under endocrine control t han t he central and posterior
parts, which are provided with hormones circulating in the
haemolymph.
In addition to its exp ression in t rophocytes of the
anterior fat body, AFP was found to be present in
another cell type. Larval haemocytes contain substantial
amounts of A FP mRNA (Fig. 5B) and AFP protein
(Fig. 4 B). A s t hese cells never express the hexamerin
receptor (Fig. 4A), AFP must have different functions in
the two cell types. Cell-free haemolymph preparations
were negative, indicating that AFP is not secreted into the
haemolymph. AFP does not contain a transmembrane
transport s ignal peptide.
Fig. 5. Northern blot demonstrating the stage-specific and tissue-specific
appearance of AFP mRNA. (A) Stage specificity of AFP mRNA
expression. Total fat b ody RNA (20 lg) isolated from different

developmental stages was applied to each slot. A digoxygenin-labeled
antisense AFP RNA probe was used with an alkaline phosphatase-
linked anti-digoxygenin IgG. Hybridization resulted in a distinct b and
at 1.2 kb. RNA was derived from l ast-instar larvae (4–7: 4–7-day-old
larvae), prepupae (V), and pupae (P ). Adult flies (Ad) do n ot show a
distinct band, indicating weak e xpres sion of AFP mRNA. (B) Tissue
specificity of AFP mRNA expression. Same probe as in (A). Total
RNA was prepared from anterior (aF), central (cF) and posterior (pF)
fat b ody, and haemocytes (H) of 7-day-old pupae . The 1.2-kb signal
was detected in the anterior fat body and the haemocytes. A light signal
only appears in the central fat body; no signal was obtained in the
posterior fat body.
Fig. 6. Immunostaining and in situ hybridization of Calliphora fat body. Longitudin al cryosections (10 lm) of 7-day-old larvae (A–C) were stained
with a Cy2-conjugated goat anti-rabbit IgG after incubation with rabbit anti-AFP IgG. (A) In the border region of anterior (aF) and central fat
body (cF), AFP-immunostaining appears only in the anterior fat body. (B) In a single fat body cell of the anterior fat body, AFP immunostaining is
restricted to the cytoplasm. (C) AFP immunostaining can also be found in the cytoplasm of haemocytes. (D) In situ hybridization of longitudinal
cryosections with a digoxygenin-labeled antisense AFP RNA probe shows no expression of AFP in muscle (m) and posterior fat body cells (pF).
Haemocytes (hc) show high expre ssion of AFP m RNA. (E,F) Whole-mount in situ hybridization of upended 7-day-old larvae. The anterior fat
body exhibits strong expression of AFP mRNA, whereas only weak expression is seen in the central fat body (cF) and no expression in the posterior
fat body (pF) or the brain. The white bars in dicate 50 lm, and the black b ars indicate 250 lm.
Ó FEBS 2002 Calliphora anterior fat body protein (Eur. J. Biochem. 269) 959
The possible function of AFP
Nothing is known a bout the function of AFP to date. Its
amino-acid sequence contains no conversant domains that
suggest a function. In contrast with the mammalian liver
protein, regucalcin, which is assumed to be derived from a
common anc estral gene, AFP has been shown to have no
calcium-binding activity in S. pe regrina [17] and is upregu-
latedinadultD. melanogaster reared at low temperatures
[22].

The i nteraction of AFP a nd the hexamerin receptor,
shown in this paper, gives a first clue to a possible function of
this protein. From our data, we conclude that it may b e
involved in endocytosis of hexamerin by interacting with the
receptor. As mentioned above, this molecular in teraction can
only occur in the anterior fat body, a tissue known to contain
fewer protein storage granules, particularly fewer hexamerin
storage particles (R. Marx, personal communication), than
the central and p osterior parts [16] and which rapidly
disintegrates shortly after pupariation [17]. We speculate
that, because of t he interaction with AFP, most o f the
hexamerin receptor i s inactivated in the anterior fat body
preventing uptake of storage protein in this part of the tissue.
This study opens the wa y to further experiments in two
distinct areas. On the one hand, the binding domains of
AFP and the hexamerin receptor could be m apped in detail
by functional dissection using truncated prey proteins in
two-hybrid experiments. On the other hand, the use of
antibodies against AFP in in vitro and in vivo experiments
investigating hexamerin uptake by the anterior fat body
may g ive insights i nto the nature of the i nteractions
described above. Such approaches could l ead to a better
understanding of the regulation of endocytotic uptake in the
insect fat body and beyond. It is possible that hexamerin
endocytosis in insects does not follow t he standard scheme
of eukaryotic endocytosis.
ACKNOWLEDGEMENTS
This work was supported by a grant from the Deutsche Forsch ungs-
gemeinschaft (Sche 195/13). W e are indeb ted to Dr Nakajima for the
gift of antibodies against AFP. We thank Anneliese Striewe -Conz and

