Báo cáo khoa học: Improvement of ecdysone receptor gene switch for applications in plants: Locusta migratoria retinoid X receptor (LmRXR) mutagenesis and optimization of translation start site pptx

Improvement of ecdysone receptor gene switch for
applications in plants: Locusta migratoria retinoid
X receptor (LmRXR) mutagenesis and optimization
of translation start site
Ajay K. Singh
1,2
, Venkata S. Tavva
1,2
, Glenn B. Collins
2
and Subba R. Palli
1
1 Department of Entomology, University of Kentucky, Lexington, KY, USA
2 Plant and Soil Sciences Department, University of Kentucky, Lexington, KY, USA
Introduction
The conditional regulation of transgene expression by
the interaction of a chemical inducer with a designed
receptor or transcription factor is a powerful tool for
the regulation of transgenes in genetically modified
crops, as well as for plant biotechnological
applications [1–4]. Several chemically inducible gene
Keywords
ecdysone receptor; gene switch; genetically
modified crops; methoxyfenozide; retinoid X
receptor
Correspondence
S. R. Palli, Department of Entomology, S225
Ag. Science N, University of Kentucky,
Lexington, KY 40546-0091, USA
Fax: +1 859 323 1120
Tel: +1 859 257 4962

E-mail:
(Received 6 May 2010, revised 1 September
2010, accepted 8 September 2010)
doi:10.1111/j.1742-4658.2010.07871.x
Gene switches have potential applications for the regulation of transgene
expression in plants and animals. Recently, we have developed a two-
hybrid ecdysone receptor (EcR) gene switch using chimera 9 [CH9, a chi-
mera between helices 1–8 of Homo sapiens retinoid X receptor (HsRXR)
and helices 9–12 of Locusta migratoria RXR (LmRXR)] as a partner for
Choristoneura fumiferana EcR (CfEcR). As CH9 includes a region of
human RXR, public acceptance of this gene switch for use in genetically
modified crops may be an issue. The current studies were conducted to
identify an LmRXR mutant that could replace CH9 as a partner for
CfEcR. The amino acid identity between LmRXR and HsRXR is fairly
high. However, there are a few amino acid residues that are different
between these two proteins. LmRXR mutants were produced by changing
the amino acids in the helices 1–8 that are different between LmRXR and
HsRXR to HsRXR residues. Screening of these mutants in tobacco pro-
toplasts identified a triple mutant, A62S:T81H:V123I (SHILmRXR), that
performed as well as CH9. The performance of the EcR gene switch was
further improved by optimizing the translational start site (Kozak
sequence, AACAATGG) of the transgene. The EcR gene switch containing
SHILmRXR and the modified translation start site supported very low
background activity in the absence of a ligand and a higher induced activ-
ity in the presence of a ligand in tobacco protoplasts, as well as Arabidop-
sis thaliana transgenic plants. At 16–80 nm methoxyfenozide, the induction
of luciferase activity was better than that observed with the CfEcR:CH9
switch.
Abbreviations
AD, activation domain; CfEcR, Choristoneura fumiferana ecdysone receptor; CH9, chimera 9; DBD, DNA-binding domain; EcR, ecdysone

receptor; FMV, figwort mosaic virus; HsRXR, Homo sapiens retinoid X receptor; LBD, ligand-binding domain; LmRXR, Locusta migratoria
retinoid X receptor; MMV, Mirabilis mosaic virus.
4640 FEBS Journal 277 (2010) 4640–4650 ª 2010 The Authors Journal compilation ª 2010 FEBS
regulation systems or gene switches that respond to a
variety of chemicals have been developed [1,4–15].
Most of the gene switches developed to date use com-
pounds that are not suitable for large-scale applica-
tions in the field because of environmental concerns.
To overcome these problems, a more versatile chemi-
cally inducible gene regulation system has been devel-
oped [3,4,16]. The ecdysone receptor (EcR)-based gene
regulation system is one of the best gene switches
available, because the chemical ligands required for its
regulation, tubufenozide and methoxyfenozide, are
already registered for field use [17,18]. The advantages
and limitations associated with various chemically
inducible gene switches that have been developed to
date have been discussed in recent reviews [4,18–20].
A chemically inducible gene regulation system that
specifically regulates transgene expression in response
to an exogenous inducer at a particular stage of plant
development, or in a specific organ, is valuable for the
expression of transgenes whose constitutive overexpres-
sion is likely to compromise plant viability or fertility.
In addition, gene switches are useful to reduce environ-
mental concerns, such as gene pollution and antibiotic
resistance development, associated with genetically
modified crops [17,18,21].
The properties of an ideal chemically inducible gene
regulation system vary with each application; in gen-

eral, the gene switch should show an undetectable level
of transgene expression in the absence of a chemical
ligand, followed by rapid and robust induction of
transgene expression in the presence of a low concen-
tration (nanomolar) of a chemical ligand. In an effort
to find an ideal chemically inducible gene regulation
system, several approaches have been tried [1,10,14,22–
25]. An EcR gene switch with a potential for use in
large-scale field applications and applicability to a vari-
ety of plant species has been developed by adopting a
two-hybrid format [26]. This two-hybrid gene switch
uses chimera 9 [CH9, a chimera between helices 1–8 of
Homo sapiens retinoid X receptor (HsRXR) and heli-
ces 9–12 of Locusta migratoria RXR (LmRXR)] as a
partner of Choristoneura fumiferana ecdysone receptor
(CfEcR), and shows low background activity in the
absence of ligand and high induction of luciferase
reporter gene in the presence of nanomolar concentra-
tions of methoxyfenozide ligand [27].
In a two-hybrid switch format, the GAL4
DNA-binding domain (GAL4 DBD) is fused to the
ligand-binding domain (LBD) of CfEcR, and the VP16
activation domain (VP16 AD) is fused to LBD of
LmRXR. On application of methoxyfenozide, the hete-
rodimer of these two fusion proteins transactivates the
luciferase reporter gene placed under the control of
multiple copies of GAL4 response elements and the
)46 35S minimal promoter (that includes )46 to the
TATAA box of the 35S promoter [27]).
To develop an EcR gene switch that is highly sensi-

