Báo cáo khoa học: Essential role of the C-terminus in Melanocarpus albomyces laccase for enzyme production, catalytic properties and structure pdf

Essential role of the C-terminus in Melanocarpus
albomyces laccase for enzyme production, catalytic
properties and structure
Martina Andberg
1
, Nina Hakulinen
2
, Sanna Auer
1
, Markku Saloheimo
1
, Anu Koivula
1
,
Juha Rouvinen
2
and Kristiina Kruus
1
1 VTT Technical Research Center of Finland, Finland
2 Department of Chemistry, University of Joensuu, Finland
Introduction
Laccases (EC 1.10.3.2; p-dihenol dioxygen oxidoreduc-
tases) are copper-containing metalloenzymes that
oxidize various phenolic compounds, anilines and even
some nonaromatic compounds by a one-electron
removal mechanism, which usually generates radicals.
Oxidation of reducing substrates occurs concomitantly
with the reduction of molecular oxygen to water. Lac-
cases are ubiquitous enzymes found in various micro-
organisms, insects, and plants. They share structural
similarities with other blue multicopper oxidases,

Keywords
ascomycete; C-terminal plug; multicopper
oxidase; mutants; site-directed mutagenesis
Correspondence
M. Andberg, VTT Technical Research Center
of Finland, P.O. Box 1000, FIN-02044 VTT,
Finland
Fax: +358 20 722 7071
Tel: +358 20 722 5124
E-mail: martina.andberg@vtt.fi
Website: .fi/research/bic/
?lang=en
Database
The atomic coordinates and structure
factors have been submitted to the
Protein Data Bank under the accession
number 3DKH
(Received 2 July 2009, revised 17 August
2009, accepted 28 August 2009)
doi:10.1111/j.1742-4658.2009.07336.x
The C-terminus of the fungal laccase from Melanocarpus albomyces (MaL)
is processed during secretion at a processing site conserved among the
ascomycete laccases. The three-dimensional structure of MaL has been
solved as one of the first complete laccase structures. According to the
crystal structure of MaL, the four C-terminal amino acids of the mature
protein penetrate into a tunnel leading towards the trinuclear site. The
C-terminal carboxylate group forms a hydrogen bond with a side chain of
His140, which also coordinates to the type 3 copper. In order to analyze
the role of the processed C-terminus, site-directed mutagenesis of the MaL
cDNA was performed, and the mutated proteins were expressed in Tricho-

derma reesei and Saccharomyces cerevisiae. Changes in the C-terminus of
MaL caused major defects in protein production in both expression hosts.
The deletion of the last four amino acids dramatically affected the activity
of the enzyme, as the deletion mutant delDSGL
559
was practically inactive.
Detailed characterization of the purified L559A mutant expressed in
S. cerevisiae showed the importance of the C-terminal plug for laccase
activity, stability, and kinetics. Moreover, the crystal structure of the
L559A mutant expressed in S. cerevisiae showed that the C-terminal muta-
tion had clearly affected the trinuclear site geometry. The results in this
study clearly confirm the critical role of the last amino acids in the
C-terminus of MaL.
Abbreviations
2,6-DMP, 2,6-dimethoxyphenol; ABTS, 2,2¢-azinobis(3-ethylbenzo-6-thiazolinesulfonic acid); BsL, Bacillus subtilis laccase; MaL,
Melanocarpus albomyces laccase; rMaL, recombinant MaL expressed in T. reesei; Sc(delDSGL559), Melanocarpus albomyces laccase
delDSGL559 mutant expressed in Saccharomyces cerevisiae; Sc(L559A), Melanocarpus albomyces laccase L559A mutant expressed in
Saccharomyces cerevisiae; ScMaL, Melanocarpus albomyces laccase expressed in Saccharomyces cerevisiae; Tr(delDSGL
559
),
Melanocarpus albomyces laccase delDSGL
559
mutant expressed in Trichoderma reesei; Tr(L559G), Melanocarpus albomyces laccase L559G
mutant expressed in Trichoderma reesei.
FEBS Journal 276 (2009) 6285–6300 ª 2009 The Authors Journal compilation ª 2009 FEBS 6285
including ascorbate oxidase, ceruloplasmin, CueO, and
Fet3p. For catalytic activity, all four copper atoms are
needed: one type 1 (T1) copper forming a mononuclear
site, and one type 2 (T2) copper and two type 3 (T3
and T3¢) coppers forming a trinuclear site.

Melanocarpus albomyces is a thermophilic fungus
expressing a laccase with substantial thermal stability
and a pH optimum with phenolic substrates in the
neutral pH region [1]. These unusual properties, as
compared with most reported fungal laccases, makes
M. albomyces laccase (MaL) an interesting enzyme for
many applications. The three-dimensional structure of
MaL has been solved as one of the first complete
laccase structures (Protein Data Bank codes: 1GW0,
laccase from M. albomyces; 2IH8, a low-dose crystal
structure of a recombinant MaL; 2IH9, a high-dose
crystal structure of a recombinant MaL; and 2Q9O,
near-atomic resolution structure of recombinant MaL)
[2–4]. The enzyme is composed of three cupredoxin
domains, A, B, and C (or 1, 2, and 3), which all have
a similar Greek key b-barrel structure. The mononu-
clear site is located in domain C, whereas the trinucle-
ar site is between domains A and C. Electrons are
withdrawn from the mononuclear site and further
transferred about 13 A
˚
along a conserved Cys–His
pathway into the trinuclear site, where dioxygen is
reduced to water. The MaL structure was the first
solved three-dimensional structure showing dioxygen
binding [2]. Since then, dioxygen binding has also been
found for Bacillus subtilis laccase (BsL) [5] and cerulo-
plasmin [6]. Other solved laccase crystal structures
have shown only one oxygen atom between the two T3
coppers [7–10]. The crystal structure of MaL also has

