Báo cáo Y học: The Saccharomyces cerevisiae type 2A protein phosphatase Pph22p is biochemically different from mammalian PP2A potx

The
Saccharomyces cerevisiae
type 2A protein phosphatase Pph22p
is biochemically different from mammalian PP2A
Piotr Zabrocki
1
, Wojciech Swiatek
1
, Ewa Sugajska
1
, Johan M. Thevelein
2
, Stefaan Wera
2
and Stanislaw Zolnierowicz
1,
*
1
Cell and Molecular Signaling Laboratory, Intercollegiate Faculty of Biotechnology UG-MUG, Gdansk, Poland;
2
Laboratorium
voor Moleculaire Celbiologie, K.U. Leuven, Leuven-Heverlee, Flanders, Belgium
The Saccharomyces cerevisiae type 2A protein phosphatase
(PP2A) Pph22p differs from the catalytic subunits of PP2A
(PP2Ac) present in mammals, plants and Schizosaccharom-
yces pombe by a unique N-terminal extension of approxi-
mately 70 amino acids. We have overexpressed S. cerevisiae
Pph22p and its N-terminal deletion mutant DN-Pph22p in
the GS115 strain of Pichia pastoris and purified these
enzymes to apparent homogeneity. Similar to other
heterologous systems used to overexpress PP2Ac, a low yield

of an active enzyme was obtained. The recombinant
enzymes designed with an 8 · His-tag at their N-terminus
were purified by ion-exchange chromatography on DEAE-
Sephacel and affinity chromatography on Ni
2+
-nitrilotri-
acetic acid agarose. Comparison of biochemical properties
of purified Pph22p and DN-Pph22p with purified human
8 · His PP2Ac identified similarities and differences
between these two enzymes. Both enzymes displayed similar
specific activities with
32
P-labelled phosphorylase a as
substrate. Furthermore, selected inhibitors and metal ions
affected their activities to the same extend. In contrast to
the mammalian catalytic subunit PP2Ac, but similar to the
dimeric form of mammalian PP2A, Pph22p, but not
DN-Pph22p, interacted strongly with protamine. Also with
regard to the effects of protamine and polylysine on phos-
phatase activity Pph22p, but not DN-Pph22p, behaved
similarly to the PP2Ac–PR65 dimer, indicating a regulatory
role for the N-terminal extension of Pph22p. The N-terminal
extension appears also responsible for interactions with
phospholipids. Additionally Pph22p has different redox
properties than PP2Ac; in contrast to human PP2Ac it
cannot be reactivated by reducing agents. These properties
make the S. cerevisiae Pph22p phosphatase a unique enzyme
among all type 2A protein phosphatases studied so far.
Keywords: Saccharomyces cerevisiae; protein phosphatase
Pph22p; protein phosphatase 2A; heterologous expression,

Pichia pastoris.
Reversible protein phosphorylation catalysed by protein
kinases and phosphoprotein phosphatases is a major
mechanism utilized by eukaryotic organisms to regulate
various cellular processes [1]. Protein kinases are apparently
derived from one primordial gene. In contrast, protein
phosphatases are encoded by at least three unrelated gene
families. Based on primary and tertiary structure similarit-
ies, protein phosphatases are currently classified into PPP,
Mg
2+
-dependent PPM (both PPP and PPM are specific
against phosphoserine/phosphothreonine residues) and
PTP (phosphotyrosine residues-specific) families [2,3]. The
PTP family comprises also dual-specificity phosphatases
that are able to dephosphorylate all three phospho-residues
[4]. Mammalian type 2A protein phosphatase (PP2A), a
member of the PPP family, displays a broad substrate
specificity in vitro. However, its in vivo substrate selectivity,
enzymatic activity and subcellular localization are regulated
by the association with regulatory subunits [5,6]. Thus, two
different dimeric forms of PP2A are formed by the
association of the catalytic subunit (PP2Ac) with PR65/A
scaffolding subunit or a4 protein. In addition, association of
a third variable subunit derived from the unrelated protein
families PR55/B, PR61/B¢ or PR72/B¢¢ to the PR65/A–
PP2Ac dimer results in the formation of trimeric PP2A [6].
In vivo substrates of PP2A in mammalian cells comprise
protein kinases and transcription factors [7]. However, the
identity of many physiological substrates of PP2A still

remains elusive.
In budding yeast Saccharomyces cerevisiae protein kin-
ases and protein phosphatases regulate cell growth, cell cycle
progression, bud formation and morphogenesis as well as
nutrient- and pheromone-induced signalling [8]. The num-
ber of protein kinases in yeast (119) is approximately four
times higher than the number of protein phosphatases (31)
[9]. However, by association of a single catalytic subunit
with different regulatory subunits, protein phosphatases can
form several functional holoenzymes and thus match the
complexity of protein kinases [2,3,5–7]. All above listed
families of protein phosphatases are encoded by the
S. cerevisiae genome and represented by 12 (PPP),
Correspondence to S. Wera, Laboratorium voor Moleculaire
Celbiologie, K.U. Leuven, Kasteelpark Arenberg 31,
B-3001 Leuven-Heverlee, Flanders-Belgium.
Fax: + 32 16 32 19 79, Tel.: + 32 16 32 15 00,
E-mail:
Abbreviations: PP2A, protein phosphatase type 2A; PP2Ac, the
catalytic subunit of PP2A; Pph21/22p, PP2Ac from Saccharomyces
cerevisiae; PR65/A, the structural subunit of PP2A; KM71
and GS115, strains of Pichia pastoris; GSSG, glutathione disulfide;
GSH, reduced glutathione.
Enzyme: protein phosphatase 2A (EC 3.1.3.16).
*Note: deceased on 13 February 2001.
(Received 31 January 2002, revised 15 April 2002,
accepted 29 April 2002)
Eur. J. Biochem. 269, 3372–3382 (2002) Ó FEBS 2002 doi:10.1046/j.1432-1033.2002.02965.x
6 (PPM) and 13 (PTP) members [8,9]. In budding yeast
Schizosaccharomyes pombe, PP2A is encoded by PPH21

and PPH22 [10]. Both Pph21p and Pph22p are involved in
actin cytoskeleton reorganization, bud morphogenesis and
cell cycle progression from G
2
to M [11–13]. Pph21p and
Pph22p are highly similar (87%) and apparently perform
overlapping functions. Deletion of both PP2A catalytic
subunit genes in budding yeast results in very slow growth.
Additional deletion of the PP2A-related PPH3 gene is lethal
[11,14]. Four polypeptides, encoded by CDC55, TPD3,
RTS1 and TAP42, form complexes with PP2A catalytic
subunits in yeast [12,15–17]. Cdc55p, Tpd3p, Rts1p and
Tap42p correspond, respectively, to mammalian PR55/B,
PR65/A, PR61/B¢ and a4. The corresponding genes are not
essential but their mutation results in specific phenotypes.
Moreover, two genes (RRD1 and RRD2) encoding homo-
logues of mammalian phosphotyrosine phosphatase activa-
tor (PTPA), a protein isolated from mammalian tissue
based on its ability to stimulate PP2A activity against
phosphotyrosine residues, are present in the budding yeast
genome [18,19].
All catalytic subunits of PP2A from various species are
subject to diverse regulatory control mechanisms. Carbo-
xymethylation of Leu309 (Leu377 of S. cerevisiae) influen-
ces PP2A activity of PP2A and is a signal for exchanging
variable regulatory B family subunits [20–22] (reviewed in
[23]). Phosphorylation of Tyr307 is dependent on insulin,
epidermal growth factor, interleukin-1, tumour necrosis
factor a (and some other pathways) and inactivation of
phosphatase activity (reviewed in [24]). However no data

