Báo cáo Y học: Two independent, light-sensing two-component systems in a filamentous cyanobacterium pot

Two independent, light-sensing two-component systems
in a filamentous cyanobacterium
Helena J. M. M. Jorissen
1
, Benjamin Quest
2
, Anja Remberg
1
,The
´
re
`
se Coursin
3
, Silvia E. Braslavsky
1
,
Kurt Schaffner
1
, Nicole Tandeau de Marsac
3
and Wolfgang Ga¨rtner
1,2
1
Max-Planck-Institut fu
¨
r Strahlenchemie, Mu
¨
lheim an der Ruhr, Germany;
2
Max-Planck-Institut fu

¨
r Biochemie, Martinsried,
Germany;
3
Unite
´
des Cyanobacte
´
ries, De
´
partement de Microbiologie Fondamentale et Me
´
dicale, Institut Pasteur (URA-CNRS 2172),
Paris, France
Two ORFs, cphA and cphB, encoding proteins CphA and
CphB with strong similarities to plant phytochromes and to
the cyanobacterial phytochrome Cph1 of Synechocystis sp.
PCC 6803 have been identified in the filamentous cyano-
bacterium Calothrix sp. PCC7601. While CphA carries a
cysteine within a highly conserved amino-acid sequence
motif, to which the chromophore phytochromobilin is co-
valently bound in plant phytochromes, in CphB this position
is changed into a leucine. Both ORFs are followed by rcpA
and rcpB genes encoding response regulator proteins similar
to those known from the bacterial two-component signal
transduction. In Calothrix, all four genes are expressed under
white light irradiation conditions, albeit in low amounts. For
heterologous expression and convenient purification, the
cloned genes were furnished with His-tag encoding
sequences at their 3¢ end and expressed in Escherichia coli.

The two recombinant apoproteins CphA and CphB bound
the chromophore phycocyanobilin (PCB) in a covalent and a
noncovalent manner, respectively, and underwent photo-
chromic absorption changes reminiscent of the P
r
and P
fr
forms (red and far-red absorbing forms, respectively) of the
plant phytochromes and Cph1. A red shift in the absorption
maxima of the CphB/PCB complex (k
max
¼ 685 and
735 nm for P
r
and P
fr
, respectively) is indicative for a
noncovalent incorporation of the chromophore (k
max
of P
r
,
P
fr
of CphA: 663, 700 nm). A CphB mutant generated at the
chromophore-binding position (Leu246 fi Cys) bound the
chromophore covalently and showed absorption spectra
very similar to its paralog CphA, indicating the noncovalent
binding to be the only cause for the unexpected absorption
properties of CphB. The kinetics of the light-induced P

fr
formation of the CphA–PCB chromoprotein, though sim-
ilar to that of its ortholog from Synechocystis, showed dif-
ferences in the kinetics of the P
fr
formation. The kinetics were
not influenced by ATP (probing for autophosphorylation)
or by the response regulator. In contrast, the light-induced
kinetics of the CphB–PCB complex was markedly different,
clearly due to the noncovalently bound chromophore.
Keywords: Calothrix sp. strain PCC 7601; flash photolysis;
heterologous expression; phytochrome-like apoproteins
CphA and CphB; response regulators RcpA and RcpB.
A precise qualitative and quantitative measurement of the
surrounding light is essential to photosynthetic organisms in
order to either adapt to the environmental light conditions
or, in the case of motility, to proceed towards a favorable
habitat. Higher plants have developed the phytochromes, a
chromoprotein family, which absorb light in the long-
wavelength region and regulate numerous photomorpho-
genetic processes [1–3]. In cyanobacteria, the presence and
molecular structure of comparable sensory system(s) have
long been debated. It has been suggested that the photo-
synthetic apparatus itself or blue-light- and/or other non-
characterized light-absorbing photoreceptors might fulfil
these functions [4–7].
The complete sequencing of the genome of the cyano-
bacterium Synechocystis sp. [8] has afforded some clues on
the components putatively involved in light sensing. Probing
this genome with phytochrome consensus sequences has

yieldedanORF(slr0473) encoding a protein of  85 kDa
(Cph1) that exhibits in its N-terminal part strong homol-
ogies to the phytochromes of higher plants [9]. Besides this
particular ORF, also others with lower similarities to
phytochromes have been identified in Synechocystis sp. [10]
and in Fremyella diplosiphon (rcaE) [11], a mutant of
Calothrix sp. [12], as well as in other phototrophic and
heterotrophic prokaryotes [13–15].
Correspondence to W. Ga
¨
rtner, Max-Planck-Institut fu
¨
r
Strahlenchemie, Postfach 10 13 65, D-45413 Mu
¨
lheim an der Ruhr,
Germany.
Fax: + 49 208 306 39 51, Tel.: + 49 208 3 06 36 93,
E-mail: or N. Tandeau de Marsac,
Unite
´
des Cyanobacteries, De
´
partement de Microbiologie
Fondamentale et Medicale, Institut Pasteur (URA-CNRS 2172), 28
rue du Docteur Roux, F-75724 Paris Cedex 15, France.
Fax: + 33 1 40613042, Tel.: + 33 1456 88415,
E-mail:
Abbreviations: Anabaena sp., Anabaena/Nostoc sp. strain PCC 7120;
Calothrix sp., Calothrix sp. strain PCC 7601; CphA and CphB,

recombinant phytochrome-like apoproteins of Calothrix sp.;
CphA-PCB and CphB/PCB, chromoproteins obtained by covalent
binding of CphA to PCB and by noncovalent complexing of CphB to
PCB, respectively; PCB, phycocyanobilin; P
r
and P
fr
,redandfar-red
absorbing forms of phytochrome, respectively; Synechocystis sp.,
Synechocystis sp. strain PCC 6803.
Note: The sequences reported in this paper have been deposited in the
GenBank database (accession nos. AF309559 for cphA-rcpA,
AF309560 for cphB-rcpB.
(Received 12 November 2001, revised 20 March 2002,
accepted 12 April 2002)
Eur. J. Biochem. 269, 2662–2671 (2002) Ó FEBS 2002 doi:10.1046/j.1432-1033.2002.02928.x
The strong similarity of slr0473 to the genes of the plant
phytochromes is also evident when the amino-acid sequences
and properties of the corresponding recombinant proteins
are compared. The cyanobacterial apoprotein (Cph1) binds
to both the chromophores of the plant phytochromes,
phytochromobilin, and to the closely related phycocyanobi-
lin (PCB). Moreover, the assembled chromoproteins can be
cycled between P
r
and P
fr
forms in a way reminiscent of the
plant phytochromes [k
max