tive and exhibits low background activity in the
absence of ligand, we compared the amino acid resi-
dues in helices 1–8 of LmRXR and HsRXR. Based on
the amino acid sequence differences in helices 1–8 of
LmRXR and HsRXR, several LmRXR mutants were
created by employing the site-directed mutagenesis
method. We identified a triple mutant of LmRXR,
SHILmRXR, which is as efficient as CH9 as a partner
of CfEcR. The performance of the EcR gene switch
with the SHILmRXR mutant was compared with that
of the gene switches containing wild-type LmRXR and
CH9, as a partner of CfEcR, in inducing reporter gene
expression in tobacco protoplasts. The results observed
in protoplasts were confirmed in Arabidopsis transgenic
plants. To further improve the performance of the
EcR gene switch containing the SHILmRXR mutant
as a partner of CfEcR, Kozak sequences were incorpo-
rated upstream of the coding sequence of the reporter
gene and compared with the standard reporter con-
struct. A Kozak sequence was identified that worked
well in combination with the CfEcR gene switch.
Results
Transient expression studies with tobacco
protoplasts
RXR mutagenesis
The amino acid identity between LmRXR and
HsRXR is fairly high. However, there are a few amino
acid residues that are different between these two pro-
teins. Site-directed mutagenesis was carried out to
change the amino acid residues that were different

between LmRXR and HsRXR in helices 1–8 to
HsRXR residues in LmRXR (Fig. 1A, B). The perfor-
mance of the LmRXR mutants in inducing luciferase
reporter gene activity in a two-hybrid format was
tested by co-electroporation of CfEcR and LmRXR
and the luciferase reporter constructs into tobacco pro-
toplasts. Among the LmRXR mutants screened, the
T81H mutant showed low background activity in the
absence of ligand, and the A62S mutant showed high
induction of luciferase in the presence of ligand, when
compared with wild-type LmRXR (Fig. 2A). In order
to combine the desirable properties of these two
LmRXR mutants, we incorporated these two muta-
tions together. The A62S:T81H mutant (SHLmRXR)
showed low background activity in the absence of
ligand when compared with wild-type LmRXR, but
A. K. Singh et al. Improvement of ecdysone receptor gene switch
FEBS Journal 277 (2010) 4640–4650 ª 2010 The Authors Journal compilation ª 2010 FEBS 4641
lower induced luciferase activity. With a goal to
improve the induction levels of the reporter gene in the
presence of ligand, we introduced two additional muta-
tions (V68I and V123I) into A62S:T81H LmRXR.
Screening of these mutants identified a triple mutant,
A62S:T81H:V123I (SHILmRXR), that showed low
background activity in the absence of ligand and high
induced activity in the presence of ligand when com-
pared with the levels observed in either wild-type
LmRXR or the double mutant SHLmRXR (Fig. 2B).
Optimization of translational start site
Several Kozak sequences placed upstream of the lucif-

erase reporter gene translational start site were
screened to determine whether they improved the
transgene expression in plants. Among several Kozak
sequences tested, AACAATGG performed the best in
enhancing the induction of luciferase activity (Fig. 3).
When this Kozak sequence was placed upstream of the
luciferase reporter gene, the induction of luciferase
increased significantly when compared with the induc-
tion of luciferase supported by the start site present in
the commercial reporter vector (Promega Corporation,
Madison, WI, USA).
Comparison of performance of CfEcR:SHILmRXR,
CfEcR:CH9 and CfEcR:LmRXR gene switches in
tobacco protoplasts
We compared the performance of CfEcR:SHILmRXR,
CfEcR:CH9 and CfEcR:LmRXR gene switches in
combination with the newly identified Kozak sequence
by transfection of receptor and luciferase reporter con-
structs into tobacco protoplasts. The transfected pro-
toplasts were exposed to various concentrations of
methoxyfenozide and the luciferase activity was quanti-
fied. As shown in Fig. 4, both SHILmRXR and CH9
showed very low background activity in the absence of
ligand when compared with the background activity
exhibited by the LmRXR wild-type receptor. The
reporter gene placed under the control of the EcR gene
A
B
35S P
35S P

GAL4 RE
GAL4 RE
DBD
AD
EcR
RXR
TATA
Methoxyfenozide (M)
M
RXR
AD
TATA
Basic
transcriptional
machinery
DBD
Reporter gene T
Reporter gene
T
T
T
EcR
Fig. 1. (A) Schematic diagram of EcR two-hybrid switch. CfEcR plasmid was constructed by cloning a fusion of the GAL4 DBD (DBD) and
CfEcR LBD (EcR LBD) cloned under the control of the 35S promoter (35SP) in the pKYLX80 vector [29] containing the terminator sequence
(T). LmRXR plasmid was constructed by cloning the fusion of the VP16 activation domain (AD) and LmRXR LBD (RXR LBD) under the con-
trol of the 35S promoter in the pKYLX80 vector. The reporter vector )4635SLuc was constructed by cloning the luciferase reporter under
the control of 5· GAL4 response elements and a 35S minimal promoter containing )46 to the TATAA box [27]. The ligand used in this
switch is the ecdysone agonist, methoxyfenozide (M). (B) The alignment of the amino acid sequences of HsRXR and LmRXR helices 1–8.
The amino acids that are identical between HsRXR and LmRXR are marked with a shaded background. Five amino acids selected for the
first round of site-directed mutagenesis are boxed. Arrowheads point to the two amino acids tested as triple mutants.