are available concerning phosphorylation of Tyr375 in
S. cerevisiae. PP2Ac is also phosphorylated on a threonine
residue, but the role and site(s) of phosphorylation is
unknown [25]. PP2A interacts with second messenger
C
2
-ceramide and phospholipids, which stimulate its activity
(reviewed in [23,24,26]). Moreover, PP2A can potentially be
regulated by changes in the redox state of the catalytic
subunit [27,28].
Both Pph21p and Pph22p differ from the catalytic
subunits of PP2A (PP2Ac) of mammals, plants and
Schizosaccharomyces pombe by the presence of a unique
N-terminal extension of approximately 70 amino acids. In
order to assess the impact of this N-terminal extension on
enzymatic properties of PP2A we expressed 8 · His-tagged
Pph22p and a mutant of Pph22p lacking the N-terminal
extension (DN-Pph22p) in the yeast Pichia pastoris, purified
the phosphatases to apparent homogeneity and compared
their biochemical properties to that of purified 8 · His-
tagged human PP2Ac expressed in Pichia.
MATERIALS AND METHODS
Host strains, media and buffers
The strain GS115 (his4, AOX1, AOX2)ofP. pastoris was
used for the overexpression of S. cerevisiae Pph22p,
DN-Pph22p and N-terminus of Pph22p (first 77 amino
acids). Human PP2Aca and PR65a/Aa were overexpressed
and purified using KM71 (his4, aox1, AOX2) as described
previously [29]. All strains were grown, transformed, and
analyzed according to the manufacturer’s (Invitrogen)

instructions. Escherichia coli strains DH5a and Top 10F¢
were used for all plasmid constructions and propagations.
The following media were used to grow P. pastoris:RDB-
agar: 1
M
sorbitol, 2% glucose, 1.34% yeast nitrogen base
without amino acids, 4 · 10
)5
% biotin, 2% agar; MD
medium: 1.34% yeast nitrogen base without amino acids,
4 · 10
)5
% biotin, 2% glucose; MM medium: 1.34% yeast
nitrogen base without amino acids, 4 · 10
)5
%biotin,0.5%
methanol; YPD: 1% yeast extract, 2% peptone, 2% glucose
pH 5.8 adjusted with HCl; MGY medium: 1.34% yeast
nitrogen base without amino acids, 4 · 10
)5
%biotin,1%
glycerol. The following buffers were applied to purify
recombinant Pph22p and DN-Pph22p: SCED buffer: 1
M
sorbitol, 10 m
M
sodium citrate pH 7.5, 10 m
M
EDTA,
10 m

M
dithiothreitol; breaking buffer: 50 m
M
Tris/HCl
pH 7.5, 1 m
M
EDTA, 0.1% 2-mercaptoethanol, 10 m
M
NaCl, 5% glycerol, 10 m
M
phenylmethanesulfonyl fluoride
and 20 m
M
benzamidine; buffer A: 20 m
M
Tris/HCl
pH 7.5, 170 m
M
NaCl (150 m
M
for DN-Pph22p purifica-
tion), 0.1 m
M
EDTA, 0.1% 2-mercaptoethanol, 5% gly-
cerol, 1 m
M
phenylmethanesulfonyl fluoride and 2 m
M
benzamidine; buffer B: 20 m
M

Tris/HCl pH 7.5, 450 m
M
NaCl, 30 m
M
imidazole, 5% glycerol and 0.01% Triton
X-100; buffer C: 20 m
M
Tris/HCl pH 7.5, 20% glycerol
(± 0.5 m
M
dithiothreitol).
Molecular cloning of the Pph22p expression constructs
Genomic DNA of S. cerevisiae strain W303 was obtained
by the ammonium acetate method [30] and used as template
to amplify the PPH22 open reading frame with Pfu DNA
polymerase (Stratagene) using a standard protocol. The
following primers were used: sense (1), 5¢-CG
GGATCC
ACCATGCATCATCATCATCATCATCATCATGATA
TGGAAATTGATGACCCTATG-3¢ (BamHI site under-
lined, 8 · His-tag bold) and antisense (2), 5¢-CG
GAA
TTCTTATAAGAAATAATCCGGTGTCTTC-3¢ (EcoRI
site underlined). For cloning of DN-Pph22p (Pph22p
without first 77 amino acids) and the N-terminus of Pph22p
(only the first 77 amino acids) we used: sense primer:
5¢-CG
GGATCCACCATGCATCATCATCATCATCAT
CATCATCTTGACCAATGGATTGAGCATTTG-3¢
(BamHI site underlined, 8 · His-tag bold) and antisense:

5¢-CG
GAATTCTTACTGATTTATATTTGTATTGGT
CAG-3¢ (EcoRI site underlined). The PCR products were
digested with EcoRI and BamHI and purified by agarose
gel electrophoresis using the Geneclean III kit (BIO101).
The isolated fragments were first subcloned into pBluescript,
and the resulting plasmid amplified in Escherichia coli.
Subsequently, the Pph22p-encoding fragments were sub-
cloned into the pPIC3.5K vector (Invitrogen). All plasmids
used were sequenced with vector- and cDNA-specific
primers.
Homologous recombination in KM71 and GS115 strains
of
Pichia pastoris
Ten micrograms of plasmid DNA produced in E. coli
DH5a strain, was either used without restriction enzyme
digestion or linearized with either SalI, NotIorBglII in
thecaseofpPIC3.5K-PPH22 and SalI in the case of
pPIC3.5K-DN-PPH22 and pPIC3.5K-Nterm (N-terminus
of Pph22p) or not digested, and transformed by the
spheroplast method into KM71 and GS115 strains of
P. pastoris. Transformed yeast cells were plated on
Ó FEBS 2002 Characterization of protein phosphatase Pph22p (Eur. J. Biochem. 269) 3373
RDB-agar plates and transformants were transferred to
plates with either glucose (MD) or methanol (MM) medium
as a carbon source. Transformants that displayed the ability
to grow on both carbon sources were selected for further
evaluation. The presence of cDNA encoding Pph22p, DN-
Pph22p and N-terminus of Pph22p integrated into the yeast
genome was confirmed by PCR analysis applying sense and

antisense oligonucleotides to amplify the PPH22 gene
(sequences listed above). Transformants obtained using
undigested plasmid DNA in KM71 strain and those
obtained after linearization of plasmid with both SalIand
NotI in GS115 in case Pph22p were used for further
evaluation. In case DN-Pph22p and N-terminus of Pph22p
transformants obtained from both kind of DNA (undigest-
edanddigestedwiththeSalI) were used for further
experiments. In order to select transformants with the
highest copy number of PPH22 genes and mutants genes
inserted into the Pichia genome, yeast colonies were
transferredtoYPD-agarplatesorYPD-agarplatescon-
taining G418 (Calbiochem) added at 2 and 4 mgÆmL
)1
.The
fastest growing colonies were selected from YPD-agar
plates containing 4 mgÆmL
)1
G418 and those were selected
for mini-scale expression studies.
Mini-scale expression of Pph22p and DN-Pph22p
in
P. pastoris
Recombinants obtained in the KM71 strain (His
+
Mut
S
,
slow methanol utilization) or in the GS115 strain (either
His