668 nm (P
r
) and 717 nm (P
fr
)with
phytochromobilin as a chromophore, and 654 nm (P
r
)and
706 nm (P
fr
) with PCB] [16–18]. This discovery of a new
group of light-sensing signal transduction proteins has also
raised new questions on their function as putative photo-
receptors. In particular, as in the case of the gene product of
rcaE of Fremyella diplosiphon, the covalent binding of a
chromophore by the recombinant protein is still question-
able. Therefore, functional assays [18] were performed which
revealed signal transduction in Synechocystis sp. once the
photoreceptor is activated by absorption of a photon. While
the N-terminal part of the phytochrome-like protein of
Synechocystis sp. incorporates the chromophore, its
C-terminal part exhibits sequence motifs with a strong
similarity to the well-characterized two-component system
of other bacteria [19,20]. As found in the bacterial system,
this process of signal transduction functions via auto-
phosphorylation of a conserved histidinyl residue in the
receptor molecule (Cph1) and transphosphorylation to an
aspartate of a response regulator (Rcp1). The target amino
acids for both reactions, the autophosphorylation and
the phosphate transfer could be identified in vitro for

the recombinant Synechocystis proteins by site-directed
mutagenesis [18].
Extensive search for DNA sequences similar to those
found in Synechocystis sp. has revealed further members of
this protein family in a number of other cyanobacteria and
eubacteria [14,21]. Some of these proteins even lack the
covalent-binding forming cysteine, but nevertheless undergo
light-induced signal transduction via a Schiff base bonded
biliverdin chromophore (covalent bond to a histidine
residue) [14]. The widespread presence of this signal
transduction principle is further supported by the finding
that the ORFs of all these receptors are accompanied by a
coding sequence for a response regulator protein capable of
transferring the biological signal into the cell interior.
Here, we describe the biochemical and spectral charac-
terization of two independently functioning, light-sensing
receptor proteins and their cognate corresponding response
regulators as new members of the two-component signal
transduction protein family from the filamentous cyano-
bacterium Calothrix sp. PCC 7601.
MATERIALS AND METHODS
Strain and growth conditions
TheaxenicstrainCalothrix sp. strain PCC 7601 (this strain
has also been named Fremyella diplosiphon UTEX 481 and
Tolypothrix sp., however, in order not to cause confusion we
wish to remain with Calothrix sp. PCC 7601 [22]) was grown
at 30 °C in liquid BG-11 medium containing 0.4 m
M
Na
2

CO
3
and supplemented with 10 m
M
NaHCO
3
.The
culture was stirred with a magnetic bar under a continuous
stream of air/CO
2
(99 : 1, v/v). White light of fluorescent
tubes (Universal White) provided a photosynthetic photon
flux density of 50 lmol photonsÆm
)2
Æs
)1
(measured with
a LICOR LI-185B quantum/radiometer/photometer
equipped with a LI-190SB quantum sensor).
The purity of the cultures was checked on plates of
medium BG-11 [22], supplemented with glucose and
casamino acids (0.2% and 0.02% w/v, respectively) and
solidified with Difco Bacto agar (1% w/v).
Plasmids were maintained in the E. coli strain DH5a F¢.
Recombinant E. coli strains were grown at 37 °Cina
Luria–Bertani medium supplemented with 100 lgÆmL
)1
ampicillin.
Cloning of phytochrome- and response
regulator-encoding DNAs

Calothrix sp. genomic DNA was extracted from a culture
growntoanD
750
value of 0.8, using the Nucleobond for the
isolation of genomic DNA of bacteria (Macherey–Nagel).
Total genomic DNA digested with NheIorHindIII gave
strong hybridization signals (5.5 and 6 kb, respectively) with
the PCR products [21] corresponding to a portion of the
cphA and cphB genes, respectively. Two partial libraries
were constructed by ligating NheIandHindIII DNA
fragments of  6 kb into the dephosphorylated pBluescript
SK
–
vector digested with XbaIandHindIII, respectively, as
described previously [23]. Ligated DNA was transformed by
electroporation (Bio-Rad, GENE PULSER) into the E. coli
strain DH5a F¢ [24]. The clones carrying the proper inserts
were selected by colony hybridization with either the cphA
or cphB PCR products as probes. The recombinant plasmid
DNAs were purified with the QIA filters (Qiagen kit 12262)
according to manufactors’ instructions, and they were
sequenced ( 3200 nucleotides) on both strands (Genome
Express, Paris, France).
The full-length DNAs encoding the cyanobacterial
phytochrome-like proteins and their respective response
regulators were synthesized with an octadecamer oligonu-
cleotide at their 3¢ end encoding for six histidine residues and
with restriction sites for cloning into the E. coli vector
pMEX8 (Medac). For cphB and rcpA the putative trans-
lation start codons TTG and GTG, respectively, were

replaced by ATG. The cphA gene was cloned between the
NcoIandSalI sites of the vector. The cphB, rcpA and rcpB
genes were cloned between the EcoRI and SalIsitesofthe
vector. The following primers (5¢ to 3¢) were used (restriction
sites and sequences coding for a His6 tag are underlined,
start and stop codons are given in bold, and gene-specific
sequences in italics): cphA:forward,GCGATA
CCATGG
TATCCGAATTCCAAG and reverse, ACCCGG
GTCG
ACTCAGTGATGGTGGTGATGGTGTCCTCGACC
AAAAAGATC; rcpA:forward,GCGATA
GAATTCATG
AGCGTAGAAACGGAAGAC and reverse, CGAAGCTT
GTCGACTCAGTGATGGTGGTGATGGTGCTCCG
ACGGCAATGTCG; cphB:forward,GCGATA
GAATTC
ATG ACGAATTGCGATCGCGA and reverse, ACCCGG
GTCGACTCAGTGATGGTGGTGATGGTGTTTGAC
CTCCTGCAATGT; cphBlong:forward,GCGATA
GAA
TTCATGTTGCAGTTAATTTATAACAATT; the reverse
primer was identical to that used for cphB; rcpB:forward,
GAGGCT
GAATTCATGGTAGGAAACGCTACTCAAC;
reverse, CGAAGCTT
GTCGACTCAGTGATGGTGGT
GATGGTGACCCATCTCAGGAAGTACAAC.
Ó FEBS 2002 Light sensing two component systems in Calothrix (Eur. J. Biochem. 269) 2663
Total RNA extraction, cDNA synthesis