a chloride ion attached to the T2 copper, whereas
other crystal structures of multicopper oxidases have
hydroxyl ion ⁄ water in this position. The role of the
chloride ion is unknown. A number of anions, i.e.
CN
)
,N
3
)
, and F
)
, are known to act as effective lac-
case inhibitors [11,12]. However, chloride ion does not
act as an inhibitor for MaL, as shown by Kiiskinen
et al. [1]. Instead, azide is a well-known inhibitor of
MaL. According to spectroscopic measurements, the
binding of azide has been suggested to bridge the T2
copper and one of the T3 coppers [13,14], or bind to
one T3 copper, as observed in the crystal structure of
ascorbate oxidase [15]. Recently, the azide was found
to bind between two T3 coppers in the crystal struc-
ture of BsL [5].
The three-dimensional structure of MaL revealed
that the C-terminus of the enzyme penetrates to a
tunnel leading to the trinuclear site (Fig. 1). This
unique feature has not been observed in any other
published laccase crystal structures. Instead, in other
known laccases, this cavity is open, and it is thought
to provide access to the fresh oxygen molecules
needed in the catalytic cycle. The C-terminus of MaL

blocks this route, as the packing of the C-terminus
against the tunnel is extensive, and there is no space
for dioxygen or any other molecules to enter. Further-
more, the C-terminal carboxylate group in MaL is
hydrogen-bonded to the side chain of His140, which
is one of the His residues coordinating the T2 copper
in the trinuclear center.
C-terminal sequencing of the mature MaL showed
that the C-terminus is post-translationally processed
after Leu559, leading to removal of the last 14 amino
Fig. 1. (A) Surface model of M. albomyces laccase; a few of the
last amino acids are represented as a purple worm (Protein Data
Bank code: 2Q9O). (B) The C-terminus of M. albomyces (in purple)
penetrates to the tunnel leading towards the trinuclear site.
Coppers are represented as orange balls, water atoms as red balls,
and dioxygen as a red stick.
Function of C-terminus in M. albomyces laccase M. Andberg et al.
6286 FEBS Journal 276 (2009) 6285–6300 ª 2009 The Authors Journal compilation ª 2009 FEBS
acids of the mature protein [16]. Similar C-terminal
processing has also been reported for other ascomycete
laccases, from Neurospora crassa [17], Podospori-
na anserina [18], and Myceliophthora thermophila [19].
The processing site for all of these laccases is Asp-Ser-
Gly-Leu. Interestingly, a similar type of sequence is
found in the C-termini of other ascomycete laccases
that do not undergo the C-terminal processing, e.g.
Borytris cinerea, Cryptonectria parasitica, and Gau-
emannomyces graminis var. tritici. The last four amino
acids in these laccases are Asp, Ser, Gly, and Leu ⁄ Ile ⁄
Val. The C-terminal end seems to be conserved among

all ascomycete laccases. The conserved C-terminus of
ascomycete laccases might have a special role in the
enzyme.
In order to analyze the role of the C-terminus, site-
directed mutagenesis of MaL cDNA was performed,
and the mutated proteins and wild-type enzyme were
expressed in Trichoderma reesei and Saccharomyces
cerevisiae. We report here the characterization of the
C-terminal mutants and the three-dimensional structure
of the L559A mutant expressed in S. cerevisiae
[Sc(L559A)].
Results
Production and characterization of MaL mutants
expressed in T. reesei
Two mutations were made in the MaL gene, and the
mutated proteins were expressed in T. reesei. The
mutated laccase constructs were produced by site-
directed mutagenesis on the plasmid pLLK8, a T. ree-
sei expression vector containing the cDNA coding for
MaL between the cbh1 promoter and terminator. In
the L559G mutant expressed in T. reesei [Tr(L559G)],
Leu559 was replaced with a Gly to change the pro-
cessing site to prevent C-terminal cleavage, and in
the delDSGL
559
mutant expressed in T. reesei
[Tr(delDSGL
559
)], an Asp at position 556 was replaced
by a stop codon to delete the last four amino acids

(Asp-Ser-Gly-Leu) of the mature MaL protein. The
mutated laccases, as well as two wild-type recombinant
MaLs (rMaLs) (produced by the pLLK13 and the
cbh1-negative pMS176 strains), were expressed in
T. reesei in shake flask cultures, and laccase pro-
duction was analyzed by activity determination
with 2,2¢-azinobis(3-ethylbenzo-6-thiazolinesulfonic acid)
(ABTS) and by immunoanalysis of culture superna-
tants. For the mutant Tr(delDSGL
559
), a transformant
in which the cbh1 gene had been replaced by the
expression construct was found and used. The C-termi-
nal mutations in Tr(L559G) and Tr(delDSGL
559
) had
a substantial effect on the production level in T. reesei,
as very low expression levels were observed for the
mutants according to the activity assays and western
blot analysis, as compared with the production of
wild-type rMaL (Fig. S1). The production level in the
T. reesei culture supernatant of the two mutants was
estimated to be 10 mgÆL
)1
, which was significantly
lower than the production level of the pLLK13 wild-
type rMaL (200 mgÆL
)1
). The activities on ABTS, 2,6-
dimethoxyphenol (2,6-DMP) and syringaldazine in the