+
Mut
+
or His
+
Mut
S
, fast and slow methanol utiliza-
tion, respectively) were grown for 24 h in 10 mL of MGY to
reach a D
600
between 2 and 6. Yeast cells were centrifuged
and resuspended in MM medium using 0.2 volume of
starting culture volume for His
+
Mut
S
or adjusting D
600
to 1
for His
+
Mut
+
. Methanol-induced cultures were grown at
30 °C in an Aquatron AI 15 incubator (Infors HT) with
shaking set up to 280 r.p.m. Methanol was added to 0.5%
(v/v) every 24 h and the induction was carried out for
9 days. To determine the optimal time for protein expres-
sion, aliquots of the cultures were removed at 24-h intervals

and analyzed for the presence of the heterologous protein
by SDS/PAGE with Coomassie staining, immunodetection
with Tetra-His antibodies (Qiagen) and phosphatase
activity measurements. Recombinant GS115 (His
+
Mut
+
)
obtained after transformation of yeast with the NotI
linearized plasmid displaying the highest level of Pph22p
expression, was used for further experiments. In case of
DN-Pph22p and N-terminus for further experiments trans-
formants GS115 (His
+
Mut
+
) obtained with plasmids
linearized with the SalIwereused.
Midi-scale expression of recombinant proteins
in
P. pastoris
For the midi-scale expression of proteins the selected GS115
(His
+
Mut
+
) strain was cultured in a 100-mL baffled flask
in 25 mL of MGY medium at 30 °C with shaking at
205 r.p.m. This yeast preculture reached an D
600

 5after
24 h; then 5 mL of the preculture was used to inoculate five
portions of 1 L each of MGY medium and grown in 3 L
flasks to D
600
between 2 and 6. Cells were harvested, washed
and resuspended in 1 L of MM medium to induce
overexpression of heterologous proteins. These cultures
were grown for 24 h at 30 °C with shaking set at 205 r.p.m.
After centrifugation at 2000 g for 5 min at room tempera-
ture the cell pellet was washed with ice-cold water and
stored at )80 °C.
Purification of recombinant Pph22p and DN-Pph22p
Methanol-stimulated GS115-PPH22 (or GS115-DN-
PPH22) cells (approximately 50 g) were resuspended in
100 mL of SCED buffer supplemented with 150 mg
(84.7 UÆmg
)1
)ofyeastlyticasefromArthrobacter luteus
(ICN) and incubated at 30 °Cfor90mintoachieve
spheroplast formation. The spheroplasts were harvested by
centrifugation at 750 g for 10 min at 25 °C and resus-
pended in 50 mL of ice-cold breaking buffer. Acid-washed
glass beads (size 450–500 lm) were added (1 : 1, v/v) and
the mixture was vortexed (MS-1 minishaker, IKA) 10
times for 1 min each with 1-min intervals for cooling on
ice. The lysates were cleared by centrifugation at 30 000 g
for 30 min at 4 °C. Cell-free supernatants were combined
and fractionated with ammonium sulfate added to obtain
45% saturation. The precipitated protein was collected by

centrifugation, dissolved in 20 mL of buffer A and dialysed
against buffer A. The dialysate was loaded at a flow rate of
15 mLÆh
)1
onto a DEAE-Sephacel column (2 · 10 cm)
equilibrated previously with buffer A. The column was
washed with 20 column volumes of buffer A and
phosphatase activity was eluted with a linear gradient
from 170 m
M
to 500 m
M
NaCl (in the case of DN-Pph22p
from 150 to 700 m
M
NaCl) in buffer A collecting 3-mL
fractions. The fractions containing phosphatase activity
were combined, dialysed against buffer B and loaded onto
aNi
2+
-nitrilotriacetate agarose (Qiagen) column
(2 · 3 cm). The column was washed with buffer B and
protein eluted with a linear gradient of imidazole from 30
to 200 m
M
, collecting 2-mL fractions. The fractions were
analysed by immunodetection with Tetra-His antibodies
and phosphatase activity assays. Combined fractions
corresponding to the peak of Pph22p activity were dialysed
against buffer C with or without dithiothreitol and stored

in small aliquots at )80 °C. Protein concentration was
determined by the Bradford method using bovine serum
albumin as standard.
Antibodies and immunodetection
To detect recombinant His-tagged proteins monoclonal
mice IgG
1
Tetra-His antibodies (Qiagen) were applied as
primary antibodies followed by goat anti-mouse horse
radish peroxidase-coupled secondary antibodies (Santa
Cruz Biotechnology Inc.). The colour reaction was devel-
oped in the presence of reduced form of NAD plus either
nitro blue tetrazolium (Sigma) or 4-chloro-1-naphthol (Sig-
ma). When goat anti-mouse alkaline phosphatase-coupled
secondary antibodies were applied the colour reaction was
developed in the presence of nitro blue tetrazolium and
5-bromo-4-chloro-3-indolyl phosphate (ICN).
Phosphatase activity assays
Protein phosphatase activity was measured with
32
P-labelled
phosphorylase a (10 l
M
) as substrate as described pre-
viously [31]. When indicated, protamine (33 lgÆmL
)1
)and
3374 P. Zabrocki et al. (Eur. J. Biochem. 269) Ó FEBS 2002
ammonium sulfate (16 m
M

), were included in the assay
buffer. The recombinant PR65/A subunit was preincubated
with PP2Ac, Pph22p or DN-Pph22p in 20 m
M
Tris/HCl
pH 7.4, 50 m
M
NaCl, 0.1 m
M
EDTA and 0.1% 2-mercapto-
ethanol for 10 min at 30 °C before the reaction was
started with
32
P-labelled phosphorylase a. To measure the
effect of pH on PP2A activity the buffer containing 20 m
M
sodium acetate/acetic acid, 20 m
M
imidazole/HCl and
20 m
M
Tris/HCl covering pH from 5.0 to 10.0 was applied.
One unit of phosphatase activity corresponds to 1 lmol of
32
P
i
released from
32
P-labelled phosphorylase a per min at
30 °C.

For activity assays with lipids, reactions were carried out
described previously [26] with minor changes. Lipids and
phosphatases were incubated on ice for 30 min, prior to the
phosphatase activity assay. Reactions were carried out for
15–30 min at 30 °C. The assay was terminated by addition
of 0.1 mL 1 m
M
KH
2
PO
4
in 1
M
H
2
SO
4
and 0.3 mL 2%
ammonium molybdate. After 10 min of incubation a
toluene/isobutyl alcohol mixture (1 : 1) was added, vortexed
for 10 s and centrifuged for 10 min. Free
32
P
i
was
determined from the radioactivity recovered in the organic
phase.
32
P-Labelled phosphorylase a hydrolysis did not
exceed 20% of total phosphorylase a inallsamples.All