and specific mRNA detection
Total RNA from white light-grown cells from Calothrix
PCC 7601 was extracted as described previously [25] with
the following modifications: cells were resuspended in BG11
medium to a D
750
of 50 and disrupted in a Mickle
desintegrator six times for 1 min at 4 °C. The ethanol-
precipitated total RNA pellets were taken up in 50 lLof
sterile water containing 0.1% (v/v) DEPC and directly
treated with DNAse I ribonuclease-free as follows. A
sample of total RNA (300 lg) was resuspended in a buffer
containing 50 m
M
Tris/HCl pH 7.5, 10 m
M
MgCl
2
,0.1 m
M
dithiothreitol and treated twice with 200 U of DNase I
ribonuclease-free (Boehringer Mannheim) for 45 min at
37 °C. After two phenol/chloroform treatments, total RNA
was ethanol-precipitated for 12 h at 20 °C and resuspended
in 50 lL of DEPC-treated water. As a control for RNA
purity, a DNase I-treated sample (1 lg) of total RNA was
amplified by PCR with the primers used for further cDNA
detection. No amplification product was obtained confirm-
ing the absence of DNA in the RNA preparations.
A pool of total cDNAs was synthesized using random

primers with the SuperScript
TM
First-Strand Synthesis
System for reverse transcriptase PCR amplifications (Gibco
BRL) as recommended by the manufacturer. A second set
of specific cDNAs was synthesized using the following
primers specific of the cphA, rcpA, cphB and rcpB genes:
cphA primer: 5¢-GGTAGCACCTTCGCCCAGTTGTGA
CTC-3¢; rcpA primer: 5¢-GCTGGCTCAGGTTGCGAGA
TTTGGTG-3¢; cphB primer: 5¢-CGCGATGGTTAGCCC
TGCACCCG-3¢; rcpB primer: 5¢-GTCTGAACCGTCTC
GGTGAGACG-3¢.
Total RNA (5 lg) was incubated with 120 pmoles of
each of the primers specific of the cphA, rcpA, cphB and
rcpB genes in 12 lL of DEPC-treated water for 10 min at
70 °C. Samples were cooled down on ice and incubated with
the SuperScript
TM
First-Strand buffer (Gibco BRL) con-
taining 10 m
M
dithiothreitol and 0.5 m
M
dNTP for 2 min at
42 °C. After addition of 200 U of SuperScript II RNase H
–
reverse transcriptase and incubation for 50 min at 42 °C,
followed by 15 min at 70 °C, 2 lL of cDNA containing
samples were used for PCR amplifications in the presence of
5U of rTaq polymerase (Amersham Pharmacia) and

different combinations of the following forward and reverse
primers (170 pmol of each): cphA gene: primer 1, 5¢-GGTA
GAGTGATATTTACAG-3¢ (forward); primer 2, 5¢-CGCT
TCATTGGGATTACC-3¢ (reverse); cphB gene: primer 3,
5¢-CCCTATGAAATCCGTAGCG-3¢ (forward); primer 4,
5¢-GGTAGAGATTGTCGCTGCAC-3¢ (reverse); primer
5, 5¢-CAAACAGCCGCGCCTGTAGC-3¢ (reverse); rcpA
gene:primer6,5¢-GCTGATATCCGCTTAATCC-3¢ (for-
ward); primer 7, 5¢-GACGTGTAAGTCGTAGCTATG-3¢
(reverse); rcpB gene: primer 8, 5¢-GGAAACGCTACTCAA
CCGTTGC-3¢ (forward); primer 9, 5¢-TCCCGCCCATCA
GTTCCTGG-3¢ (reverse).
The program for PCR (Robocycler gradient 40, Strata-
gene) was one cycle for 5 min at 95 °C, 1 min at 55 °Cand
30 s at 72 °C, 40 cycles at the same temperatures for 1 min,
1 min 30 s and 1 min, respectively, and one cycle for 1 min,
1 min and 5 min, respectively. The PCR products were
analyzed by electrophoresis (1.2% (w/v) agarose gels, Tris/
borate buffer) [23].
Generation of the Leu246 fi Cys mutant of CphB
A point mutation was introduced into cphB, converting the
leucine-encoding codon into TGT, encoding for cysteine,
thus principally allowing covalent chromophore binding.
Forward primer: 5¢-CACTCGGTACTCCGCAGCGTTT
CGCCGTGTCACATTGAATATTTGCACAATATGG
-3¢; reverse primer: 5¢-CCATATTGTGCAAATATTCAA
TGTGACACGGCGAAACGCTGCGGAGTACCGAG
TG-3¢. Sequences different from the wild-type CphB
sequence are given in bold.
Expression of (apo)proteins, chromoprotein assembly

and affinity purification
This followed recently published procedures [26]. In brief,
the E. coli strain C600 was used as a host (for expression of
CphB L246C mutant, E. coli BL21DE3RIL from Strata-
gene was used), and was grown at 37 °C in Luria–Bertani
medium [23] containing penicillin (150 lgÆmL
)1
)to
D
600
¼ 1.8. BL21DE3RIL cells were induced with IPTG
following the instructions of the manufacturer. Cells were
harvested by centrifugation (2200 g,10min,4°C) and
opened at liquid nitrogen temperature by treatment with an
Ultraturrax (Jahnke & Kunkel T25, 10 000 r.p.m.). The
cellular debris was pelleted by centrifugation (39 000 g,
30 min, 4 °C). The supernatant was cleared by ultracentrif-
ugation (200 000 g,45min,4°C). After readjusting the pH
to 8.0, the cleared crude extract was incubated with PCB.
The amount of assembled chromoprotein was determined
from the difference spectrum (P
r
) P
fr
), based on the P
r
absorption coefficient of the recombinant phytochrome-like
protein of Synechocystis sp. (e
max
85 000

M
)1
Æcm
)1
at
656 nm [27]). Purification of the assembled chromoproteins
was accomplished by affinity chromatography on a Talon
metal affinity resin (Clontech). The analysis of protein
content and purity was performed by polyacrylamide gel
electrophoresis and Western blotting (PHAST system,
Pharmacia) employing an anti Penta-His antibody from
Qiagen.
Assembly kinetics, determination of absorption maxima/
difference spectra, P
fr
stability, and P
r
-to-P
fr
kinetics
For the determination of the assembly kinetics, the
apoproteins were purified as described for the assembled
chromoproteins and were incubated in the dark with a
10-fold excess of PCB. The assembly kinetics was followed
at 10 °C and at room temperature. In addition to normal
buffer, deuterated buffers were also used for these meas-
urements. For CphA–PCB, the absorption rise at 663 (k
max
of P
r