culture supernatants of the mutants were considerably
reduced. In fact, no activity could be detected for the
Tr(delDSGL
559
) mutant, although amounts detectable
by western blot analysis were expressed into the super-
natant. The ABTS activity in the culture supernatant
of the Tr(L559G) mutant was several hundred-fold
lower than that of the wild-type rMaL. Comparison of
the production level and the activity in the culture
supernatant showed the specific activity of the mutants
to be considerably lower than that of the wild-type
enzyme. In addition to having low expression levels,
the Tr(L559G) and Tr(delDSGL
559
) mutants were
partly degraded (Fig. S1, lanes 2 and 3). Some laccase
degradation products were also detected in the culture
supernatants of the wild-type rMaL produced in the
two strains, but the ratio of degraded laccase to full-
length laccase was much higher in the mutant strains.
Changes in the original C-terminus thus caused major
defects in protein production in T. reesei as well as
changes in the protein properties.
The T. reesei strain producing the Tr(delDSGL
559
)
protein was also cultivated in a laboratory-scale
bioreactor (20 L), and the protein was purified from
the culture supernatant by applying the procedure

optimized for the wild-type rMaL [20]. The purifica-
tion protocol contained three chromatographic steps:
anion exchange chromatography, hydrophobic interac-
tion chromatography and, finally, anion exchange
chromatography with a high-resolution resin. The
Tr(delDSGL
559
) mutant started to degrade during
purification, and the mutant laccase could not be
obtained from the T. reesei culture filtrate.
Production and characterization of MaL in
S. cerevisiae
Owing to the difficulties in producing the mutant
laccases in T. reesei, S. cerevisiae was chosen as
an expression host for the designed mutants. The
full-length gene of MaL containing the C-terminal
extension, i.e. the last 14 amino acids that are cleaved
from the mature protein, was expressed in S. cerevisiae,
and the protein was purified from this source. The
M. Andberg et al. Function of C-terminus in M. albomyces laccase
FEBS Journal 276 (2009) 6285–6300 ª 2009 The Authors Journal compilation ª 2009 FEBS 6287
C-terminus of the purified laccase was analyzed by
C-terminal sequencing to determine whether yeast is
also able to process the C-terminus properly. MaL has
previously been showed to be processed at its C-termi-
nus during secretion, both in Melanocarpus and in
Trichoderma [16,20]. The results from the sequencing
clearly showed that the yeast was not able to process
MaL correctly, and that the additional 14 amino acids
were present in the protein. Therefore, all further work

was performed with another construct, pMS175, where
mature MaL cDNA, with a stop codon, was intro-
duced after the C-terminal processing site [16].
The effects of using S. cerevisiae as expression host
on the properties of M. albomyces laccase (ScMaL)
were also studied. The conditions for production of
ScMaL in shake flask cultures were optimized in terms
of CuSO
4
concentration in the medium, temperature,
culture medium, and induction conditions. The opti-
mal culture conditions were found to be as follows:
synthetic complete medium (SC-URA) buffered to pH
6 with succinate and supplemented with 1 mm CuSO
4
at 250 r.p.m. and 30 °C. Yeast cells were grown on
raffinose (20 gÆL
)1
), and a washing step prior to a
change to induction medium containing galactose
(20 gÆL
)1
) was shown to have a positive effect on lac-
case production. The production level in shake flask
cultures was about 4.5 nkatÆmL
)1
(ABTS activity),
roughly corresponding to 7 mgÆL
)1
ScMaL, when

calculated from the specific activity for ScMaL
(610 nkatÆmg
)1
).
ScMaL was heavily overglycosylated (Fig. 2). Iso-
electric focusing combined with activity staining of the
culture supernatant demonstrated that ScMaL had sev-
eral pI forms (pI 3.5–5), whereas the rMaL produced
in T. reesei only had one pI form (pI 4.0) (data not
shown). Purification of ScMaL was performed in two
chromatographic steps, including weak and strong
anion exchange resins. Owing to the heterogeneous
overglycosylation of ScMal, the laccase was fraction-
ated into two separate pools: pool 1, containing the
more heavily overglycosylated laccase; and pool 2,
with less overglycosylated laccase showing a major
laccase band at 100 kDa as analyzed by SDS ⁄ PAGE
(Fig. 2). The ABTS activity for pool 1 (430 nkatÆmg
)1
)
was consistently slightly lower than that for pool 2
(520 nkatÆmg
)1
). Pool 2 was therefore used for charac-
terization. Table 1 presents a summary of the charac-
teristics of purified ScMaL in comparison to the rMaL
produced in T. reesei. The specific activity of ScMaL
(520 nkatÆmg
)1
) was lower than the reported specific