illustrated data represent the mean of at least two
independent experiments.
Preparation of liposomes
Phospholipids were solubilized in chloroform and after
evaporation of chloroform were resuspended in 50 m
M
Tris
pH 7.4, 0.1 m
M
EDTA, 0.1% 2-mercaptoethanol buffer by
sonication under argon. Sonication was carried out in an
ice-bath for 10 min with breaks (24 kHz) (BioMetra
Ultrasonicator). Before use, liposomes were kept for 2 h
on ice to allow association of lipids.
Determination of the influence of disulfides on yeast
and mammalian recombinant PP2Ac
Pph22p, PP2Ac and DN-Pph22p were incubated with
20 m
M
dithiothreitol overnight at 4 °C. Mixtures were
dialyzed extensively against buffer containing 50 m
M
Tris,
pH 7.4, 0.1 m
M
EDTA and 20% glycerol. Determination
of the influence of glutathione disulfide (GSSG) and
reduced glutathione (GSH) was carried out by mixing this
redox agent with the purified phosphatase and incubation at
30 °C for 30 min. The phosphatase assay was initialized by

adding
32
P-labelled phosphorylase a. The reaction buffer
contained 20 m
M
Tris, pH 7.4, 0.1 m
M
EDTA and 10%
glycerol.
Reactivation of PP2Ac and Pph22p activity
Reactivation was carried out as described previously [27]
with minor changes. PP2Ac, Pph22p and DN-Pph22p were
inactivated by incubation with 20 m
M
GSSG overnight at
4 °C. Mixtures were dialyzed extensively against buffer
contained 50 m
M
Tris, pH 7.4, 0.1 m
M
EDTA and 20%
glycerol.
Aliquots of the inactivated enzymes were mixed with
dithiothreitol or 2-mercaptoethanol at various concentra-
tions. Phosphatase activity in samples was determined after
a 10-min incubation at 30 °C by addition of
32
P-labelled
phosphorylase a. Reactions were carried out for 30 min
under standard conditions.

RESULTS AND DISCUSSION
Comparison of PP2A catalytic subunits
from
S. cerevisiae
and other species
S. cerevisiae protein phosphatases encoded by PPH21 and
PPH22 are homologues of mammalian PP2Ac. Pph21p
consists of 369 amino acids and Pph22p of 377 amino acids.
Both enzymes are hence larger than PP2Ac from mammals,
plants and S. pombe which are composed of 306–322 amino
acids. This difference in size results from the presence of an
acidic stretch of approximately 70 amino acids (pI 3.78 and
4.07 for Pph21p and Pph22p, respectively) at the N-termini
of Pph21/Pph22p (Fig. 1). The role of this N-terminal
extension present in budding yeast PP2Ac is currently
unknown. One may speculate that these regions are
responsible for targeting Pph21p and Pph22p to intracellu-
lar compartments or to specific substrates, or fulfil a special
regulatory function. Interestingly, the N-terminal regions of
Pph21p and Pph22p are quite divergent showing only
49.4% amino-acid sequence identity (the first N-terminal 42
amino acids of Pph22p display only 33.3% identity to the
corresponding region in Pph21p) whereas the overall
identity between enzymes equals 87%. This might indicate
that the N-termini of Pph21p and Pph22p may have distinct
functions. In order to determine whether the N-terminal
extension present in Pph22p influences its biochemical
properties we decided to overexpress this phosphatase and
its deletion mutant without 77 N-terminal amino acids in
P. pastoris, purify these enzymes to apparent homogeneity

and compare their enzymatic properties to those of human
PP2Ac.
Purification of
S. cerevisiae
Pph22p expressed
in
P. pastoris
We determined the growth curves of control GS115,
recombinant GS115-PPH22, and GS115-DN-PPH22
strains in minimal medium containing methanol (data not
shown). A lag period of approximately 100 h was observed
in the case of the GS115-PPH22 and GS-115-DN-PPH22
strains cultured starting from a D
600
of 0.05, but not in the
wild-type control. After this period the recombinant strains
resumed growth and eventually reached a D
600
similar to
that of the wild-type strain. Protein levels in both strains
were similar, but phosphatase activity in GS115-DN-PPH22
lysates was lower than in lysates of GS115-PPH22; it is
likely that more DN-Pph22p was in the insoluble state and
this might also explain why the yield of purification was
lower in case of DN-Pph22p. Cultures in the stationary
phase (high D
600
) showed less pronounced differences
between the strains, but even under these conditions the
strain overexpressing Pph22p grew somewhat slower.

Phosphorylase phosphatase activity was measured in cell-
free extracts of all strains and its dependence on growth
phase (reflected in D
600
value) was analysed. At stationary
phase (high D
600
), both Pph22p and DN-Pph22p proteins
were maximally overexpressed 24 h after methanol induc-
tion; amounts of active phosphatase decreased after this
Ó FEBS 2002 Characterization of protein phosphatase Pph22p (Eur. J. Biochem. 269) 3375
time, as confirmed also by Western blotting analysis (data
not shown).
The long lag period in the growth of the GS115-PPH22
strain observed after transferring the cells to methanol-
containing medium is similar to that described for the strain
overexpressing human PP2Ac [29] and might reflect effects
of higher phosphatase activity on yeast growth or on the cell
cycle.
Figure 2 illustrates the purification of Pph22p and
DN-Pph22p from P. pastoris cells using ammonium sulfate
fractionation, DEAE-Sephacel and Ni
2+
-nitrilotriacetic
acid agarose, as described in the Materials and methods
section. The final preparation, stained with Coomassie
Brilliant Blue, appeared to be homogeneous. Purity was
confirmed by gel filtration (data not shown). Pph22p and
DN-Pph22p proteins were purified with a yield of active
protein of 80 and 60 lgÆL

)1
of P. pastoris culture, respect-
ively, in intracellular overexpression.
The inclusion of Triton X-100 (0.01%) in the buffers used
for chromatography on Ni
2+
-nitrilotriacetic acid agarose
greatly enhanced recovery of active phosphatase from
this column. Similarly to mammalian PP2Ac, Pph22p and
DN-Pph22p migrated as a doublet of two proteins. Pph22p
migrated on SDS/PAGE with a molecular mass of
52–53 kDa, different from its calculated molecular mass
of 44 kDa. DN-Pph22p migrated on SDS/PAGE at its
theoretical molecular mass of 37 kDa. The specific activity
of the final Pph22p and DN-Pph22p appropriate prepara-
tions was 1.3 and 1.8 lmolÆmin
)1
Æmg protein
)1
using phos-
phorylase a as substrate. The specific activity of DN-Pph22p
is similar to the 1.7 lmolÆmin
)1
Æmg protein
)1
obtained for
recombinant human PP2Ac [29], but the value for Pph22p is
lower indicating an inhibitory effect of the N-terminus.
Characterization of purified Pph22p and DN-Pph22p
PP2Ac was initially described as a metal-ion-independent

protein phosphatase [32]. In agreement with this, none of
metal ions tested increased significantly the activity of
Pph22p, DN-Pph22p or PP2Ac (Table 1). In contrast,
several metal ions applied at a concentration of 1 m
M
(Co
2+
,Ni
2+
,Fe
2+
,Fe
3+
and Zn
2+
) inhibited Pph22p
and PP2Ac activities with phosphorylase a as a substrate. In
order to exclude the latter effects being substrate dependent
we confirmed the data from Table 1 using kemptide as
substrate (not shown). It remains to be determined whether
the inhibitory effect of these high concentrations of metal
ions reflect an interaction with SH groups exposed on the
enzyme surface or formation of complexes with amino-acid
Pph22_S.cerevisiae
Pph21_S.cerevisiae
ppa1_S.pombe
PP2Ac/beta_rabbit
PP2Ac/alfa_H.sapiens
ppa2_pombe
PP2Ac_2_A.thaliana