) and 700 nm was recorded. For the CphB/PCB
complex, spectra were run from 600 to 750 nm, and the
absorption rise at 685 nm (k
max
of P
r
) was determined. The
fully assembled chromoproteins were subjected to repetitive
red and far-red irradiations [interference filter at
658 ± 7 nm and cut-off filter > 715 nm, Schott] for P
fr
and P
r
formation, respectively. Absorption spectra were
recorded with a Shimadzu spectrophotometer UV-2102/
2402PC. For the determination of the thermal stability of
the P
fr
form, the samples were irradiated at 658 nm until
a maximum of P
fr
was formed. Subsequently, the
spectral changes of the sample during the storage at room
2664 H. J. M. M. Jorissen et al. (Eur. J. Biochem. 269) Ó FEBS 2002
temperature in the dark were recorded by measuring spectra
(500–800 nm) at various time intervals.
The laser flash-induced P
r
-to-P
fr

formation was followed
in the time range from  1 ls to 5 s essentially as described
previously [28]. In some experiments, ATP was added to a
final concentration of 1.5 m
M
. When the response regulator
was added during the measurements, it was used in about
eight-fold molar excess over the amount of phytochrome.
Recorded data were averaged and treated by a global fit
analysis as described previously [28].
RESULTS
Two ORFs of the cyanobacterium Calothrix sp., cphA (2304
nucleotides, GenBank accession number AF309559) and
cphB (2298 nucleotides, AF309560), initially cloned in part
by using the same PCR primer sets [21], have now been fully
characterized. Both ORFs encode proteins with strong
sequence similarities to plant phytochromes and to Cph1 of
Synechocystis sp., the first phytochrome protein identified in
cyanobacteria. However, despite a particularly high
sequence degree of similarity in the chromophore region
for both the CphA and CphB proteins of Calothrix sp.
(Fig. 1), in the latter protein the chromophore-binding
cysteine is replaced by a leucyl residue (position 246; Fig. 1).
A comparison of their complete amino-acid sequences with
those of the cyanobacterial phytochromes available to date
(Table 1, see also gene sequences deposited at GenBank)
confirms the membership of the new Calothrix proteins to
this protein family, the highest score being found between
Calothrix sp. CphA and Anabaena sp. AphA (GenBank
accession no. AB028873).

The translation starting point of cphA is identified by the
putative Shine–Dalgarno sequence, GAGGA at nucleotide
positions 33–37 (Fig. 2), and the ATG at position 46
indicating the first amino-acid residue. For the cphB gene,
there are two possible translation initiation sites. The first
one is at position 28 (TTG, coding for leucine and preceded
by a stop codon) with a putative Shine–Dalgarno sequence
AAGG at positions 18–21. Another one is located at
position 118 (TTG) with a putative Shine–Dalgarno
sequence GAGG at positions 109–112. In both cases, a
leucine is encoded as the first amino acid, which for
heterologous expression was replaced by methionine
(ATG).
In addition to the high sequence similarity to the
phytochromes in the N-terminal half, a motif (ASHDL)
reminiscent of the histidine kinases of the two-component
signal transduction were found in the C-terminal parts of
CphA and CphB with the histidinyl residues prone to
autophosphorylation (positions 538, CphA, and 526, CphB).
The response regulator-encoding genes rcpA and rcpB
(447 and 450 nucleotides, respectively, corresponding to 148
and 149 amino acids) were found downstream from cphA
and cphB, respectively (Fig. 2). The sequence of rcpA over-
laps by more than 50 nucleotides with that of cphA,
assuming an operon-like arrangement. In the case of cphB
and rcpB, the stop codon of the receptor gene and the ATG
of the response regulator gene are separated by four
nucleotides. A comparison of the deduced amino-acid
sequences of response regulators reveals a high degree of
conservation: RcpA is 66% identical with its Synechocystis

sp. ortholog and 39% with its Calothrix paralog. All motifs
common to the two-component response regulators, in
particular those involved in the phosphate transfer from the
receptor, are conserved and can readily be identified
(Fig. 3).
Fig. 1. Sequence alignment of the chromo-
phore-binding domain of phytochrome-like
proteins of cyanobacteria (Calothrix sp. CphA
and -B, Synechocystis sp. Cph1, and Anabaena
sp. AphA and AphB, GenBank numbers
AB028873 and AB034952), Arabidopsis thali-
ana (At phyA and -C) and Solanum tuberosum
(St phyA and -B). Grey boxes: amino acids
identicalinnomorethaneightofthenine
sequences. The position of covalent chromo-
phore attachment (in case a cysteinyl residue is
present) is indicated by an asterisk.
Table 1. Percentage of sequence identity of prokaryotic phytochrome-
like apoproteins.
7601CphB 6803Cph1 7120AphA 7120AphB
a
7601CphA
b
43 58 81 45
7601CphB
b
–424563
6803Cph1
c
––5942

7120AphA
d
–––46
Phytochrome-like apoproteins of:
a
Anabaena sp. (Genebank
accession no. AB028873),
b
Calothrix sp.,
c
Synechocystis sp. [8].,
and
d
Anabaena sp. (GenBank accession no. AB034952).
Ó FEBS 2002 Light sensing two component systems in Calothrix (Eur. J. Biochem. 269) 2665
A transcription analysis indicated that both the receptor-
and the response regulator-encoding ORFs are expressed,
albeit in low yields as the transcripts could not be detected
by Northern hybridizations but only by PCR amplification
of either pools of total cDNAs or of cDNAs specific of the
cphA, rcpA, cphB and rcpB genes. In each case, the size of
PCR products obtained were as expected from the combi-
nation of the primers used for the amplification (Fig. 4).
Moreover, a PCR product was obtained when the specific
primers 1 and 2 were used to amplify cphA from the cDNA
synthesized with the rcpA primer (Fig. 4). This demonstra-
ted that cphA and rcpA form an operon. In contrast, no
PCR product was obtained when the specific primers 3 and
4 were used to amplify cphB from the cDNA synthesized
with the rcpB primer, suggesting that cphB and rcpB are