activity of rMaL (840 nkatÆmg
)1
). However, the K
m
values for ABTS showed practically no difference
between the MaL preparations expressed in S. cerevi-
siae and T. reesei. Also, the temperature stability was
similar for ScMaL and rMaL. The N-terminal
sequencing verified correct processing of the yeast
a-prepro sequence (KEX2 cleavage site). Removal of
the glycans by enzymatic deglycosylation with endo-
b-N-acetylglucosaminidase F1 slightly lowered the
specific ABTS activity of ScMaL, but had no effect on
the specific activity of rMaL. Deglycosylation of over-
glycosylated ScMaL resulted in one pI isoform of the
enzyme, in contrast to the several isoforms seen with
the enzyme still having the glycans attached. The
results confirmed that MaL can be expressed in
S. cerevisiae and that the protein properties are com-
parable to those of the wild-type laccases and the lac-
case expressed heterologously in T. reesei.
Production and purification of the Sc(delDSGL
559
)
and Sc(L559A) mutants
Two C-terminal mutants of MaL, Sc(delDSGL
559
) and
Sc(L559A), were expressed in S. cerevisiae, and the
proteins were purified to homogeneity from the yeast

culture supernatant. In the Sc(delDSGL
559
) mutant,
the last four amino acids (Asp-Ser-Gly-Leu) were
deleted from the protein [equivalent to the Tr(del-
DSGL
559
mutant], and in the Sc(L559A) mutant, the
C-terminal Leu was replaced with a smaller Ala, in
order to prevent the hydrogen bonding of the carbox-
ylate group to a side chain of His140. Production of
the two mutated proteins in S. cerevisiae was carried
out in shake flasks using conditions optimized for
Fig. 2. SDS ⁄ PAGE gel and western blot analysis of purified
ScMaL. The samples from a Resource Q run were separated in a
12% SDS ⁄ PAGE gel. In lanes 1–3, a Coomasssie-stained gel is
shown, and in lanes 5–7, the gel has been blotted using antibodies
against MaL. The samples are rMaL (purified from T. reesei)in
lanes 1 and 7, ScMaL pool I, containing the more heavily overgly-
cosylated laccase, in lanes 2 and 5, and the less overglycosylated
laccase ScMaL pool II in lanes 3 and 6.
Function of C-terminus in M. albomyces laccase M. Andberg et al.
6288 FEBS Journal 276 (2009) 6285–6300 ª 2009 The Authors Journal compilation ª 2009 FEBS
ScMaL production. The total cultivation volume was
4 L for both mutated proteins. The culture superna-
tant was concentrated prior to purification. Similarly
to what was found for the Sc(delDSGL
559
) mutant
expressed in T. reesei, laccase activity on ABTS sub-

strate was not detectable in the Sc(delDSGL
559
) culture
supernatant, or in the concentrated culture filtrate,
although the expression of the mutant laccase was
confirmed by western blot analysis. The result clearly
confirms that the last four amino acids are essential
for enzyme activity. In the culture supernatant of
Sc(L559A), the activity on ABTS was 1.8 nkatÆmL
)1
,
which was 2.5-fold lower than the activity for ScMaL
(4.5 nkatÆmL
)1
).
The Sc(delDSGL
559
) mutant was purified in four
subsequent chromatographic steps. As the Sc(del-
DSGL
559
) mutant was not active in the culture super-
natant or after the first purification steps, the pooling
of the laccase-containing fractions was based on anti-
body detection on dot blots. In the pooled fractions
after the third hydrophobic interaction step, very low
but detectable laccase activity on ABTS could be
observed. The specific activities in two separate pools
were 0.21 and 0.45 nkatÆmg
)1

. These values are over
1000-fold lower than the specific activity of the wild-
type ScMaL (520 nkatÆmg
)1
). The activity results for
the Sc(delDSGL
559
) mutant, together with the activity
results for the corresponding mutant Tr(delDSGL
559
)
(see above), clearly indicate the essential role of the
last four amino acids for the function of MaL.
The Sc(L559A) mutant was also produced in shake
flasks for the initial characterization studies. From 4 L
shake flask cultures, overall 11.1-fold purification and
activity recovery of 24% were achieved. Altogether,
8.7 mg of purified Sc(L559A) mutant was recovered,
with a specific ABTS activity of 102 nkatÆmg
)1
.In
order to produce enough protein for crystallization
purposes, the Sc(L559A) mutant was also produced in
a laboratory-scale bioreactor (20 L), and the enzyme
was purified to homogeneity. The protein yield was
22 mg, and the specific activity of the final Sc(L559A)
sample was 184 nkatÆmg
)1
. Thus, the specific activity
of the Sc(L559A) mutant was three-fold to four-fold

lower than that of the wild-type ScMaL (520
nkatÆmg
)1
).
Characterization of the Sc(delDSGL
559
) and
Sc(L559A) mutants
The two purified MaL mutant proteins expressed in
yeast were characterized and compared with the wild-
type ScMaL. In order to determine whether the muta-
tions had affected the overall structure of the protein,
CD spectra of the Sc(delDSGL
559
) and Sc(L559A)
mutants were measured and compared with that of the
wild-type laccase (ScMaL) (Fig. 3A). The general
shapes of the spectra were the same for the Sc(del-
DSGL
559
) and Sc(L559A) mutants and wild-type
ScMaL, which suggests that no major changes in the
conformation of the mutated enzymes had occurred.
The thermal unfolding profiles measured with CD
(Fig. 3B) were broad, with no clear folded–unfolded
transition for ScMaL and the two mutants. The
Sc(L559A) mutant starts to unfold at a lower tempera-
ture as compared with ScMaL, suggesting slightly
reduced thermal stability. The difference between the
Sc(delDSGL