Pph3_S.cerevisiae
Pph22_S.cerevisiae
Pph21_S.cerevisiae
ppa1_S.pombe
PP2Ac/beta_rabbit
PP2Ac/alfa_H.sapiens
ppa2_pombe
PP2Ac_2_A.thaliana
Pph3_S.cerevisiae
Pph22_S.cerevisiae
Pph21_S.cerevisiae
ppa1_S.pombe
PP2Ac/beta_rabbit
PP2Ac/alfa_H.sapiens
ppa2_pombe
PP2Ac_2_A.thaliana
Pph3_S.cerevisiae
Fig. 1. Alignment of PP2A from S. cerevisiae and other organisms. Sequence alignment of PP2A catalytic subunits from S. cerevisae (Pph21p,
Pph22p, Pph3p), S. pombe (ppa1), rabbit, Homo sapiens and Arabidopsis thaliana. Conserved residues are coloured. The N-terminal extension is
only found in the S. cerevisiae PP2A isoforms. The region deleted in DN-Pph22p is framed.
Fig. 2. Purification of Pph22p and DN-Pph22p from overexpressing
P. pastoris cells. Aliquots of Pph22p and DN-Pph22p overexpressed in
P. pastoris and purified by using three steps of purification (protein
precipitation with ammonium sulfate, ion-exchange chromatography
on DEAE-Sephacel and affinity chromatography on Ni
2+
-nitrilotri-
acetatic acid agarose were taken and analysed by polyacrylamide
(10%) gel electrophoresis and staining with Coomassie Brilliant
Blue. St, molecular mass standard (kDa); lane 1, Pph22p; lane 2,

DN-Pph22p.
3376 P. Zabrocki et al. (Eur. J. Biochem. 269) Ó FEBS 2002
residues involved in catalysis. Some metal ions, e.g. Co
2+
and Ni
2+
, might interact with the N-terminal His-tag, but
this is unlikely to explain the effect on phosphatase activity,
because even (nonrecombinant) PP2A purified from rabbit
skeletal muscle is inhibited by  20–30% by these ions at a
concentration of 0.75 m
M
(data not shown).
Mammalian PP2Ac is inhibited by several naturally
occurring compounds in a way that allows this enzyme to be
distinguished from PP1 [33]. In contrast, more recently
discovered protein phosphatases such as PP4 and PP6,
which are present in mammalian cells in much smaller
quantities, are inhibited similarly to PP2A. Figure 3
presents inhibition of purified Pph22p by okadaic acid,
nodularin, cantharidin and endothall. The IC
50
values
calculated at 3 n
M
concentration of Pph22p were 0.2, 0.5,
130 and 210 n
M
, respectively, and were very similar to those
obtained for DN-Pph22p (data not shown). For PP2Ac

applied at a similar concentration (4 n
M
)IC
50
values were
very similar, 0.5, 0.6, 140 and 300 n
M
for okadaic acid,
nodularin, cantharidin and endothall, respectively. Thus,
both Pph22p and PP2Ac are similarly affected by a panel of
inhibitors reflecting the high degree of conservation of the
catalytic core between these two enzymes and ruling out the
involvement of the N-terminal extension in binding to these
inhibitors. As can be expected from the presence of a stretch
of acidic amino acids, the pH optimum of Pph22p (pH 7.5)
is slightly different from the pH optimum of PP2Ac (pH 7).
Unique properties of Pph22p
In vivo PP2Ac associates with the scaffolding PR65/A
subunit to form dimers, which can further associate into
trimers by association with a variable B subunit. Homo-
logues of the PR65/A subunit and of various B subunits are
present in yeast (reviewed in [23]). A classical biochemical
approach to distinguish between PP2Ac and the dimer
makes use of protamine. It has been described that this
compound inhibits the activity of the isolated catalytic
subunit, but stimulates activity of the dimer [34]. Unexpect-
edly, however, protamine (both in the absence and in the
presence of ammonium sulfate) stimulated the phosphatase
activity of purified Pph22p (Fig. 4A). At 66 lgÆmL
)1

,
protamine (and 16 m
M
ammonium sulfate) an 11-fold
activation of Pph22p was observed. Protamine, in the
presence of the same concentration of ammonium sulfate,
had little effect on human PP2Ac and on DN-Pph22p
(Fig. 4A). In contrast, 33 lgÆmL
)1
, protamine together with
16 m
M
ammonium sulfate stimulated the activity of the
PP2Ac-PR65/A dimer about 12-fold and that of the
DN-Pph22p-PR65/A dimer around fourfold (Fig. 4B).
Hence, with respect to protamine stimulation of phospha-
tase activity, the yeast catalytic subunit Pph22p behaved
similarly to the PP2Ac-PR65/A dimer, but mutant
DN-Pph22p behaved like PP2Ac. As can be seen in Fig. 4B,
addition of PR65/A subunit to Pph22p increased the
protamine activation a further 1.8-fold.
Fig. 3. Inhibition of Pph22p activity by okadaic acid, nodularin, can-
tharidin and endothall. Purified Pph22p applied at 3 n
M
was incubated
with the indicated concentration of inhibitor at 30 °Cfor10min
before the reaction was initiated with
32
P-labelled phosphorylase a as
substrate.

Table 1. The effects of metal ions on the activity of type 2A protein
phosphatases. Activities of purified human PP2Ac (PP2Ac, specific
activity 1.7 lmolÆmin
)1
Æmg protein
)1
) and purified S. cerevisiae
Pph22p (Pph22p, specific activity 1.3 lmolÆmin
)1
Æmg protein
)1
)were
measured against 10 l
M
32
P-labelled phosphorylase a. 100% activity
refers to activity measured in the absence of exogenous metal ions
added.
Metal
Relative activity (%)
ions (m
M
) PP2Aca Pph22p
Mn
2+
0.1 122 121
0.3 89 107
174 53
Co
2+

0.1 74 41
0.3 39 11
122 8
Fe
2+
0.1 110 103
0.3 106 54
174 7
Fe
3+
0.1 115 82
0.3 79 17
115 2
Ni
2+
0.1 69 88
0.3 35 13
118 4
Mg
2+
0.1 100 112
0.3 100 130
1 93 129
Ca
2+
0.1 110 106
0.3 77 91
166 76
Zn
2+