transcribed independently.
Both receptor-encoding ORFs were furnished at their 3¢
end with a His6-encoding octadecanucleotide tail and were
cloned into the E. coli vector pMEX8 for heterologous
expression. For cphB, two different starting sites were used
(Fig. 2). While the expression of cphA was sufficiently high
(based on Western blot analysis, and also estimated from
incubation experiments with linear tetrapyrrole chromo-
phores, see above), the yield of the gene product of cphB was
considerably lower, irrespective of which of the two cphB
constructs was expressed, and a large amount of the protein
was found in inclusion bodies.
Fig. 3. Sequence alignment of the cyanobacte-
rial response regulators 7601RcpA and -B (of
Calothrix sp.), and 6803Rcp1 (of Synechocystis
sp.). Grey boxes: amino acids identical in two
out of the three sequences. The phosphate-
accepting aspartate (Asp69 in RcpA) is indi-
cated by an asterisk, and the other amino acids
generating the binding site (Glu13, Asp14,
Thr99, Lys121) are marked by a diamond.
Fig. 4. Expression of the cphA, rcpA, c phB and rcpB genes in Calothrix
PCC 7601 cells grown under 50 lmol photonsÆm
)2
Æs
)1
of white light.
PCR products of the cDNA specific of cphA amplified with primers 1
and 2 specific of cphA (450 bp, line 1), of the cDNA specific of cphB
with primers 3 and 5 specific of cphB (200 bp, line 4), of the cDNA

specific of rcpA amplified with primers 1 and 2 specific of rcpA (450 bp,
line 2), of the cDNA specific of rcpB amplified with primers 3 and 4
specific of rcpB (no detectable product, line 5), and of the cDNA pool
with primers 6 and 7 specific of rcpA (290 bp, line 3) or primers 8 and 9
specific of rcpB (230 bp, line 6).
Fig. 2. Genomic arrangement of phytochrome and response regulator
ORFs of Calothrix sp. showing the start and stop regions of the genes.
Putative Shine–Dalgarno sequences and start positions of the coding
regions are underlined. For cphB both putative starting sequences are
indicated. In all cases, the nucleotides encoding leucine/valine at
position one of the protein were changed for heterologous expression
into methionine (ATG codons).
2666 H. J. M. M. Jorissen et al. (Eur. J. Biochem. 269) Ó FEBS 2002
CphA
Incubation of the crude mixture of the recombinant CphA
protein obtained from the lysis of the E. coli cells with PCB
led to the appearance of an absorption band with
k
max
¼ 663 nm (Fig. 5). This assembly process was very
rapid and primarily afforded an intermediate with a red-
shifted absorption maximum at around 700 nm. On the
time scale of the observation, more than 50% of this
intermediate formed within less than 1 min (at 10 °C),
indicating an unresolved, much more rapid primary reac-
tion. The 700-nm intermediate then converted into the
660-nm P
r
-like band. The decay of the 700-nm species and
the formation of the 660-nm species remained nearly

unchanged when performed in deuterated buffer. The decay
of the primary 700-nm species showed, however, a strong
temperature dependence (Fig. 5). In order to investigate
possible effects of protonation changes on the absorption
maximum, the pH stability of the CphA-PCB chromopro-
tein in its P
r
form was determined. The holoprotein proved
stable in the broad range of pH 6–10 without showing
strong shifts of the absorption maximum, and started to
denature irreversibly beyond these pH values.
This novel cyanobacterial phytochrome exhibits spectral
features similar to those of the plant phytochromes, i.e.
irradiation with red light caused formation of a red-shifted
absorption band (k
max
710 nm), close to the P
fr
absorption
of Synechocystis sp. phytochrome [9]. This photochemical
behavior was fully reversible and reproducible. Monitoring
of the thermal stability of the P
fr
form of CphA in the dark
revealed practically no spectral change within 10 days.
The light-induced P
r
-to-P
fr
conversion of CphA was

followed by laser flash photolysis (Fig. 6 and Table 2; it
should be kept in mind that the data presentation shows
decay processes with positive amplitudes, whereas the
formation of an absorbance is presented with a negative
amplitude). In the time window of up to 1 ms two kinetic
processes were identified. The immediate absorbance
increase (k
max
680 nm), which is not time-resolved, but
appears instantaneous on this time scale, decays with a
lifetime of 22 ls, and a new absorbance appears at k
max
700 nm with a lifetime of 1.0 ms, this one being the major
P
fr
-forming process. The subsequent reaction with a lifetime
of 9.4 ms shows the absorbance decrease in the range of the
P
r
form (670 nm), and a concomitant absorbance rise at
around 720 nm. Slower processes of very low intensity and
Fig. 6. Lifetime-associated difference spectra of the CphA–PCB chro-
moprotein. Flash photolysis was performed at 10 °C. Note that pos-
itive amplitudes in the difference spectra refer to an absorbance decay
related to the process observed, and negative amplitudes indicate an
absorbance rise. The solid curve without symbols shows the residual
absorbanceattheendoftheobservationtime,i.e.theP
r
) P
fr

differ-
ence spectrum.
Fig. 5. Assembly kinetics of CphA + PCB at various temperatures and
buffer conditions and absorption (difference, P
r
–P
fr
) spectra of the
CphA-PCB chromoprotein at ambient temperature. Top: filled squares
are H
2
O, ambient temperature; open squares are D
2
O, ambient tem-
perature; triangles are D
2
O, 10 °C.
Table 2. Lifetimes for the light-induced P
r
-to-P
fr
conversion of CphA-
PCB. The values in column one are those from Fig. 6. Lifetimes were
determined by global analysis. The concentration of ATP was 1.5 m
M
,
and the molar ratio [CphA-PCB]:[RcpA]  1:8.
CphA-PCB
CphA-PCB +
ATP

CphA-PCB +
RcpA
CphA-PCB +
ATP + RcpA
22 ls21ls25ls25ls
1.0 ms 0.86 ms 1.2 ms 1.2 ms
9.4 ms 8.0 ms 10 ms 10 ms
42 ms 34 ms 42 ms 41 ms
290 ms 220 ms 256 ms 264 ms
33 s 26 s 10 s 19 s
Ó FEBS 2002 Light sensing two component systems in Calothrix (Eur. J. Biochem. 269) 2667
lifetimes of 42 ms, 290 ms and 33 s exhibit almost no
absorbance changes in the 660-nm range, but only an
increase of absorbance at around 720 nm. As an auto-
phosphorylation has been described for the corresponding
protein of Synechocystis sp., the measurements were also
performed in presence of ATP, and upon addition of the
response regulator RcpA. Neither the presence of ATP nor
RcpA had any significant effect on the kinetics of P
fr
formation (Table 2), although the light-induced phospho-
relay between receptor and their cognate response regulator
had recently been demonstrated for these proteins [29]. It
should be taken into account that these experiments were
not performed under quantitative conditions, i.e. no proof
was performed for the extent of phosphorylation.
CphB
Incubation of the soluble amounts of CphB apoprotein with
PCB, as described for the CphA, surprisingly yielded also a
P