559
) mutant and ScMaL is even greater;
the Sc(delDSGL
559
) mutant exhibited an unfolding
behavior without any transition state, and started to
unfold at relatively low temperatures (40–50 °C). The
T
m
values were estimated from the graph to be 71 °C,
69 °C and 65 °C for ScMaL, the Sc(L559A) mutant,
Table 1. Characterization of the M. albomyces laccase produced in S. cerevisiae (ScMaL) and in T. reesei (rMaL).
Property ScMaL rMaL
N-terminal amino acid sequence Correctly processed Correctly processed
Molecular mass (MALDI-TOF) 79 420 Da 70 700 Da
Overglycosylation (on SDS ⁄ PAGE
and western blot)
Yes (100 kDa + smear) No (70 kDa)
Isoelectric point Several isoforms, pI 3.5–5 One isoform, pI 4
pH optimum (ABTS) 4 3.5
Specific activity (ABTS, pH 4.5, 25 °C) 400–610 nkatÆmg
)1
640–840 nkatÆmg
)1
K
m
(ABTS, pH 4.5, 22 °C) 260 lM 280 lM
Thermostability, t
1 ⁄ 2
at 65 °C, pH 6 40 min 35 min

Effect of deglycosylation
(endo-b-N-acetylglucosaminidase F1)
on isoelectric point
One isoform, pI 4 None (one isoform), pI 4
E
o
(T1 copper center) 0.43 V 0.47 V
M. Andberg et al. Function of C-terminus in M. albomyces laccase
FEBS Journal 276 (2009) 6285–6300 ª 2009 The Authors Journal compilation ª 2009 FEBS 6289
and the Sc(delDSGL
559
) mutant, respectively. Both
mutants were expected to be stable at 25 °C, and all of
the following kinetic analyses were therefore performed
at this temperature.
The redox potential of the mononuclear (T1) copper
center for the Sc(L559A) mutant was measured using
the ferrocyanide ⁄ ferricyanide redox buffer system
(E
0,Fe
= 0.433 V) [21] in 20 mm Tris ⁄ HCl (pH 7.5).
The laccase concentration used in the redox measure-
ments was estimated from the 600 nm absorbance,
using an extinction coefficient of 5700 m
)1
Æcm
)1
. The
redox potential of the Sc(L559A) mutant was deter-
mined to be 0.43 V, which is in agreement with the

value measured for ScMaL and also for the rMaL
expressed in T. reesei (0.47 V).
As the deletion mutant Sc(delDSGL
559
) was practi-
cally inactive, no detailed kinetic characterization
could be performed, and the kinetic characterization
was performed only with the Sc(L559A) mutant. For
analysis of the purified Sc(L559A) mutant in more
detail, three different substrates were used. The kinetic
constants presented in Table 2 show that the mutation
had a two-fold increased K
m
value on the nonphenolic
substrate ABTS (K
m
= 900 lm) as compared with
wild-type ScMaL (K
m
= 400 lm). The Sc(L559A)
mutant also exhibited a four-fold decreased catalytic
constant on ABTS (k
cat
= 394 min
)1
) as compared
with ScMaL (k
cat
= 1686 min
)1

). Consequently, the
specificity constant on ABTS dropped about 10-fold
from 4.2 lm
)1
Æmin
)1
for ScMaL to 0.44 lm
)1
Æmin
)1
for the Sc(L559A) mutant. However, for the two
phenolic substrates 2,6-DMP and syringaldazine, the
L559A mutation did not greatly influence the catalytic
parameters (Table 2). The K
m
values for the
Sc(L559A) mutant on 2,6-DMP and syringaldazine
were 16 and 31 lm, and the corresponding K
m
values
for ScMaL were 11 and 37 lm, respectively. The
L559A mutation had decreased the turnover number
on syringaldazine about two-fold (k
cat
= 1263 min
)1
)
as compared with wild-type ScMaL (k
cat
= 2410

min
)1
). With 2,6-DMP, no significant changes in the
kinetic parameters were observed.
In order to determine whether the L559A mutation
affects the trinuclear site, inhibition constants for
sodium azide were also determined. Azide inhibits the
Fig. 3. (A) CD spectra of wild-type ScMaL and the Sc(delDSGL
559
)
and Sc(L559A) mutants. The CD spectra of wild-type ScMaL (solid
line) and the Sc(delDSGL
559
) (dotted line) and Sc(L559A) (double
dotted line) mutants were recorded from 240 to 190 nm at 25 °Cin
10 m
M sodium phosphate buffer (pH 7.1). (B) Temperature-induced
unfolding of wild-type ScMaL and the Sc(delDSGL
559
) and
Sc(L559A) mutants measured by CD spectroscopy. Changes in
ellipticity of ScMaL and the Sc(delDSGL
559
) and Sc(L559A) mutants
were recorded at 202 nm upon heating from 30 °Cto90°Cin
10 m
M sodium phosphate buffer at pH 7.1. The data were
smoothed with
ORIGIN 7.5 (OriginLab).
Table 2. Kinetic parameters for wild-type ScMaL and the Sc(L559A) mutant. ABTS activity was measured in 25 mM succinate buffer at pH