0.1 27 8
0.3 9 1
10 0
Cu
2+
0.1 110 106
0.3 77 91
166 76
Ó FEBS 2002 Characterization of protein phosphatase Pph22p (Eur. J. Biochem. 269) 3377
The observation that in the absence of protamine PP2Ac,
Pph22p and DN-Pph22p are inhibited by increasing the
PR65/A subunit concentration (Fig. 4C), indicates the effi-
cient formation of PP2Ac-PR65/A, DN-Pph22p-PR65/A
and Pph22p-PR65/A dimers. We have shown previously
[29] that protamine exerts its effect on PP2Ac activity via an
interaction with the PR65/A subunit, which interacts much
more strongly with protamine-agarose than PP2Ac itself.
Here we have confirmed these data, but we also showed
that, in agreement with the protamine stimulation of
Pph22p, this enzyme interacts strongly with protamine-
agarose (Fig. 4D). The strong interaction between Pph22p
catalytic subunit and protamine-agarose is reflected by the
resistance to elution with 1
M
NaCl. Denaturing conditions
(boiling of the gel in SDS sample buffer) are required to
dissociate Pph22p from the protamine-agarose column.
This interaction is mediated by the acidic N-terminal
extension, since the DN-Pph22p protein cannot interact
strongly with protamine-agarose and like PP2Ac is eluted

with 0.5
M
NaCl from the gel (Fig. 4D).
In order to determine the effect of other polycations on
phosphorylase phosphatase activity of yeast and mamma-
lian PP2Ac poly-
L
-lysine was added to the purified
enzymes. As presented in Fig. 5 a peak of poly-
L
-lysine-
stimulated phosphorylase phosphatase activity was
observed at 20 lg poly-
L
-lysine per mL for both enzymes,
but the extend of activation of Pph22p was much more
pronounced (4.5-fold activation of Pph22p activity vs.
2.5-fold activation of PP2Ac). PR65/A subunit (3 n
M
)
increased activation of PP2Ac by poly-
L
-lysine by
approximately 70% and it also increased stimulation of
Pph22p by poly-
L
-lysine another 50%. From Fig. 5 it is
clear that the activation (4.5-fold) of Pph22p by
20 lgÆmL
)1

poly-
L
-lysine is very similar to activation
Fig. 4. Pph22p responds to protamine in a similar way as the mammalian PP2Ac-PR65/A dimer. (A) Phosphatase activity of 0.5 n
M
Pph22p
(squares), 0.5 n
M
DN-Pph22p (triangles) and 0.5 n
M
PP2Ac (circles) was assayed using
32
P-labelled phosphorylase a as a substrate in the presence
of the indicated concentrations of protamine and in the absence (open symbols) or presence (closed symbols) of 16 m
M
ammonium sulfate (SA). (B)
Phosphatase activity of 0.5 n
M
Pph22p (squares), 0.5 n
M
DN-Pph22p (triangles) and 0.5 n
M
PP2Ac (circles) was assayed using
32
P-labelled
phosphorylase a as a substrate in the presence of the indicated concentrations of purified PR65a/A subunit and in the absence (open symbols) or
presence (closed symbols) of 33 lgÆmL
)1
protamine and 16 m
M

ammonium sulfate. (C) Phosphatase activity of the indicated concentrations of
Pph22p (squares), DN-Pph22p (triangles) and PP2Ac (circles) was assayed using
32
P-labelled phosphorylase a as a substrate in the absence (open
symbols) or presence (closed symbols) of 3 n
M
purified PR65a/A subunit. (D) Binding of PP2Ac, DN-Pph22p and Pph22p to protamine-agarose.
Immunodetection of Pph22p/DN-Pph22p/PP2Ac was carried out on a Western blot after separation of protein fractions on 10% SDS-poly-
acrylamide gel. Lanes 1 and 2, material loaded to the column; lane 3, flow-through; lanes 4, 5 and 6, material eluted with 50 m
M
,500m
M
and 1
M
NaCl, respectively; lane 7, material eluted with 1 · SDS/PAGE buffer.
3378 P. Zabrocki et al. (Eur. J. Biochem. 269) Ó FEBS 2002
(4.5-fold) of the human PP2Ac-PR65/A dimer by
20 lgÆmL
)1
poly-
L
-lysine and much stronger than that of
the free human catalytic subunit PP2Ac. Interestingly the
deletion mutant DN-Pph22p behaved more like PP2Ac.
DN-Pph22p is only around 70% activated by poly
L
-lysine
and even the DN-Pph22p/PR65a dimerislessstimulated
than Pph22p alone (Fig. 5). Again these data point to a
domain present in the yeast Pph22p N-terminus respon-

sible for mimicking the polycation-stimulation effects
exerted by the PR65/A subunit in mammalian PP2A.
Taken together we can conclude that activation of
Pph22p by polycations is mediated by its N-terminal region.
The role of this region in vivo is unknown, but it might
stabilize the structure of Pph22p, influence substrate specif-
icity or exert a regulatory function.
Effects of phospholipids on activity of Pph22p
Some studies showed that phospholipids can stimulate or
inhibit of PP2A and PP1 phosphatases [26] (reviewed in
[23,24]). In this study we also checked the influence of
several phospholipids (assembled in liposomes) on activity
of Pph22p and DN-Pph22p. Lipids were tested at a
Fig. 5. Effect of polylysine on the phosphatase activity of Pph22p,
DN-Pph22p, PP2Ac and the corresponding dimers. Phosphatase activity
of 0.5 n
M
Pph22p (squares), 0.5 n
M
DN-Pph22p (triangles) and 0.5 n
M
PP2Ac (circles) was assayed using
32
P-labelled phosphorylase a as a
substrate in the presence of the indicated concentrations of poly-
L
-lysine and in the absence (open symbols) or presence (closed
symbols) of 3 n
M
purified PR65a/A subunit.

Fig. 6. Influence phospholipids on Pph22p and DN-Pph22p activity. Phosphatase assays were carried out as described in Materials and Methods.
(A) Influence of egg yolk phosphatidic acid (PA) and synthetic dioleoylphosphatidic acid (DOPA) on Pph22p and DN-Pph22p phosphatase activity
(B) Influence of phosphatidylserine (PS) and (C) phosphatidylethanolamine (PE) on Pph22p and DN-Pph22p phosphatase activity (D) Effects
of dioleoylphosphatidylcholine (DOL) and phosphatidylcholine (L) on Pph22p and DN-Pph22p phosphatase activity. Phosphatases at a con-
centration of 2.3 n
M
were used to measure the effects of phospholipids on its activity. Lipids were solubilized in chloroform and after evaporation
of chloroform were resuspended in 50 m
M
Tris,pH7.4,0.1m
M
EDTA, 0.1 m
M
2-mercaptoethanol buffer and sonicated. Liposomes were added
to phosphatase and reactions were incubated on ice for 30 min and phosphatase activity in samples were determined (see Materials and
methods).
Ó FEBS 2002 Characterization of protein phosphatase Pph22p (Eur. J. Biochem. 269) 3379
calculated concentration of 4–400 l
M
and after 10 min
incubation on ice, a time where effects were maximal.
Phosphatidic acid from egg yolk (PA) stimulated Pph22p
activity, but it inhibited DN-Pph22p. Inhibition reached
70% for DN-Pph22p at 320 l
M
concentration with IC
50
around 80 l
M
of lipid (Fig. 6A). The same lipid stimulated