Improvement of ecdysone receptor gene switch A. K. Singh et al.
4642 FEBS Journal 277 (2010) 4640–4650 ª 2010 The Authors Journal compilation ª 2010 FEBS
with either SHILmRXR, CH9 or LmRXR as a part-
ner increased after the protoplasts were exposed to as
low as 0.64 nm methoxyfenozide. The reporter activity
increased steadily as the dose of methoxyfenozide
increased, and reached maximum levels in protoplasts
exposed to 80 nm methoxyfenozide. At this concentra-
tion of ligand, the CfEcR:SHILmRXR switch sup-
ported the highest induction of reporter activity. The
CfEcR:CH9 switch supported a reporter activity that
was lower than that observed for the CfEcR:SHIL-
mRXR switch, but higher than that observed for
the CfEcR:LmRXR switch. These transient expression
700
LmRXR S122A
400
500
600
LmRXR A105S
LmRXR T94A
LmRXR T81H
LmRXR A62S
LmRXR Wt
100
200
300
Luciferase activity (RLU/µg protein)
0
0 0.64 3.2 16 80 400 2000 10 000

Methoxyfenozide (n
M)
0 0.64 3.2 16 80 400 2000 10 000
Methoxyfenozide (n
M)
500
600
700
800
900
LmRXR Wt
SHLmRXR
SHILmRXR
0
100
200
300
400
Luciferase activity (RLU/µg protein)
A
B
Fig. 2. (A) Screening of LmRXR mutants
S122A, A105S, T94A, T81H and A62S in
tobacco protoplasts. Tobacco protoplasts
were electroporated with receptor and the
reporter constructs. Electroporated protop-
lasts were exposed to various concentra-
tions of methoxyfenozide. The luciferase
activity was measured 24 h after the addi-
tion of methoxyfenozide. The luciferase val-

ues are expressed as relative light units
(RLU) per microgram of protein. The data
shown are the average of three repli-
cates ± standard deviation. (B) Comparison
of performance of LmRXR, LmRXR double
mutant A62S:T81H (SHLmRXR) and LmRXR
triple mutant A62S:T81H:V123I (SHILmRXR)
as a partner of CfEcR. The receptor and
reporter constructs were electroporated into
protoplasts. The transfected protoplasts
were exposed to various concentrations of
methoxyfenozide. Luciferase activity was
measured 24 h after the addition of meth-
oxyfenozide. The luciferase values are
expressed as RLU per microgram of protein.
The data shown are the average of three
replicates ± standard deviation.
400
500
600
CfEcR:LmRXR:–46 35S Luc
CfEcR:LmRXR:–46 35S
Kozak(AAAAATGGA) Luc
CfEcR:LmRXR:–46 35S
100
200
300
Kozak(AACCATGGA) Luc
CfEcR:LmRXR:–46 35S
Kozak(AACAATGGA) Luc

0
0 0.64 3.2 16 80 400 2000 10 000
Methoxyfenozide (nM)
Luciferase activity (RLU/µg protein)
Fig. 3. Improvement of Kozak sequence for
the expression of transgenes regulated by
the EcR gene switch. CfEcR, LmRXR and
reporter constructs containing three modi-
fied versions of Kozak sequences were elec-
troporated into protoplasts. The transfected
protoplasts were exposed to various con-
centrations of methoxyfenozide. Luciferase
activity was measured 24 h after the addi-
tion of methoxyfenozide. The luciferase
values are expressed as relative light units
(RLU) per microgram of protein. The data
shown are the average of three
replicates ± standard deviation.
A. K. Singh et al. Improvement of ecdysone receptor gene switch
FEBS Journal 277 (2010) 4640–4650 ª 2010 The Authors Journal compilation ª 2010 FEBS 4643
studies in tobacco protoplasts showed that SHIL-
mRXR was an excellent partner for CfEcR because of
low background activity in the absence of ligand and
higher induced activity in the presence of ligand, the
two most desirable properties of a successful gene
switch. A time-course experiment was conducted to
determine the ‘on’ and ‘off’ properties of the
CfEcR:SHILmRXR gene switch. The luciferase gene
expression regulated by CfEcR:SHILmRXR began to
increase at 3 h after addition of the ligand, and

reached maximum levels 24 h after the addition of the
ligand (Fig. 4B). The luciferase activity began to
decrease 24 h after withdrawal of the ligand, and
showed a continuous decrease until 42 h after ligand
withdrawal. By this time, about 75% of the induced
luciferase activity had disappeared (Fig. 4B). The
performances of CfEcR:SHILmRXR, CfEcR:CH9 and
CfEcR:LmRXR switches were further compared in
transgenic plants as described in the next section.
Comparison of performance of CfEcR:SHILmRXR,
CfEcR:CH9 and CfEcR:LmRXR gene switches in
Arabidopsis transgenic plants
For stable transformation, CfEcR:SHILmRXR,
CfEcR:CH9 and CfEcR:LmRXR gene switches and
the luciferase reporter constructs were cloned into the
T-DNA region of the pCAMBIA2300 binary vector.
The Arabidopsis transgenic plants were developed and
evaluated for their dose–response and time course
of induction of luciferase activity in the presence of
methoxyfenozide.
800
1000
1200
1400
1600
SHILmRXR CH9 LmRXR
0
200
400
600

DMSO 0.64 3.2 16 80 400 2000 10 000
Methoxyfenozide (nM)
Luciferase activity
(RLU/µg protein)
Luciferase activity
(RLU/µg protein)
800
900
1000
200
300
400
500
600
700
0
100
036 2412 6 12 24 4236
Hours exposed to
methoxyfenozide
Hours after methoxyfenozide
withdrawal
A
B
Fig. 4. (A) Comparison of performance of LmRXR, CH9 and LmRXR triple mutant A62S:T81H:V123I (SHILmRXR) as a partner of CfEcR. The
receptor and reporter constructs were electroporated into protoplasts. The transfected protoplasts were exposed to various concentrations
of methoxyfenozide. Luciferase activity was measured 24 h after the addition of methoxyfenozide. The luciferase values are expressed as
relative light units (RLU) per microgram of protein. The data shown are the average of three replicates ± standard deviation. DMSO, dimeth-
ylsulfoxide. (B) Time course of ‘turn on’ and ‘turn off’ of CfEcR:SHILmRXR switch. The receptor and reporter constructs were electroporated
into protoplasts. The transfected protoplasts were exposed to 80 n