4.5 and 25 °C, and 2,6-DMP and syringaldazine activities were measured in 40 m
M MES buffer at pH 6 and 25 °C. For determination of inhi-
bition constants for the sodium azide, the enzyme was preincubated for 2 min with NaN
3
prior to addition of substrate. The K
i
value was
obtained from Dixon plots. The error in all measurements was estimated to ± 15%. ND, not determined.
ABTS 2,6-DMP Syringaldazine
ScMaL Sc(L559A) ScMaL Sc(L559A¢) ScMaL Sc(L559A)
K
m
(lM) 400 900 11 16 37 31
k
cat
(min
)1
) 1686 394 612 545 2410 1263
k
cat
⁄ K
m
(lM
)1
Æmin
)1
) 4.2 0.44 48 34.3 66 41.3
K
i
(lM) 7.9 85 29 55 ND ND

Function of C-terminus in M. albomyces laccase M. Andberg et al.
6290 FEBS Journal 276 (2009) 6285–6300 ª 2009 The Authors Journal compilation ª 2009 FEBS
laccase activity by binding to the trinuclear centrer. In
the crystal structure of ascorbate oxidase, azide is sug-
gested to bind to one T3 copper [15], and in the crystal
structure of BsL, between two T3 coppers [5]. Spectro-
scopic findings have suggested that azide bridges the
T2 copper and one of the T3 coppers [13,14]. The
inhibition constants (K
i
) of sodium azide for the
Sc(L559A) mutant and ScMaL were determined using
ABTS or 2,6-DMP as substrate. The results indicated
that sodium azide was a mixed inhibitor with respect
to both ABTS and 2,6-DMP; that is, the inhibitor
binds at a location distinct from the reducing sub-
strate-binding site. When the nonphenolic substrate
ABTS was used, the K
i
value of sodium azide was
increased approximately 11-fold for the Sc(L559A)
mutant as compared with that of the wild-type ScMaL,
and was calculated (from Dixon plots) to be 85 lm
(Table 2). The corresponding value for the wild-type
enzyme was 7.9 lm. However, the difference in the K
i
values for ScMaL and the Sc(L559A) mutant was only
two-fold when the phenolic substrate 2,6-DMP was
used.
The pH optima of the purified Sc(L559A) mutant

were determined using ABTS and 2,6-DMP as sub-
strates. On ABTS, both wild-type ScMaL and the
Sc(L559A) mutant had optimal activity at pH 4, but
the pH activity profile of the Sc(L559A) mutant was
more narrow than that of the wild-type enzyme, and
had shifted to the alkaline side (Fig. 4). At pH 3, the
relative laccase activity was 88% for ScMaL, whereas
for the Sc(L559A) mutant it had dropped to below
3%. On 2,6-DMP, the pH activity profile of the
Sc(L559A) mutant was similar to that of the wild-type
enzyme, the mutant having a slightly broader pH
activity in an alkaline pH range (Fig. 4).
The stability of the purified Sc(L559A) mutant was
also analyzed as a function of pH and temperature.
The Sc(L559A) mutant remained stable within the pH
range 5.5–8 after 330 h of incubation at 4 °C (data not
shown). At pH < 5, the enzyme started to lose its
activity, the residual activity being 40% at pH 5, and
5% at pH 4 after 330 h. No activity was observed at
pH 3 and pH 2 after 330 h. In addition, it was shown
that the Sc(L559A) mutant was not stable at tempera-
tures higher than 50 °C during prolonged incubations
(at pH 6). The thermal stability was clearly reduced in
comparison to ScMaL. As an example, the half-life
(T
1 ⁄ 2
) of wild-type ScMaL at 60 °C was 4.5 h, whereas
the half-life of the Sc(L559A) mutant at this tempera-
ture was only a few minutes (Table 3). The results are
consistent with the CD spectrum as a function of

temperature, which also indicated lowered thermal
stability of the Sc(L559A) mutant.
Deglycosylation of ScMaL and the Sc(L559A)
mutant
The protein properties of wild-type ScMaL were com-
parable to the properties of rMaL (Table 1), although
ScMaL was heavily overglycosylated. Thus, the yeast
was a suitable host for production of the MaL vari-
ants for structural analysis. As the long glycan chains
attached in yeast to the laccase protein most probably
disturb crystallization, optimization of conditions for
removing the N-glycans was performed. Enzymatic
deglycosylation of ScMaL and the Sc(L559A) mutant
was performed with endo-b-N-acetylglucosaminidase
Fig. 4. The pH optima of the wild-type (h) and Sc(L559A) mutant
(d) laccases measured at 22 ° C, using ABTS (A) or 2,6-DMP (B) as
substrate. The enzymes were incubated in McIlvaine’s buffer.
Table 3. The apparent half-life values, T
1 ⁄ 2
, of the Sc(L559A)
mutant and ScMaL for ABTS at 40 °C, 50 °C, and 60 °C.
Sc(L559A) ScMaL
T
1 ⁄ 2
(40 °C) 24 h > 50 h
T
1 ⁄ 2
(50 °C) 6 h 23 h
T
1 ⁄ 2