r
-like absorption spectrum (k
max
685 nm) as found for its
paralog, despite the absence of the chromophore-binding
cysteinyl residue contained in phytochrome (-like proteins)
(Fig. 7, top). A biexponential kinetics with lifetimes of 15
and 103 s was determined, but no instantaneous formation
of an initial red-shifted intermediate analogous to the
700-nm species was observed as in the assembly of CphA
with PCB. Irradiation of the CphB/PCB complex led to the
formation of a far-red shifted species with an absorption
maximum at 735 nm, reminiscent of a P
fr
state (Fig. 7
middle, trace A). The incorporation of the chromophore
without covalent binding became evident upon the purifi-
cation via metal-affinity chromatography. The elution of the
affinity-bound protein from the resin resulted in the
collection of only the apoprotein, i.e. in a complete loss of
the chromophore (Fig. 7 middle, trace B). Yet, when PCB
was added to this eluted protein, the P
r
-like absorption
appeared again and photoreversibility identical to that of
the unpurified complex was re-established (Fig. 7, middle,
trace C).
The time-resolved measurement of P
r
-to-P

fr
photoconver-
sion of the CphB/PCB complex followed only biexponential
kinetics with lifetimes of 1.9 and 12.8 ms, both reactions
showing a decrease in absorption at 680–690 nm and a
concomitant increase at around 730 nm (Fig. 8). Contrary to
Fig. 7. Assembly kinetics of CphB + PCB at 10 °C, determined at
685 nm (top), and proof of noncovalent binding of PCB by CphB (middle
and bottom). Middle, CphB + PCB assembly probe: (A) incubation of
the crude lysate after cell harvest, (B) after elution of the CphB/PCB
complex from the affinity column, (C) after addition of fresh PCB to
eluate (B). Note the different total volumes for the various spectra.
Bottom, difference absorption spectra at various stages of purification
of the L246C mutant of CphB: affinity chromatography before (solid
lines) and after addition of PCB (dashed lines). The dashed curves
show the spectra after addition of PCB to the assembled chromprotein.
The apparent rise of the absorbances is due to the underlying broad
absorbance of unbound PCB (see for comparison the identical dif-
ference spectra).
Fig. 8. Lifetime-associated difference spectra of the CphB/PCB com-
plex. For details see caption to Fig. 6.
2668 H. J. M. M. Jorissen et al. (Eur. J. Biochem. 269) Ó FEBS 2002
CphA-PCB and other phytochromes, microsecond and
longer millisecond-to-second kinetics do not appear.
In addition to the above recombinant CphB, another
construct with the earliest possible translation starting site
was cloned and expressed in E. coli (Fig. 2). This ÔlongÕ
CphB apoprotein exhibited no differences to the results
discussed above regarding expression level, noncovalent
assembly with PCB, and P

r
and P
fr
absorption spectra (data
not shown).
The capability of apo-CphB to induce a phytochrome-
like photochemistry in noncovalently bound tetrapyrrole
chromophores prompted us to generate a point mutation
introducing a potentially covalently binding cysteinyl resi-
due. This mutant apoprotein (CphB L246C), when incuba-
ted with PCB, formed a P
r
-like absorption band with an
absorption maximum at 653 nm, and showed photochem-
ical reactivity with the formation of a P
fr
-like absorption
band with k
max
at 697 nm, very similar to the absorption
maxima of CphA (Fig. 7, bottom, solid lines). Also similar
to the behavior of CphA and different to the CphB/PCB
complex, the mutant protein, when assembled with PCB,
did not loose the chromophore upon affinity chromatogra-
phy. Accordingly, no absorbance increase could be
observed when additional PCB was added to the eluted
protein (dashed curves in Fig. 7, bottom).
DISCUSSION
Initially based on sequence alignments, and followed by the
characterization of recombinant proteins, a new type of

signal transduction components has been identified in
cyanobacteria and other, nonphotosynthetic prokaryotes.
The discovery of proteins with sequence similarity and the
capability to bind tetrapyrrole chromophores in a manner
reminiscent of the plant phytochromes, and their interac-
tion, via autophosphorylation upon an incoming stimulus
and phosphate transfer to a response regulator, connects the
light perception known from plants to the well characterized
two-component signal transduction of bacteria [19]. The
similarities of the prokaryotic photoreceptors with plant
phytochromes relate to the kinase motifs in the C-terminal
domain and to large portions of the proteins in the
N-terminal part that include the chromophore-binding
domain [8–11,13,14,16,21].
The interesting case in the results presented here is the
finding that Calothrix comprises two bacterial phyto-
chromes, one binding the chromophore covalently, and
the other, only tested under in vitro conditions, incorporates
the chromophore noncovalently. Yet, as shown by func-
tional studies, both chromoproteins undergo light-induced
auto- and trans-phosphorylation. One of the new proteins
(CphA of Calothrix sp.) and the previously characterized
photoreceptor of the cyanobacterium Synechocystis sp. [9]
exhibit strong sequence similarities. In contrast, its paralog,
CphB, lacks the chromophore-binding cysteinyl residue,
carrying a leucyl residue instead, and it shows lower
sequence similarities. The same codon change occurs also
in the sequence of the phytochrome-like protein AphB of
the cyanobacterium Anabaena sp., the genome of which has
recently been sequenced completely (GenBank accession no.

AB034952). It is not yet known whether these phyto-
chrome-like proteins in the cyanobacterial cell contain any
chromophore at all or, if not, whether they would be
capable of covalently binding a chromophore (of the linear
tetrapyrrole type or of any other structure) if incubated
in vitro. This is of particular interest in conjunction with
some other phytochrome-like proteins, the chromophore-
protein binding domains of which also deviate markedly
from the plant phytochromes. Several groups [11,13,14]
have reported naturally occurring phytochrome-like
chromoproteins which lack the cysteinyl and/or other
amino-acid residues close to the binding site essential in
plant phytochromes for the covalent chromophore attach-
ment. In fact, the investigation of factors being essential for
inducing a phytochrome-like photochemistry is currently
performed with strong activity [14,15,30]. These studies
become of even stronger interest after the recent demon-
stration that this induction of photochemistry is apparently
not restricted to the prokaryotic phytochromes, but also a
plant phytochrome apoprotein (apo-phyA of oat) can
incorporate a PCB-like chromophore with photochemical
activity, even when the binding capability of the chromo-
phore has been inactivated chemically [31]. The lack of the
chromophore-binding cysteine in some of the above-men-
tioned phytochrome-like proteins has triggered investiga-
tions on the type of interaction between chromophore and
protein. Based on studies on D. radiodurans [14,15], also
lacking the cysteinyl residue for covalent binding of a
tetrapyrrole, but carrying a histidine at a position similar to
that of CphB, a covalent bond formation between the