M methoxyfenozide for 0, 3, 6, 12 and 24 h. The protoplasts were col-
lected at the end of each time point and the luciferase activity was measured; the values are expressed as RLU per microgram of protein.
In ligand withdrawal experiments, the transfected protoplasts were exposed to 80 n
M methoxyfenozide for 24 h, followed by incubation in
ligand-free medium for 6, 12, 24, 36 and 42 h. The protoplasts were collected at the end of each time point and the luciferase activity was
measured. The data shown are the average of three replicates ± standard deviation.
Improvement of ecdysone receptor gene switch A. K. Singh et al.
4644 FEBS Journal 277 (2010) 4640–4650 ª 2010 The Authors Journal compilation ª 2010 FEBS
Dose–response study with T2 Arabidopsis plants
In order to analyze the dose–response of methoxyfenoz-
ide, four Arabidopsis lines were selected for each con-
struct. The T2 seeds were germinated on agar medium
supplemented with 50 mgÆL
)1
kanamycin and 0 (dim-
ethylsulfoxide), 0.64, 3.2, 16, 80, 400, 2000 and
10 000 nm methoxyfenozide. After 20 days, three seed-
lings from each plate were collected and assayed sepa-
rately for luciferase activity. The plants containing the
CfEcR:SHILmRXR switch exhibited low background
activity of luciferase in the absence of ligand. On appli-
cation of 16–80 nm methoxyfenozide, the luciferase
activity in the CfEcR:SHILmRXR plants increased in a
dose-dependent manner (Fig. 5). The induction of the
luciferase reporter supported by this switch was initiated
at a concentration as low as 0.64 nm methoxyfenozide
and reached maximum levels at 16–80 nm methoxyfe-
nozide. The methoxyfenozide dose–response of the
CfEcR:SHILmRXR switch in combination with the
new Kozak sequence was similar to the dose–response

described above for the CfEcR:SHILmRXR switch and
the original Kozak sequence. However, the luciferase
activity at each dose of methoxyfenozide was higher in
plants containing the new Kozak sequence. The trans-
genic plants containing the CfEcR:LmRXR switch
showed higher background luciferase activity in the
absence of ligand and lower induced luciferase activity
in the presence of ligand. The transgenic plants contain-
ing the CfEcR:LmRXR switch showed a similar meth-
oxyfenozide dose–response to that observed in plants
containing the CfEcR:SHILmRXR switch (Fig. 5).
Time course studies in Arabidopsis plants
In order to evaluate the time course of the methoxyfe-
nozide response by the three EcR gene switches, T2
seeds collected from Arabidopsis transgenic lines were
germinated on agar medium containing 50 mgÆL
)1
kanamycin without methoxyfenozide. After 20 days,
the seedlings were transferred to the glasshouse and
different concentrations of methoxyfenozide ligand
were applied to soil. The luciferase reporter gene
expression was quantified at 0, 1, 2 and 4 days after
application of methoxyfenozide. As shown in Fig. 6,
luciferase activity began to increase 24 h after applica-
tion of the ligand to the soil, and continued to increase
up to 4 days. At most of the time points tested, the
luciferase induction values observed were higher in
seedlings exposed to 16–80 nm methoxyfenozide
(Fig. 6A). The time course of activity of methoxyfe-
nozide was similar for all three gene switches tested.

Time course studies were also conducted using T3
Arabidopsis transgenic plants expressing CfEcR and
SHILmRXR to determine the ‘on’ and ‘off’ properties
of this gene switch. As shown in Fig. 6B, luciferase
activity began to increase 6 h after the addition of
ligand, and reached maximum levels by 96 h after
application of the ligand. The luciferase activity began
to decrease 48 h after withdrawal of the ligand, and
600
700
LmRXR
SHILmRXR
CH9
400
500
CH9
100
200
300
0
0 0.64 3.2 16 80 400 2000 10 000
Methoxyfenozide (n
M)
Luciferase activity (RLU/µg protein)
Fig. 5. Comparison of performance of LmRXR, CH9 and LmRXR triple mutant T81H:A62S:V123 (SHILmRXR) as a partner of CfEcR in T2
Arabidopsis plants. Seeds collected from T1 Arabidopsis lines were plated on agar medium containing 50 mgÆL
)1
kanamycin and different
concentrations (0, 0.64, 3.2, 16, 80, 400, 2000, 10 000 n
M) of methoxyfenozide. Three seedlings from each plate were collected separately

and ground in a volume of 100 lLof1· passive lysis buffer, and the luciferase activity was measured and expressed in terms of relative
light units (RLU) per microgram of protein. Data shown are the average of three replicates ± standard deviation.
A. K. Singh et al. Improvement of ecdysone receptor gene switch
FEBS Journal 277 (2010) 4640–4650 ª 2010 The Authors Journal compilation ª 2010 FEBS 4645
reached less than 25% of the induced levels by 144 h
after withdrawal of the ligand.
Discussion
The major contribution of this study was the identifi-
cation of the SHILmRXR mutant, which performs
better than CH9 as a partner for CfEcR for applica-
tion as a chemically inducible gene regulation system
in plants. The CfEcR:SHILmRXR switch showed a
low background activity of the reporter gene in the
absence of ligand and a high induced activity of the
luciferase gene in the presence of a concentration as
low as 16 nm methoxyfenozide. Several versions of
EcR gene switches have been developed for use in
plants [3,4,13,16]. The EcR gene switch developed by
Tavva et al. [26] uses CH9 as a partner of CfEcR. As
CH9 is a region of HsRXR, this may not be accepted
by the public for applications in genetically modified
crops. Therefore, the current study was conducted to
find an alternative partner for CfEcR.
Previous studies on comparisons between
EcR:HsRXR and EcR:LmRXR gene switches have
shown that the EcR:HsRXR switch exhibits a low back-
ground activity of the reporter in the absence of ligand,
but the ligand sensitivity of this switch is lower than that
of the EcR:LmRXR gene switch [27]. In contrast, the
EcR:LmRXR switch shows higher ligand sensitivity

when compared with the EcR:HsRXR switch, but this
switch shows higher background activity of the reporter
gene in the absence of ligand. We hypothesized that the
differences in ligand sensitivity and background expres-
sion levels of luciferase reporter gene activity between
LmRXR and HsRXR containing EcR gene switches
700
300
400
500
600
0 day
1 day
2 day
4 day
0
100
200
LmRXR CH9
Luciferase activity (RLU/µg protein)
Luciferase activity (RLU/µg protein)
SHILmRXR
300
400
500
600
0
100
200
0 6 12 24 96 24 48 72 96 120 144