(60 °C) > 10 min 4.5 h
M. Andberg et al. Function of C-terminus in M. albomyces laccase
FEBS Journal 276 (2009) 6285–6300 ª 2009 The Authors Journal compilation ª 2009 FEBS 6291
F1 (Sigma-Aldrich, St. Louis, MO, USA), which is an
enzyme suitable for deglycosylation of native proteins.
Endo-b-N-acetylglucosaminidase F1 generates a trun-
cated sugar molecule with one N-acetylglucosamine
residue remaining attached to the Asn. The effect of
deglycosylation was analysed by SDS ⁄ PAGE and
activity measurements. A single band at 90 kDa was
detected in the deglycosylated laccase samples, in con-
trast to the major band at about 100 kDa with an
additional smear of larger proteins observed for the
nontreated enzyme (Fig. S2). The removal of the gly-
cans reduced the laccase activity by approximately
5% (data not shown).
The secondary structure of the deglycosylated
ScMaL was also measured and compared with that
of the nonglycosylated ScMaL by CD spectroscopy.
The spectra of ScMaL and deglycosylated ScMaL
showed very little difference, indicating no major
changes in the protein fold (data not shown). The
thermal stability of the enzymes was also analyzed by
CD measurement. The results indicated that the ther-
mostability of the deglycosylated enzyme was slightly
improved in comparison with the glycosylated
enzyme.
The three-dimensional structure of the Sc(L559A)
mutant
In order to determine the structural effects of the

C-terminal mutation, the Sc(L559A) mutant was
crystallized for X-ray analysis. A crystal was diffracted
to 2.4 A
˚
, and the crystal structure was solved by
molecular replacement. The electron density map
clearly confirmed that the last residue of the mutant
was an Ala instead of a Leu (Fig. 5A). Superimposi-
tion of the rMaL (Protein Data Bank code: 2Q9O)
and Sc(L559A) mutant (Protein Data Bank code:
3KDH) structures showed that an additional water
molecule was present in the mutant structure (Fig. 5B).
Owing to the lower steric limitations of the side chain
of the Ala than of the Leu, water may occupy the
space. Furthermore, the side chain of His140, which is
coordinated to the T3 copper, rotated slightly and
formed a hydrogen bond with the new water. In the
structure of wild-type MaL, His140 was hydrogen-
bonded to the carboxylate group of the C-terminus,
with a distance of 3.1 A
˚
. In the Sc(L559A) mutant, the
distance between the ND1 atom of His140 and the ter-
minal oxygen OXT atom of Ala559 increased to 4.0 A
˚
.
In addition, a nearby Asn109 adopted a different
conformation in the Sc(L559A) mutant structure
(Fig. 5B). The C-terminal mutation clearly affected the
trinuclear site geometry.

In addition, the B-value of the T2 copper was clearly
higher than the B-values of the two T3 coppers in the
trinuclear site (Table 4). This was observed in both
molecules in an asymmetric unit, thus verifying the
phenomenon. Furthermore, no electron density was
observed for the chloride ion in molecule A. A chlo-
ride ion is coordinated to the T2 copper in the wild-
type MaL [4]. In molecule B, some electron density
was observed, but the refined chloride showed a very
high B-value. On the basis of this structure solved at
2.4 A
˚
resolution, it is impossible to say whether there
is a hydroxide or chloride ion, but we decided to refine
a chloride ion, because our near-atomic resolution
structure has confirmed that MaL has a chloride ion
in this position. It is likely that the occupancy of the
chloride ion was less in molecule B and that it was
totally lost in molecule A. Therefore, it seems that the
Fig. 5. (A) 2F
o
) F
c
electron density map of the C-terminus in the
crystal structure of the Sc(L559A) mutant (Protein Data Bank code:
3KDH). (B) Superimposition of the native enzyme (Protein Data
Bank code: 2Q9O) (green) and the Sc(L559A) mutant structure (in
blue).
Function of C-terminus in M. albomyces laccase M. Andberg et al.
6292 FEBS Journal 276 (2009) 6285–6300 ª 2009 The Authors Journal compilation ª 2009 FEBS

Sc(L559A) mutant at least partly loses its chloride ion
and probably also the T2 copper, as the B-value of the
T2 copper was rather high. On the basis of the anoma-
lous signal, the estimated occupancy of the T2 copper
was about 0.5. T2 copper depletion is known to be
common for laccases. The first solved laccase structure
lacked T2 copper [22], and several published structures
seem to have only partial T2 occupation, on the basis
of their high B-values. So far, MaL has been found to
be particularly stable, and before this mutant structure,
no signs of partial occupation of the T2 copper had
been observed.
Dioxygen was refined inside the trinuclear site of the
Sc(L559A) mutant. Dioxygen has earlier been observed
to bind to coppers in the trinuclear site, with all
copper–oxygen distances being 2.2–2.6 A
˚
[2] or slightly
more close to one of the type 3 coppers as observed in
a near-atomic resolution structure [4]. In the present
Sc(L559A) mutant structure, dioxygen was again
refined slightly differently. The copper–ligand distances
are presented in Table 4. In molecule B, the distance
between dioxygen and the T2 copper has extended to
3.1 A
˚
. However, our previous studies with MaL have
shown that the trinuclear site is sensitive to X-rays, and
the observed structure may depend on the data collec-
tion strategy or intensity of the beam [3]. Electrons are