biliverdin and the histidinyl residue via a Schiff base has
been proposed. Similar experiments performed with CphB,
which was incubated with biliverdin IXa, show that no
stable bond formation can be detected, yet, a photochem-
istry similar to that of the phytochromes can be induced
[30].
Nevertheless, the possibility that, despite their sequence
similarities to the chromophore-binding domain of other
receptors of this class, AphB and CphB may monitor a
different type of external stimulus, can apriorinot be
excluded.
The fact that both the cphA and cphB genes are expressed
in Calothrix sp., the sequence similarity throughout the total
ORFs, and the similar genome structure (i.e. the presence of
a response regulator directly downstream from the receptor
gene) strongly suggest, however, that the two gene products
of Calothrix sp. and the Synechocystis chromoprotein
belong indeed to the same two-component signal-transduc-
ing receptor category. In the experiments reported here,
both recombinant apoproteins, CphA and CphB, were able
to incorporate PCB as a chromophore, and to undergo
reversible P
r
-to-P
fr
photoconversions. The question whether
either of these proteins is associated also in vivo with a
chromophore, and with which type of chromophore,
however, remains open at this time, and is currently very
difficult to answer due to the low concentration of these

proteins in the cyanobacterial cells, although in the case of
Cph1 from Synechocystis, PCB could be identified as the
in vivo incorporated chromophore [32].
For the in vitro generated CphB/PCB complex one
should note several distinct differences to other cyanobac-
terial phytochrome-like chromoproteins with respect to the
red shifts of the P
r
-and P
fr
-like absorption maxima, kinetics
of chromophore incorporation and P
fr
formation upon
irradiation (Figs 7 and 8), evidently reflecting the altered
chromophore–protein interactions. The results from the
Ó FEBS 2002 Light sensing two component systems in Calothrix (Eur. J. Biochem. 269) 2669
CphB L246C mutant that shows spectra very similar to
those from CphA give strong evidence that the exchange of
solely the covalently binding residue converts CphB into a
ÔnormalÕ cyanobacterial phytochrome. The loss of the
phytochrome-like absorbance during affinity chromatogra-
phy of the CphB/PCB complex, taken together with the
absolute stability of the point-mutated (L246C) protein
under the same experimental conditions, is a clear proof for
the unstability, or noncovalent character, of the chromo-
phore–protein interactions.
In contrast, the CphA–PCB chromoprotein and its
Synechocystis ortholog Cph1–PCB [16,17] are remarkably
similar to each other with respect to assembly kinetics, P

r
and P
fr
absorption maxima positions, and even P
r
-to-P
fr
conversion kinetics. In fact, the similar formation of a far-
red shifted intermediate during the assembly process (found
in both cyanobacterial proteins, Cph1 and CphA) has not
been found in any plant-derived phytochrome on that time
scale. The strong red shift of this intermediate points to a
protonation of the protein-adsorbed chromophore prior to
or during the incorporation into the protein binding site. It
is worth noting that this assembly intermediate is not
observed in the formation of the CphB/PCB complex,
another indication for the different chromophore–protein
interaction in this peculiar protein.
The thermal stability of the P
fr
form of CphA in the dark,
which is nearly identical to that of the recombinant
Synechocystis protein, is greater than that for any plant
phytochrome studied so far [28]. However, a process of
protonation/deprotonation, evident from a strong isotope
effect in the Synechocystis phytochrome photoconversion
[17], could not be detected in CphA. The finding that the P
r
-
to-P

fr
conversion is not affected by addition of ATP and/or
response regulator does not contradict a protein–protein
interaction during the phosphotransfer between receptor
and response regulator [29]. The fact that the kinetics
remain undisturbed upon the addition of ATP or the
interacting response regulator allows to suggest that this
protein–protein interaction occurs in the P
fr
state of the
CphA or CphB.
With the finding of two new receptor proteins in
Calothrix sp., associated with two response regulators, the
principle of detection and response to external stimuli is
farther extended into the prokaryotic phylum and illustrates
the broad spread of light-driven two-component signal
transduction.
ACKNOWLEDGEMENTS
We thank Tanja Berndsen, Gu
¨
l Koc and Helene Steffen, Max-Planck-
Institut fu
¨
r Strahlenchemie, Mu
¨
lheim an der Ruhr, for their technical
assistance. This work was financially supported by the Institut Pasteur
and the CNRS URA 1129 and by the Fonds der Chemischen Industrie
(B. Q.).
REFERENCES

1. Kendrick, R.E. & Kronenberg, G.H.M., eds (1994) Photo-
morphogenesis in Plants, 2nd edn. Kluwer Academic Publishers,
Dordrecht, the Netherlands.
2. Quail, P.H. (1997) The phytochromes: a biochemical mechanism
of signaling in sight? Bioessays 19, 571–579.
3. Braslavsky, S.E., Ga
¨
rtner, W. & Schaffner, K. (1997) Phyto-
chrome photoconversion. Plant Cell Env. 20, 700–706.
4. Tandeau de Marsac, N. (1983) Phycobilisomes and complement-
ary chromatic adaptation in cyanobacteria. Bull. Inst Pasteur 81,
201–254.
5. Tandeau de Marsac, N. & Houmard, J. (1993) Adaptation of
cyanobacteria to environmental stimuli – new steps towards
molecular mechansims. FEMS Microbiol. Rev. 104, 119–190.
6. Grossman, A.R., Schaefer, M.R., Chiang, G.G. & Collier, J.L.
(1994) The responses of cyanobacteria to environmental condi-
tions: light and nutritients. In The Molecular Biology of Cyano-
bacteria (Bryant, D.A., ed.), pp. 641–675. Kluwer Academic
Publishers, New York.
7. Fujita, Y., Murakami, A., Aizawa, K. & Ohki, K. (1994) Short-
term and long-term adaptation of the photosynthetic apparatus:
homeostatic properties of thylakoids. In The Molecular Biology of
Cyanobacteria (Bryant, D.A., ed.), pp. 677–692. Kluwer Academic
Publishers, New York.
8. Kaneko, T., Sato, S., Kotani, H., Tanaka, A., Asamizu, E.,
Nakamura, Y., Miyajima, N., Hirosawa, M., Sugiura, M., Sasa-
moto, S., Kimura, T. et al. (1996) Sequence analysis of the genome
of the unicellular cyanobacterium Synechocystis sp. strain
PCC6803. II. Sequence determination of the entire genome and