Hours exposed to
methoxyfenozide
Hours after methoxyfenozide
withdrawal
A
B
Fig. 6. (A) Comparison of performance of LmRXR, CH9 and LmRXR triple mutant A62S:T81H:V123I (SHILmRXR) as a partner of CfEcR in T2
Arabidopsis plants growing in soil. Seedlings grown on agar medium without added methoxyfenozide were transferred to the glasshouse;
80 n
M methoxyfenozide was applied to the soil. Three leaf disks were collected at 0, 1, 2 and 4 days after the addition of ligand, and the lucif-
erase activity was measured and expressed in terms of relative light units (RLU) per microgram of protein. Data shown are the average of
three replicates ± standard deviation. (B) Time course of ‘turn on’ and ‘turn off’ of CfEcR:SHILmRXR switch in transgenic plants. Seedlings
grown on agar medium without added methoxyfenozide were transferred to the glasshouse; 80 n
M methoxyfenozide was applied to the soil.
Three leaf disks were collected at 0, 6, 12, 24 and 96 h after the addition of ligand, and the luciferase activity was measured and expressed in
terms of RLU per microgram of protein. In ligand withdrawal experiments, transgenic plants grown in soil containing 80 n
M methoxyfenozide
for 96 h were transferred to ligand-free soil, and samples were collected at 24, 48, 72, 96, 120 and 144 h after transfer. The luciferase activity
was measured in leaf disks collected at each time point. The data shown are the average of four replicates ± standard deviation.
Improvement of ecdysone receptor gene switch A. K. Singh et al.
4646 FEBS Journal 277 (2010) 4640–4650 ª 2010 The Authors Journal compilation ª 2010 FEBS
might be a result of differences in the amino acid
sequences in helices 9–11, because CH9, which was cre-
ated by fusing helices 1–8 of HsRXR LBD and helices
9–12 of LmRXR LBD, performed very well by showing
the desirable properties of both EcR:HsRXR and
EcR:LmRXR switches. To test this hypothesis, seven
LmRXR mutants were created and tested by transfec-
tion of the LmRXR mutants, together with CfEcR and
reporter constructs, into tobacco protoplasts. These

screening assays identified a triple mutant of LmRXR,
SHILmRXR, that showed low background activity in
the absence of ligand when used as a partner of CfEcR.
The activity of this triple mutant of LmRXR was differ-
ent from that of wild-type LmRXR in this respect, as
wild-type LmRXR as a partner of EcR showed high
background activity in the absence of ligand. In addi-
tion, the CfEcR:SHILmRXR gene switch also sup-
ported a high induced activity of reporter gene in the
presence of a ligand concentration as low as 16 nm
methoxyfenozide. This induced activity supported by
SHILmRXR as a partner of CfEcR was better than that
observed when wild-type LmRXR was used as a partner
of CfEcR. Thus, this newly identified triple mutant of
LmRXR as a partner of CfEcR possesses two of the
most desirable properties of receptors used in gene
switches. Comparative studies in tobacco protoplasts, as
well as in Arabidopsis transgenic plants, showed that the
background activity of the CfEcR:SHILmRXR switch
was similar to that supported by the CfEcR:CH9 switch,
but the induced reporter activity supported by the
CfEcR:SHILmRXR switch in the presence of 16–80 nm
methoxyfenozide was better than that observed for the
CfEcR:CH9 switch. The differences observed in the
background activity in the absence of ligand and
induced reporter activity in the presence of ligand
between wild-type LmRXR and its triple mutant are
most probably caused by differences in their ability to
heterodimerize with CfEcR [17,18]. Previous studies in
mammalian cells on the heterodimerization of EcR and

RXR have suggested that SHILmRXR does not hetero-
dimerize with EcR in the absence of ligand [28]. This
mutant behaves like HsRXR in this respect. Palli et al.
[28] reported that HsRXR does not heterodimerize with
CfEcR in the absence of ligand. In the presence of
a nanomolar concentration of methoxyfenozide,
SHILmRXR heterodimerizes well with CfEcR and
transactivates genes placed under the control of meth-
oxyfenozide response promoters. In this respect, SHIL-
mRXR behaves like CH9. Palli et al. [18] showed that,
when compared with either HsRXR or LmRXR, the
chimeras between HsRXR and LmRXR heterodimerize
well with CfEcR at nanomolar concentrations of ecdys-
teroid ligands.
We screened several Kozak sequences to identify a
sequence that supports better transgene expression in
plants. We observed a significant increase in luciferase
reporter gene activity in the presence of ligand when a
Kozak sequence containing AACAATGG was used to
replace the native luciferase reporter gene Kozak
sequence. Interestingly, an increase in the ligand-
induced activity of this switch containing the improved
Kozak sequence was not accompanied by an increase
in background activity in the absence of ligand. There-
fore, this newly identified Kozak sequence could be
used in EcR gene switches, as well as other gene
switches, for the regulation of transgenes in plants.
The data presented here clearly demonstrate that
luciferase reporter gene expression is tightly regulated
by the CfEcR:SHILmRXR gene switch. This gene

switch showed negligible levels of background reporter
gene activity in the absence of ligand and the highest
levels of induced reporter gene activity in the presence of
a concentration as low as 16 nm of methoxyfenozide.
Although the amino acid identity between SHILmRXR
and HsRXR was increased, when compared with the
amino acid identity between wild-type receptors, SHIL-
mRXR performed much better than wild-type LmRXR
as a partner for EcR, and SHILmRXR is an insect
receptor. Therefore, the improvement made to the EcR
gene switch in this study by the manipulation of
LmRXR as a partner of CfEcR may lead to the wide-
spread use of this gene switch for applications in plants.
Experimental procedures
Ligand
Technical grade (99% pure) methoxyfenozide (a gift from
Rohm and Haas Company, Spring House, PA, USA) was
dissolved in dimethylsulfoxide to prepare 100 mm solution.
Various dilutions of this ligand in dimethylsulfoxide were
prepared from this stock solution.
LmRXR mutants
Site-directed mutagenesis was carried out using the Quick
Change Site-Directed Mutagenesis Kit (Stratagene, La
Jolla, CA, USA). Mutations were verified by sequencing.
The primers used for mutagenesis were as follows:
LmS122A (F), CTTGGCTGCTTGCGAGCTGTTATTCT
TTTCAATCC; LmS122A (R), GGATTGAAAAGAATAA
CAGCTCGCAAGCAGCCAAG; LmA105S (F), TTGACA
GAACTGGTATCAAAGATGAGAGAAATG; LmA105S
(R), CATTTCTCTCATCTTTGATACCAGTTCTGTCAA;