Pph22p around twofold at 8 l
M
or higher concentrations
(Fig. 6A).
Dioleoylphosphatidic acid (C18:1, [cis]-9) inhibited both
Pph22p and DN-Pph22p in a similar manner (IC
50
)40 l
M
concentration of phospholipid for DN-Pph22p and 30 l
M
of phospholipid for Pph22p) (Fig. 6A). Phosphatidylserine
and phosphatidylethanolamine both stimulated Pph22p
phosphatase around 2.5-fold to threefold, but only slightly
affected DN-Pph22p (Figs 6B,C). Dioleoylphosphatidyl-
choline (C18:1, [cis]-9) and phosphatidylcholine were not
selective, and stimulated both Pph22p and DN-Pph22p in a
similar way (Fig. 6D). These results indicate a specific
influence of the N-terminal extension of Pph22p on its
activity and on interactions with specific phospholipids and
possibly membranes.
Redox state of Pph22p
Some authors reported an influence of reducing and
oxidizing agents on PP2A and PP1 activity [27,28]. Oxid-
izing reagents like o-iodosobenzoate, dipiridyl disulfates or
glutathione disulfide can inactivate of PP2A and PP1
isolated from rabbit skeletal muscle [27]. Inactivation is
different between PP2A and PP1 and depends on the
oxidizing agent used [27]. We tested the influence of the
oxidizing agent GSSG on activity of Pph22p, DN-Pph22p

and recombinant human PP2Ac catalytic subunit as
control. Figure 7A illustrates the influence of various
concentrations of GSSG on PP2Ac, Pph22p and
DN-Pph22p phosphatases. All these enzymes are inactivated
in a similar way by GSSG, but interestingly only Pph22p
activity is also inhibited by GSH. GSH at 6 m
M
concen-
tration has no effect on recombinant human PP2Ac and in
low concentrations even slightly stimulates PP2Ac activity
(Fig. 7A) (data not shown).
We then checked the influence of reducing agents on the
activity of phosphatases. Dithiothreitol and 2-mercapto-
ethanol can reactivate PP1 and PP2A phosphatases from
rabbit skeletal muscle inactivated by GSSG [27]. We tested
whether both Pph22p and DN-Pph22p were reactivated by
dithiothreitol and 2-mercaptoethanol. As a control recom-
binant PP2Ac was used. Pph22p and DN-Pph22p were not
reactivated, even at 50 m
M
concentration dithiothreitol or
2-mercaptoethanol, while PP2Ac was reactivated by both
reducing agents to around 15% of its original activity
(Fig. 7B). This is in agreement with data reported previ-
ously [27], where authors have shown slight reactivation of
PP2A from rabbit skeletal muscle and very high levels of
reactivation of rabbit PP1. Pph22p cannot be reactivated
under our conditions by reducing agents, moreover
2-mercaptoethanol and in lesser extend dithiothreitol, even
decrease the activity of Pph22p, in contrast to PP2Ac,

which can be activated about twofold (data not shown).
Serine-threonine phosphatases, e.g. rabbit and human
PP1c and PP2Ac, probably have disulfide bonds connecting
their cysteine residues. PP2Ac and Pph22p have 10 and 9
cysteine residues, respectively. The different properties of
both enzymes can probably be explained by two residues,
Cys50 and Cys251, which are unique for PP2Ac, and
Cys143, which is unique for Pph22p. Because cysteine
residues can influence secondary structure, the structure of
both phosphatases might be slightly different. More likely,
in contrast to Pph22p, PP2Ac might be regulated by
reversible oxidation of cysteine residues; it is noteworthy
that PP2A from rabbit tissue was isolated in complex with
nucleoredoxin, an enzyme with high homology to thiore-
doxins (S. Zolnierowicz, N. Andjelkovic, C. Van Hoof,
J. Goris & B. A. Hemmings, unpublished data) (reviewed in
[24]). However, homologs of nucleoredoxin are not found in
the yeast genome.
CONCLUSION
Although Pph22p has been studied thoroughly using
genetic methods, no data are available regarding its
enzymatic properties. To fill this gap we overexpressed
Fig. 7. Determination of influence of redox agents on phosphatase
activity. (A) Effects of GSSG and GSH on activity of yeast and human
recombinant phosphatases. Phosphatases (PP2Ac, Pph22p and
DN-Pph22p) at a concentration of 2.5 n
M
wereaddedtotheindicated
concentrations of GSSG and GSH. Reactions were incubated at 30 °C
for 10 min and phosphatase activity was determined. (B) Reactivation

test of PP2Ac, DN-Pph22p and Pph22p phosphatases inactivated by
incubation with 20 m
M
GSSG. After inactivation phosphatases were
dialysed extensively and assayed for activity after 10 min incubation
with dithiothreitol or 2-mercaptoethanol in the indicated concentra-
tions. A 2.5-n
M
concentration of PP2Ac, Pph22p and DN-Pph22p was
used. On the graph, the solid squares precisely overlap the open
squares.
3380 P. Zabrocki et al. (Eur. J. Biochem. 269) Ó FEBS 2002
Pph22p in P. pastoris, purified this phosphatase to
apparent homogeneity, determined its enzymatic proper-
ties and compared them to those of mammalian PP2Ac.
This analysis shows that although both enzymes share a
number of characteristics (specific activity, sensitivity to
inhibitors, inhibition by high concentrations of metal
ions), they show a remarkably different response to
protamine, polylysine and reducing agents. Using purified
Pph22p lacking the N-terminus, we can attribute most of
these differences to the unique N-terminal extension
present in Pph22p. In contrast to PP2Ac and DN-Pph22p,
Pph22p strongly interacts with protamine resulting in
stimulation of enzymatic activity. The stimulation of
catalytic activity of Pph22p by protamine and polylysine
reflects the stimulation of the mammalian PP2Ac-PR65/A
dimeric form of the phosphatase. The N-terminus of
Pph22p also influences interactions of Pph22p with
specific phospholipids or membranes. Our data therefore

indicate a possible regulatory function for the acidic
N-terminus of Pph22p and demonstrate that yeast Pph22p
has unique enzymatic characteristics compared to other
PP2A phosphatases studied so far.
ACKNOWLEDGEMENTS
This work was supported by grants from NATO (LST.CLG 974983)
and the Ministry of the Flemish Community (BIL99/26), by a
postdoctoral fellowship from the Research Fund of the Katholieke
Universiteit Leuven to S. W., and by a grant BW# B000-5-0217-1 to
S. Z. The authors thank Prof. Michal Wozniak for helping with the
preparation of liposomes.
REFERENCES
1. Hunter, T. (2000) Signaling 2000 and beyond. Cell 100, 113–127.
2. Barford, D. (1996) Molecular mechanisms of the protein serine/
threonine phosphatases. Trends Biochem. Sci. 21, 407–412.
3. Cohen, P.T.W. (1997) Novel protein serine/threonine phospha-
tases: variety is the spice of life. Trends Biochem. Sci. 22, 245–251.
4. Denu, J.M., Stuckey, J.A., Saper, M.A. & Dixon, J.E. (1996) Form
and function in protein dephosphorylation. Cell 87, 361–364.
5. Wera, S. & Hemmings, B.A. (1995) Serine/threonine protein
phosphatases. Biochem. J. 311, 17–29.
6. Zolnierowicz, S. (2000) Type 2A protein phosphatase, the complex
regulator of numerous signaling pathways. Biochem. Pharmacol.
60, 1225–1235.
7. Millward, T.A., Zolnierowicz, S. & Hemmings, B.A. (1999) Reg-
ulation of protein kinase cascades by protein phosphatase 2A.
Trends Biochem. Sci. 24, 186–191.
8. Stark, M.J. (1996) Yeast protein serine/threonine phosphatases:
multiple roles and diverse regulation. Yeast 12, 1647–1675.
9. Costanzo, M.C., Hogan, J.D., Cusick, M.E., Davis, B.P., Fancher,