assignment of potential protein-coding regions. DNA Res. 3,
109–136.
9. Hughes, J., Mittmann, F., Wilde, A., Ga
¨
rtner, W., Bo
¨
rner, T.,
Hartmann, E. & Lamparter, T. (1997) A prokaryotic phyto-
chrome. Nature 386, 663.
10. Park, C M., Shim, J Y., Yang, S S., Kang, J G., Kim, J I.,
Luka, Z.A. & Song, P S. (2000) Chromophore–apoprotein
interactions in Synechocystis sp PCC6803 phytochrome Cph1.
Biochemistry 39, 1409–1412.
11. Kehoe, D.M. & Grossmann, A.R. (1996) Similarity of a chromatic
adaptation sensor to phytochrome and ethylene receptors. Science
273, 1409–1412.
12. Cobley, J.G., Zerweck, E., Reyes, R., Mody, A., Seludo-Unson,
J.R., Jaeger, H., Weerasuriya, S. & Navankasattusas, S. (1993)
Construction of shuttle plasmids which can be effectively mobi-
lized from Escherichia coli into the chromatically adapting cya-
nobacterium, Fremyella diplosiphon. Plasmid 30, 90–105.
13. Jiang, Z.Y., Swem, L.R., Rushing, B.G., Devanathan, S.,
Tollin, G. & Bauer, C.E. (1999) Bacterial photoreceptor with
similarity to photoactive yellow protein and plant phytochromes.
Science 285, 406–409.
14. Davis, S.J., Vener, A.V. & Vierstra, R.D. (1999) Bacter-
iophytochromes: Phytochrome-like photoreceptors from non-
photosynthetic eubacteria. Science 286, 2517–2520.
15. Bhoo, S.H., Davis, S.J., Walker, J.M., Karniol, B. & Vierstra,
R.D. (2001) Bacteriophytochromes are photochromic histidine

kinases using a biliverdin chromophore. Nature 414, 776–779.
16. Lamparter, T., Mittmann, F., Ga
¨
rtner, W., Bo
¨
rner, T., Hart-
mann, E. & Hughes, J. (1997) Characterization of recombinant
phytochrome from the cyanobacterium Synechocystis. Proc. Natl
Acad. Sci. USA 94, 11792–11797.
17. Remberg,A.,Lindner,I.,Lamparter,T.,Hughes,J.,Kneip,C.,
Hildebrandt, P., Braslavsky, S.E., Ga
¨
rtner, W. & Schaffner, K.
(1997) Raman spectroscopic and light-induced kinetic character-
ization of a recombinant phytochrome of the cyanobacterium
Synechocystis. Biochemistry 36, 13389–13395.
18. Yeh, K C., Wu, S H., Murphy, J.T. & Lagarias, J.C. (1997) A
cyanobacterial phytochrome two-component light sensory system.
Science 277, 1505–1508.
19. Parkinson, J.S. & Kofoid, E.C. (1992) Communication modules in
bacterial signaling proteins. Annu. Rev. Genet. 26, 71–112.
20. Wurgler-Murphy, S.M. & Saito, H. (1997) Two-component
signal transducers and MAPK cascades. Trends Biochem. Sci. 22,
172–176.
2670 H. J. M. M. Jorissen et al. (Eur. J. Biochem. 269) Ó FEBS 2002
21. Herdman, M., Coursin, T., Rippka, R., Houmard, J. & Tandeau
de Marsac, N. (2000) A new appraisal of the prokaryotic origin of
eukaryotic phytochromes. J. Mol. Evol. 51, 205–213.
22. Rippka, R., Deruelles, J., Waterbury, J.B., Herdman, M. & Stanier,
R.Y. (1979) Generic assignments, strain histories and properties of

pure cultures of cyanobacteria. J. Gen. Microbiol. 111, 1–61.
23. Sambrook, J., Fritsch, E.F. & Maniatis, T. (1989) Molecular
Cloning, 2nd edn. Cold Spring Harbor Laboratory Press, New
York.
24. Dower, W.J., Miller, J.F. & Ragsdale, C.W. (1988) High efficiency
transformation of E. coli by high voltage electroporation. Nucleic
Acids Res. 16, 6127–6145.
25. Mazel,D.,Guglielmi,G.,Houmard,J.,Sidler,W.,Bryant,D.A.
& Tandeau de Marsac, N. (1986) Green light induces transcription
of the phycoerythrin operon in the cyanobacterium Calothrix
7601. Nucleic Acids Res. 14, 8279–8290.
26. Remberg, A., Schmidt, P., Braslavsky, S.E., Ga
¨
rtner, W. &
Schaffner, K. (1999) Differential effects of mutations in the chro-
mophore pocket of recombinant phytochrome on chromoprotein
assembly and P
r
-to-P
fr
photoconversion. Eur. J. Biochem. 266,
201–208.
27. Lamparter, T., Esteban, B. & Hughes, J. (2001) Phytochrome
Cph1 from the cyanobacterium Synechocystis PCC6803 – purifi-
cation, assembly, and quaternary structure. Eur. J. Biochem. 268,
4720–4730.
28. Schmidt,P.,Gensch,T.,Remberg,A.,Ga
¨
rtner, W., Braslavsky,
S.E. & Schaffner, K. (1998) The complexity of the P

r
fi P
fr
phototransformation kinetics is an intrinsic property of homo-
geneous native phytochrome. Photochem. Photobiol. 68, 754–761.
29. Hu
¨
bschmann, T., Jorissen, H.J.M.M., Bo
¨
rner, T., Ga
¨
rtner, W. &
Tandeau de Marsac, N. (2001) Phosphorylation of proteins in the
light-dependent signalling pathway of a filamentous cyano-
bacterium. Eur. J. Biochem. 268, 3383–3389.
30. Jorissen, H.J.M.M., Quest, B., Lindner, I., Tandeau de
Marsac, N. & Ga
¨
rtner, W. (2002) Phytochromes with non-
covalently bound chromophores: The capability of apophyto-
chromes to direct tetrapyrrole photoisomerization. Photochem.
Photobiol. 75, 554–559.
31. Lindner, I., Braslavsky, S.E., Schaffner, K. & Ga
¨
rtner, W.
(2000) Model studies of phytochrome photochromism: Protein-
mediated photoisomerization of a linear tetrapyrrole in the
absence of covalent binding. Angew. Chem. Int., ed. Engl. 39,
3269–3271.
32. Hu

¨
bschmann, T., Bo
¨
rner,T.,Hartmann,E.&Lamparter,T.
(2001) Characterization of the Cph1 holo-phytochrome from
Synechocystis sp. PCC 6803. Eur. J. Biochem. 268, 2055–2063.
Ó FEBS 2002 Light sensing two component systems in Calothrix (Eur. J. Biochem. 269) 2671