LmT94A (F), CAAGCTGGAGTCGGCGCAATATTTGA
CAGAGTTTTG; LmT94A (R), CAAAACTCTGTCAAA
A. K. Singh et al. Improvement of ecdysone receptor gene switch
FEBS Journal 277 (2010) 4640–4650 ª 2010 The Authors Journal compilation ª 2010 FEBS 4647
TATTGCGCCGACTCCAGCTTG; LmT81H (F), CTTGC
CACTGGTCTCCACGTGCATCGAAATTCTGCC; LmT81H
(R), GGCAGAATTTCGATGCACGTGGAGACCAGTG
GCAA; Lm A62S (F), GAACTGCTAATTGCATCATTT
TCACATCGATCTG; Lm A62S (R), CAGATCGATGTG
AAAATGATGCAATTAGCAGTTC; Lm V123I (F), TGG
CTGCTTGCGATCTATTATTCTTTTCAATCC; Lm V123I
(R), GGATTGAAAAGAATAGATCGCAAGCAGCCA.
Screening of LmRXR mutants in tobacco
protoplasts
The LmRXR mutants S122A, A105S, T94A, T81H, A62S,
A62S:T81H and A62S:T81H:V123I were cloned downstream
of the VP16 AD sequence in the pVP16 vector (BD Bio-
sciences Clonetech, San Jose, CA, USA). DNA sequences
coding for the fusion protein of VP16 AD and LmRXR
mutants were transferred from pVP16LmRXR to the
pKYLX80 vector [29] using NheI and XbaI restriction endo-
nucleases. GAL4 and CfEcRDEF fusion protein construct
(CfEcR) and a reporter construct containing the gene coding
for luciferase under the control of the )46 35S minimal pro-
moter and GAL4 response elements ()4635SLuc) were
cloned into the pKYLX80 vector (Table 1). Transient expres-
sion studies were carried out by isolating protoplasts from
cell suspension cultures of tobacco (Nicotiana tabacum cv.
Xanthi-Brad). A detailed description of the isolation and
electroporation of protoplasts has been given previously by

Tavva et al. [26].
Dose–response and time course studies in
tobacco protoplasts
The methoxyfenozide dose-dependent performance of dif-
ferent LmRXR mutants in inducing luciferase reporter gene
activity in a two-hybrid gene switch was tested by co-elec-
troporation of pK80-46 35S:luc, pK80GCfE and mutant
LmRXR constructs. The electroporated protoplasts were
incubated in growth medium containing 0, 0.64, 3.2, 16, 80,
400, 2000 and 10 000 nm methoxyfenozide. Twenty-four
hours after the addition of ligand, the protoplasts were
assayed for luciferase reporter gene activity using a Fluoro-
scan FL plate reader (Fluoroscan Ascent FL, Thermo Bio-
systems, Milford, MA, USA) as described previously [26].
In time course experiments, the protoplasts transfected with
CfEcR and SHILmRXR and the )46 35SLuc reporter were
exposed to 80 nm methoxyfenozide for 0–24 h, protoplasts
were collected and the luciferase activity was measured. In
ligand withdrawal experiments, the transfected protoplasts
were exposed to 80 nm methoxyfenozide for 24 h, and the
protoplasts were then transferred to ligand-free medium
and incubated for an additional 6–42 h. The protoplasts
were collected at the end of each time point and the lucifer-
ase activity was measured.
Optimization of translational start site
using Kozak sequences
Kozak sequences (AAAAATGG, AACCATGG and
AACAATGG) were placed upstream of the luciferase
reporter gene and screened for transgene expression in
plants. )46 and )31 35S minimal promoters were cloned

into the pKYLX80 vector as described by Tavva et al. [26].
The luciferase reporter gene was PCR amplified from the
pFRLuc vector (Stratagene) using several sets of primers
containing different Kozak sequences, and cloned into
pGEM-T Easy vector to verify the integration of the Kozak
sequences. The PCR primers used were as follows: KZK-
LUC2 (F), CTCGAGAAAAATGGAAGACGCCAAAAAC
ATAAAG; KZKLUC4 (F), CTCGAGAACCATGGAAGA
CGCCAAAAACATAAAG; KZKLUC1 (F), CTCGAGAA
CAATGGAAGACGCCAAAAACATAAAG. The bold
letters in the primers show Kozak sequence.
The luciferase reporter gene with the Kozak sequence was
then excised from the pGEM-T Easy vector and cloned into
the XhoI ⁄ SacI sites downstream of the )46 35S minimal pro-
moter in the modified pKYLX80 vector. The reporter gene
expression cassette with the pKYLX80 background was des-
ignated as pK80-46 35S:KLuc. The full-length luciferase gene
was cloned into the pKYLX80 vector under the control of
the cauliflower mosaic virus (CaMV) 35S promoter and used
as a positive control in transient transfection studies.
Binary vectors for stable transformation of
Arabidopsis
Binary vectors for stable transformation of Arabidopsis tha-
liana were constructed in pCAMBIA2300 vectors (CAM-
BIA, Canberra, Australia). To construct the binary vector
for plant transformation, the GAL4DBD:CfEcRDEF
fusion gene was cloned under the control of the figwort
mosaic virus (FMV) promoter and ubiquitin 2 (Ubi) termi-
nator sequence, and the VP16AD:LmRXR fusion gene was
cloned under the control of the Mirabilis mosaic virus