Dieter Dudaczek for competent technical assistance.
REFERENCES
1. Telfer, W.H. & Kunkel, J.G. (1991) The function and evolution of
insect storage h examers. Annu. Rev. Entom ol. 36, 205–228.
2. Duhamel, R.C. & Kunkel, J.G. (1987) Moulting-cycle regulation
of h aemolymph protein c learance in cockroache s: possible size-
dependent mechanism. J. Insect Physiol. 33, 1 55–158.
3. Pan, M.I. & Telfer, W.H. (1992) Selectivity in storage hexamerin
clearing demonstrated with hemolymph transfusions between
Hyalophora cecropia an d Actias luna. Arch. Insect B iochem.
Physiol. 19, 203–219.
4. Wang, Z. & Ha unerland, N. ( 1994a) Receptor-mediated endo-
cytosis of storage proteins by the fat body of H elicoverpa zea. Cell
Tissue Res. 278, 107–115.
5. Burmester, T. & Scheller, K. (1995) Ecdysterone-mediated uptake
of arylphorin by larval fat bodies of Calliphora vicina: involvement
and developmental regulation of arylphorin binding proteins.
Insect Biochem. Mol. Biol. 25, 799–806.
6. Burmester, T. & Scheller, K. (1997) Conservation of hexamerin
endocytosis in Diptera. Eur. J. Biochem. 244, 713–720.
7. Burmester, T. & Scheller, K. (1999) Ligands and receptors: com-
mon theme in insect storage protein transport. Naturwissenschaften
86, 468–474.
8. Burmester, T. & Scheller, K. (1995) Complete cDNA-sequence of
the recepto r responsible for arylphorin uptake by the larval fat
body of the blowfly, Calliphora vicina. Insect Biochem. Mol. Biol.
25, 981–989.
9. Burmester, T. & Scheller, K. (1997) Developmentally controlled
cleavage of the Calli phora arylphorin rece ptor and posttransla-
tional regulation by 2 0-hydroxy-e cdysone . Eur. J. Biochem. 24 7,

695–702.
10. Locke, M. & Collins, J.V. (1965) The structure and formation of
protein granules in the fat body of an insect. J. Cell Biol. 26, 857–884.
11. Locke, M. & Collins, J.V. (1968) Protein uptake in multivesicular
bodies and sto rage g ranules in the fat body of an i nsect. J. Cell
Biol. 36, 453–483.
12. Wang, Z. & Haunerland, N. (1994b) Storage protein uptake in
Helicoverpa zea: arylphorin and VHDL share a single receptor.
Arch. Insect. Biochem. Physiol. 26, 15–26.
13. Vanishree, V., Nirmala, X. & Krishnan, M. (1999) Differential
synthesis of storage proteins by various fat body tissues during
development of f emale silkworm, Bombyx mori. SAAS Bull.:
Biochem. Biotechnol. 12, 69–89.
14. Ritzki, T.M. ( 1978) Fat body. In The Genetics and Biology of
Drosophila (Ash burner, A. & Wright, T.R.F., e ds), Vol 2 b,
pp. 561–601. Academic Press, New York.
15. Du
¨
bendorfer, A. & Eichenberger, S. (1985) In vitro metamorphosis
of insect cells and t issues : devel opmen t and fun ction of fat b ody
cells in embryonic cell cultures of Drosop hila. In Metamorphosis
(Balls, M. & Bownes, M., eds), pp. 146–161. Oxford University
Press, Oxford.
16. Butterworth, F.M. & Rasch, E.M. (1986) A d ipose tissue of
Drosophila melanogaster. VII. Distribution of nuclear DNA
amount along the an terior-posterior axis in the larval fat body.
J. Exp. Zool. 239, 77–85.
17. Nakajima, Y. & Natori, S. (2000) Identification and character-
ization of an anterior fat body protein in an insect. J. Biochem.
127, 901–908.

18. Scheller, K. & Karlson, P. (1977) Effects of ecdysteroids on RNA
synthesis of fat body cells in Calliphora vicina. J. Insect Physiol. 23,
285–291.
19. Ausubel, F.M., Brent, R., Kingston, R.E ., Moo re, D.D ., Seid -
man,J.G.,Smith,J.A.&Struhl,K.(1998)Current Protocols in
Molecular Biology. John W iley & Sons, Ne wYork.
20. Sambrook, J., Fritsch, E.F. & Maniatis, T. (1989) Molecular
Cloning: A Laboratory Manual, 2nd e dn. Cold Spring Harbor
Laboratory Pr ess, Col d Spring Ha rbor , NY.
21. Harland, R.M. (1991 ) In situ hybridiz ation: an improved w hole -
mount method for Xenopus embryos. Methods Cell Biol. 36,
685–695.
22. Goto, S.G. (2000) Expression of Drosophila homologue of s enes-
cence marker protein-30 during cold acclimation. J. Insect Physiol.
46, 1111–1120.
960 I. A. Hansen et al.(Eur. J. Biochem. 269) Ó FEBS 2002