A.M., Hodges, P.E., Kondu, P., Lengieza, C., Lew-Smith, J.E.,
Lingner, C., Roberg-Perez, K.J., Tillberg, M., Brooks, J.E. &
Garrels, J.I. (2000) The yeast proteome database (YPD)
and Caenorhabditis elegans proteome database (WormPD):
comprehensive resources for the organization and comparison
of model organism protein information. Nucleic Acids Res. 28,
73–76.
10. Sneddon, A.A., Cohen, P.T.W. & Stark, M.J.R. (1990)
Saccharomyces cerevisiae protein phosphatase 2A performs an
essential cellular function and is encoded by two genes. EMBO J.
9, 4339–4346.
11. Evans, D.R.H. & Stark, M.J.R. (1997) Mutations in the
Saccharomyces cerevisiae type 2A protein phosphatase catalytic
subunit reveal roles in cell wall integrity, actin cytoskeleton orga-
nization and mitosis. Genetics 145, 227–241.
12. Di Como, C.J. & Arndt, K.T. (1996) Nutrients, via the Tor pro-
teins, stimulate the association of Tap42 with type 2A phospha-
tase. Genes Dev. 10, 1904–1916.
13. Lin, F.C. & Arndt, K.T. (1995) The role of Saccharomyces
cerevisiae type 2A phosphatase in the actin cytoskeleton and in
entry into mitosis. EMBO J. 14, 2745–2759.
14. Ronne, H., Carlsberg, M., Hu, G Z. & Nehlin, J.O. (1991)
Protein phosphatase 2A in Saccharomyces cerevisiae:effectson
cell growth and bud morphogenesis. Mol. Cell. Biol. 11,4876–
4884.
15. Healy, A.M., Zolnierowicz, S., Stapleton, A.E., Goebl, M.,
DePaoli-Roach, A.A. & Pringle, J.R. (1991) CDC55,aSacchar-
omyces cerevisiae gene involved in cellular morphogenesis: iden-
tification, characterization, and homology to the B subunit of
mammalian type 2A protein phosphatase. Mol. Cell. Biol. 11,

5767–5780.
16. van Zyl, W., Huang, W., Sneddon, A.A., Stark, M., Camier, S.,
Werner, M., Marck, C., Sentenac, A. & Broach, J.R. (1992)
Inactivation of the protein phosphatase 2A regulatory subunit A
results in morphological and transcriptional defects in Sacchar-
omyces cerevisiae. Mol. Cell. Biol. 12, 4946–4959.
17. Zhao, Y., Boguslawski, G., Zitomer, R.S. & DePaoli-Roach, A.A.
(1997) Saccharomyces cerevisiae homologs of mammalian B and
B¢ subunits of protein phosphatase 2A direct the enzyme to dis-
tinct cellular functions. J. Biol. Chem. 272, 8256–8262.
18. Ramotar, D., Belanger, E., Brodeur, I., Masson, J.Y. &
Drobetsky, E.A. (1998) A yeast homologue of the human phos-
photyrosyl phosphatase activator PTPA is implicated in protection
against oxidative DNA damage induced by the model carcinogen
4-nitroquinoline 1-oxide. J. Biol. Chem. 273, 21489–21496.
19. Van Hoof, C., Janssens, V., De Baere, I., de Winde, J.H.,
Winderickx, J., Dumortier, F., Thevelein, J.M., Merlevede, W. &
Goris, J. (2000) The Saccharomyces cerevisiae homologue of
protein phosphatase 2A controls progression through the G1
phase of the yeast cell cycle. J. Mol. Biol. 302, 103–120.
20. Favre, B., Zolnierowicz, S., Turowski, P. & Hemmings, B.A.
(1994) The catalytic subunit of protein phosphatase 2A is
carboxyl-methylated in vivo. J. Biol. Chem. 269, 16311–16317.
21. Bryant, J.C., Westphal, R.S. & Wadzinski, B.E. (1999) Methy-
lated C-terminal leucine residue of PP2A catalytic subunit is
important for binding of regulatory B subunit. Biochem. J. 339,
241–246.
22. Wei, H., Ashby, D.G., Moreno, C.S., Ogris, E., Yeong, F.M.,
Corbett, A.H. & Pallas, D.C. (2001) Carboxylmethylation of the
PP2A catalytic subunit in Saccharomyces cerevisiae is required for

efficient interaction with the B-type subunits Cdc55p and Rts1p.
J. Biol. Chem. 276, 1570–1577.
23. Zabrocki, P., Van Hoof, C., Goris, J., Thevelein, J.M., Windericx,
J. & Wera, S. (2002) Protein phosphatase 2A on track for nutrient-
induced signalling in yeast. Mol. Microbiol. 43, 835–842.
24. Janssens, V. & Goris, J. (2001) Protein phosphatase 2A: a highly
regulated family of serine/threonine phosphatases implicated in
cell growth and signalling. Biochem. J. 353, 417–439.
25. Guo, H. & Damuni, Z. (1993) Autophosphorylation – activated
protein kinase phosphorylates and inactivates protein phospha-
tase 2A. Proc. Natl Acad. Sci. USA 90, 2500–2504.
26. Kishikawa, K., Chalfant, C.E., Perry, D.K., Bielawska, A. &
Hannun, Y.A. (1999) Phosphatidic acid is a potent and selective
inhibitor of protein phosphatase 1 and an inhibitor of ceramide-
mediated responses. J. Biol. Chem. 274, 21335–21341.
27. Nemani, R. & Lee, E.Y.C. (1993) Reactivity of sulfhydryl groups
of the catalytic subunits of rabbit skeletal muscle protein phos-
phatase 1 and 2A. Arch. Biochem. Biophys. 300, 24–29.
28. Holmes, C.F.B. & Boland, M. (1993) Inhibitors of protein phos-
phatase-1 and -2A; two of the major serine/threonine protein
Ó FEBS 2002 Characterization of protein phosphatase Pph22p (Eur. J. Biochem. 269) 3381
phosphatases involved in cellular regulation. Curr. Opin. Struct.
Biol. 3, 934–943.
29. Swiatek, W., Sugajska, E., Lankiewicz, L., Hemmings, B.A. &
Zolnierowicz, S. (2000) Biochemical characterization of
recombinant subunits of type 2A protein phosphatase over-
expressed in Pichia pastoris. Eur. J. Biochem. 267, 5209–5216.
30. Hoffman, C.S. & Winston, F. (1987) A ten-minute DNA pre-
paration from yeast efficiently releases autonomous plasmids for
transformation of Escherichia coli. Gene 57, 267–272.

31. Zolnierowicz, S., Csortos, C., Bondor, J., Verin, A., Mumby,
M.C. & DePaoli-Roach, A.A. (1994) Diversity in the regulatory
B-subunits of protein phosphatase 2A: identification of a
novel isoform highly expressed in brain. Biochemistry 33, 11858–
11867.
32. Cohen, P. (1989) The structure and regulation of protein
phosphatases. Annu. Rev. Biochem. 58, 453–508.
33. Favre, B., Turowski, P. & Hemmings, B.A. (1997) Differential
inhibition and posttranslational modification of protein phos-
phatase 1 and 2A in MCF7 cells treated with calyculin-A, okadaic
acid, and tautomycin. J. Biol. Chem. 272, 13856–13863.
34. Turowski, P., Favre, B., Campbell, K.S., Lamb, N.J. & Hem-
mings, B.A. (1997) Modulation of the enzymatic properties of
protein phosphatase 2A catalytic subunit by the recombinant
65-kDa regulatory subunit PR65a. Eur. J. Biochem. 248, 200–208.
3382 P. Zabrocki et al. (Eur. J. Biochem. 269) Ó FEBS 2002