(MMV) promoter and Agrobacterium tumefaciens octopine
synthase (Ocs) poly A sequence. The FMV- and MMV-dri-
ven expression cassettes were assembled into the pSL301
vector. The reporter and receptor expression cassettes were
excised with appropriate restriction enzymes and assembled
into the pCAMBIA2300 vector for plant transformation.
The map of the binary vector used is shown in Fig. 7.
Production of transgenic plants
Arabidopsis thaliana (L.) Heynth. ecotype Columbia ER was
used for plant transformation experiments. The binary vec-
tors were mobilized into Agrobacterium tumefaciens strain
GV3850 by the freeze–thaw method. Arabidopsis plants were
transformed using the whole-plant dip method [30]. Trans-
Improvement of ecdysone receptor gene switch A. K. Singh et al.
4648 FEBS Journal 277 (2010) 4640–4650 ª 2010 The Authors Journal compilation ª 2010 FEBS
genic Arabidopsis plants were selected by germinating the
seeds collected from the infiltrated plants on medium con-
taining 50 mgÆL
)1
kanamycin. The analysis of transgenic
plants for luciferase induction level was carried out on T2
and T3 seeds plated on kanamycin-containing medium.
Dose–response studies in T2 Arabidopsis plants
Seeds collected from four T1 Arabidopsis lines were plated
on agar medium containing 50 mgÆL
)1
kanamycin and dif-
ferent concentrations of methoxyfenozide (0, 0.64, 3.2, 16,
80, 400, 2000, 10 000 nm). The seeds were allowed to germi-
nate and were grown on the induced medium for 20 days

at 25 °C, 16 h light ⁄ 8 h dark. Three seedlings from each
plate were collected separately and ground in a volume of
100 lLof1· passive lysis buffer (Promega Corporation),
and the luciferase activity was measured. To study the
dose–response in soil-grown plants, T2 Arabidopsis plants
were transferred to soil in pots placed in a glasshouse, and
the plants were allowed to grow in the glasshouse until they
had developed a complete whorl of rosette leaves. Different
doses of methoxyfenozide (0, 0.64, 3.2, 16, 80, 400, 2000,
10 000 nm) were applied to the pots three times at 2-day
intervals. Leaf disks were collected on day 4 and the lucifer-
ase activity was measured.
Time course studies in soil-grown plants
T2 Arabidopsis plants were transferred to a glasshouse, and
a time course study was conducted after application of 0,
0.64, 3.2, 16, 80, 400, 2000 or 10 000 nm methoxyfenozide
to the soil. Care was taken not to leach out any excess solu-
tion. Leaf disks were collected at 0, 1, 2 and 4 days after
application of methoxyfenozide, and the luciferase activity
was measured. To determine the ‘on’ and ‘off’ properties of
the CfEcR:SHILmRXR switch, time course studies were
conducted using T3 Arabidopsis plants. The transgenic T3
Arabidopsis plants growing in the soil were exposed to
80 nm methoxyfenozide for 0–96 h. The luciferase activity
was determined in leaf disks collected at 0, 6, 12, 24 and
96 h after application of the ligand. For ligand withdrawal
experiments, T3 Arabidopsis plants were exposed to 80 nm
methoxyfenozide for 96 h, followed by transfer to ligand-
free soil. The luciferase activity was determined in leaf disks
collected at 24, 48, 72, 96, 120 and 144 h after withdrawal

of the ligand.
Acknowledgements
This work was supported by Consortium for Plant
Biotechnology Research. This is contribution number
10-08-112 from the Kentucky Agricultural Experimen-
tal Station.
References
1 Aoyama T & Chua NH (1997) A glucocorticoid-
mediated transcriptional induction system in transgenic
plants. Plant J 11, 605–612.
UbiT
SpeI/XbaI SalI PstI HindIII
CfEcR
GAL4 DBD
FMVP
rbcST
Kozak-Luc
–46 35S P
GAL4 RE
MMV P
VP16 AD
OCS T
LmRXR mutant
Fig. 7. p2300:Lm7:KLuc: T-DNA region of the pCAMBIA2300 binary vector showing the assembly of receptor and reporter expression cas-
settes. FMVP, figwort mosaic virus promoter; MMVP, Mirabilis mosaic virus promoter; OCST, Agrobacterium tumefaciens octopine synthase
poly A; rbcST, poly A sequence; UbiT, ubiquitin 3 terminator; 35S P, CaMV 35S promoter with double enhancer sequence.
Table 1. Constructs used in the experiments.
Name of the
construct Description
CfEcR A fusion of GAL4 DNA-binding domain with CfEcR ligand-binding domain cloned under the control of the 35S promoter

in the pKYLX80 vector
LmRXR A fusion of VP16 activation domain and LmRXR ligand-binding domain cloned under the control of the 35S promoter in
the pKYLX80 vector
CH9 Chimera 9, a chimera between helices 1–8 of Homo sapiens retinoid X receptor (HsRXR) and helices 9–12 of
Locusta migratoria retinoid X receptor (LmRXR)
SHLmRXR A double mutant A62S:T81H of LmRXR
SHILmRXR A triple mutant A62S:T81H:V123I of LmRXR
)46 35SLuc Luciferase regulated by 5· GAL4 response elements and )46 to TATAA 35S promoter
)46 35SLuc Luciferase containing modified Kozak sequence and regulated by 5· GAL4 response elements and )46 to TATAA 35S
promoter
A. K. Singh et al. Improvement of ecdysone receptor gene switch
FEBS Journal 277 (2010) 4640–4650 ª 2010 The Authors Journal compilation ª 2010 FEBS 4649
2 Koo JC, Asurmendi S, Bick J, Woodford-Thomas T &
Beachy RN (2004) Ecdysone agonist-inducible
expression of a coat protein gene from tobacco mosaic
virus confers viral resistance in transgenic Arabidopsis.
Plant J 37, 439–448.
3 Martinez A, Sparks C, Drayton P, Thompson J, Green-
land A & Jepson I (1999a) Creation of ecdysone recep-
tor chimeras in plants for controlled regulation of gene
expression. Mol Gen Genet 261, 546–552.
4 Padidam M, Gore M, Lu DL & Smirnova O (2003)
Chemical-inducible, ecdysone receptor-based gene
expression system for plants. Transgenic Res 12, 101–109.
5 Gatz C, Frohberg C & Wendenburg R (1992) Stringent
repression and homogeneous de-repression by tetracy-
cline of a modified CaMV 35S promoter in intact trans-
genic tobacco plants. Plant J 2, 397–404.
6 Wilde RJ, Shufflebottom D, Cooke S, Jasinska I,
Merryweather A, Beri R, Brammar WJ, Bevan M &

Schuch W (1992) Control of gene expression in tobacco
cells using a bacterial operator-repressor system. EMBO
J 11, 1251–1259.
7 Williams S, Friedrich L, Dincher S, Carozzi N & Kess-
mann H (1992) Chemical regulation of Bacillus thuringi-
ensis-endotoxin expression in transgenic plants.
BioTechnol 10, 540–543.
8 Mett VL, Lochhead LP & Reynolds PH (1993) Copper-
controllable gene expression system for whole plants.
Proc Natl Acad Sci USA 90, 4567–4571.
9 Rieping M, Fritz M, Prat S & Gatz C (1994) A domi-
nant negative mutant of PG13 suppresses transcription
from a cauliflower mosaic virus 35S truncated promoter
in transgenic tobacco plants. Plant Cell 6, 1087–1098.
10 Weinmann P, Gossen M, Hillen W, Bujard H & Gatz
C (1994) A chimeric transactivator allows tetracycline-
responsive gene expression in whole plants. Plant J 5,
559–569.
11 Caddick MX, Greenland AJ, Jepson I, Krause KP,
Qu N, Riddell KV, Salter MG, Schuch W, Sonnewald
U & Tomsett AB (1998) An ethanol inducible gene
switch for plants used to manipulate carbon metabo-
lism. Nat Biotechnol 16, 177–180.
12 Bohner S, Lenk II, Rieping M, Herold M & Gatz C
(1999) Technical advance: transcriptional activator
TGV mediates dexamethasone-inducible and tetracy-
cline-inactivatable gene expression. Plant J 19, 87–95.
13 Martinez A, Sparks C, Hart CA, Thompson J &
Jepson I (1999b) Ecdysone agonist inducible transcrip-
tion in transgenic tobacco plants. Plant J 19, 97–106.

14 Bruce W, Folkerts O, Garnaat C, Crasta O, Roth B &
Bowen B (2000) Expression profiling of the maize flavo-
noid pathway genes controlled by estradiol-inducible
transcription factors CRC and P. Plant Cell 12, 65–80.
15 Zuo J, Niu QW, Moller SG & Chua NH (2001) Chemi-
cal-regulated, site-specific DNA excision in transgenic
plants. Nat Biotechnol 19, 157–161.
16 Unger E, Cigan AM, Trimnell M, Xu RJ, Kendall T,
Roth B & Albertsen M (2002) A chimeric ecdysone
receptor facilitates methoxyfenozide-dependent restora-
tion of male fertility in ms45 maize. Transgenic Res 11,
455–465.
17 Palli SR, Hormann RE, Schlattner U & Lezzi M
(2005a) Ecdysteroid receptors and their applications in
agriculture and medicine. Vitam Horm 73, 59–100.
18 Palli SR, Kapitskaya MZ & Potter DW (2005b) The
influence of heterodimer partner ultraspiracle ⁄ reti-
noid X receptor on the function of ecdysone receptor.
Febs J 272, 5979–5990.
19 Tang W & Newton RJ (2004) Regulated gene expres-
sion by glucocorticoids in cultured Virginia pine (Pinus
virginiana Mill.) cells. J Exp Bot 55, 1499–1508.
20 Zuo J & Chua NH (2000) Chemical-inducible systems
for regulated expression of plant genes. Curr Opin Bio-
technol 11 , 146–151.
21 Hare PD & Chua NH (2002) Excision of selectable
marker genes from transgenic plants. Nat Biotechnol 20,
575–580.
22 Ainley WM & Key JL (1990) Development of a heat
shock inducible expression cassette for plants: character-

ization of parameters for its use in transient expression
assays. Plant Mol Biol 14, 949–967.
23 Schena M, Lloyd AM & Davis RW (1991) A steroid-
inducible gene expression system for plant cells. Proc
Natl Acad Sci USA 88, 10421–10425.
24 Lloyd AM, Schena M, Walbot V & Davis RW (1994)
Epidermal cell fate determination in Arabidopsis: pat-
terns defined by a steroid-inducible regulator. Science
266, 436–439.
25 Zuo J, Niu QW & Chua NH (2000) Technical advance:
an estrogen receptor-based transactivator XVE mediates
highly inducible gene expression in transgenic plants.
Plant J 24, 265–273.
26 Tavva VS, Dinkins RD, Palli SR & Collins GB (2006)
Development of a methoxyfenozide-responsive gene
switch for applications in plants. Plant J 45, 457–
469.
27 Tavva VS, Dinkins RD, Palli SR & Collins GB (2007)
Development of a tightly regulated and highly inducible
ecdysone receptor gene switch for plants through the
use of retinoid X receptor chimeras. Transgenic Res 16,
599–612.
28 Palli SR, Kapitskaya MZ, Kumar MB & Cress DE.
(2003) Improved ecdysone receptor-based inducible gene
regulation system. Eur J Biochem 270, 1308–1315.
29 Schardl CL, Byrd AD, Benzion G, Altschuler MA,
Hildebrand DF & Hunt AG. (1987) Design and
construction of a versatile system for the expression of
foreign genes in plants. Gene 61, 1–11.
30 Clough SJ & Bent AF (1998) Floral dip: a simplified

method for Agrobacterium-mediated transformation of
Arabidopsis thaliana. Plant J 16, 735–743.
Improvement of ecdysone receptor gene switch A. K. Singh et al.
4650 FEBS Journal 277 (2010) 4640–4650 ª 2010 The Authors Journal compilation ª 2010 FEBS