extracted in the mononuclear site by the T1 copper and
further transferred to the trinuclear site, where dioxy-
gen acts as a terminal electron acceptor. Therefore, it is
difficult to draw any conclusions about the effect of the
C-terminal mutation on the binding of dioxygen. In
addition, it should be noted that the B-values of oxygen
atoms are very low, especially in molecule A.
Discussion
The ascomycete M. albomyces produces a thermostable
and alkaline laccase that undergoes C-terminal
processing. The processing site has been shown to be
conserved, but the C-terminal extension is not present
in all ascomycete-type laccases. The laccase sequences
from Chaetomium globosum, P. arenaria, N. crassa,
My. thermophila, Thielaviae arenaria and Magnapor-
the grisea contain the extension (Fig. 6). Processing
has been reported in the literature for only some
laccases [16–19,23]. The amino acid preceding the
C-terminal extension in the laccases undergoing
processing has been shown to be a Leu. C-terminal
processing has also been shown for the basidomycete
laccase from Coprinus cinereus, but the processing is
distinct from that of the ascomycete laccases, because
the C-terminus of C. cinereus laccase does not contain
the conserved ascomycete cleavage site [24].
The role of C-terminal processing of the ascomycete
laccases is not known, but it has been suggested to be
involved in the activation of the laccase [17,19].
Screening a My. thermophila laccase mutant library,
Zumarraga et al. found a laccase variant with better

kinetics than the parental type, with two mutated
amino acids in the C-terminal extension. The mutations
Table 4. Distances and B-values of atoms at the trinuclear site. The Sc(L559A) mutant structure is compared with published native
rMaL structures: a low-dose structure (Protein Data Bank: 2IH8), a high-dose structure (Protein Data Bank: 2IH9) and a near-atomic structure
(Protein Data Bank: 2Q9O). A and B are two molecules in the asymmetric unit.
L559A mutant
rMaL,
low-dose structure
rMaL,
high-dose structure
rMaL,
near-atomic structure
Distances (A
˚
)ABABABAB
T3–T3¢ 5.1 5.2 4.7 4.7 4.9 4.8 4.7 4.7
T3–T2 4.1 4.4 3.9 4.0 4.1 4.1 4.0 4.0
T3¢–T2 4.0 4.4 4.0 3.9 3.9 4.1 4.0 4.0
T2–Cl 3.0 – 2.5 2.6 2.9 2.8 2.5 2.5
T3–O1 2.6 2.5 2.2 2.3 – – 2.0 2.2
T3–O2 2.7 2.6 2.5 2.5 2.7 2.4 2.5 2.3
T3¢–O1 2.7 2.9 2.6 2.7 – – 2.7 2.6
T3¢–O2 2.5 2.7 2.3 2.3 2.3 2.5 2.5 2.5
T2–O2 2.7 3.1 2.6 2.7 3.5 3.4 2.3 2.7
B-values (A
˚
2
)
T3 26.0 23.0 18.6 22.5 19.1 18.3 11.9 12.3
T3¢ 15.5 25.9 15.9 17.0 16.4 18.7 11.7 11.7

T2 48.0 58.1 15.9 20.1 21.4 22.1 10.1 10.5
Cl 49.9 – 22.7 27.0 31.9 32.1 15.2 15.4
O1 1.0 9.9 33.2 32.0 11.2 13.8 24.4 23.9
O2 1.1 8.3 28.2 27.8 – – 26.0 25.3
M. Andberg et al. Function of C-terminus in M. albomyces laccase
FEBS Journal 276 (2009) 6285–6300 ª 2009 The Authors Journal compilation ª 2009 FEBS 6293
in My. thermophila laccase (75% identical to MaL)
resulted in a protein with disturbed T1 copper geome-
try and reduced redox potential, as well as an altered
trinuclear copper site, as shown by reduced oxygen
uptake [25]. Surprisingly, the mutations in the C-termi-
nal extension affected the protein properties, although
the extension was cleaved from the mature protein.
The mutations were suggested [25] to affect the folding
of the protein during the post-translational processing,
and thereby the function of the mature laccase.
Our structural analysis of wild-type MaL indicated
that the last four amino acids of the mature protein
penetrate the tunnel leading from the surface to the
trinuclear site and form a plug [2]. C-terminal blocking
might be a general feature of ascomycete laccases. In
fact, we have determined a low-resolution structure
(3.1 A
˚
)ofTh. arenaria laccase (unpublished results),
and it clearly shows that the C-terminus similarly
blocks the tunnel leading towards the trinuclear site.
This is strong evidence that C-terminal blocking is a
common feature of ascomycete laccases.
The deletion of the last four amino acids in MaL

dramatically affected the specific activity of the
enzyme, as the deletion mutant delDSGL
559
, expressed
both in yeast and in T. reesei, was practically inactive.
Also, the kinetic parameters were altered. The change
of only one amino acid in the C-terminus of the lac-
case, giving the Tr(L559G) and Sc(L559A) mutants,
reduced the turnover of the mutant proteins. For the
substrate ABTS, the Michaelis constant of the
Sc(L559A) mutant increased two-fold, and the turnover
decreased four-fold, yielding an enzyme with 10-fold
reduced catalytic efficiency, indicating that the last resi-
due, Leu559, has a role in the catalysis of ABTS oxida-
tion. The catalytic constants for the phenolic substrates
2,6-DMP and syringaldazine were not greatly affected
by the L559A mutation. For the substrate 2,6-DMP,
the mutation led to a slightly increased K
m
value
without significantly altering the k
cat
.
The thermal stability of the yeast mutants Sc(del-
DSGL
559
) and Sc(L559A) was determined by monitor-
ing the CD spectrum as a function of temperature,
because the kinetic stability of the inactive Sc(del-
DSGL

559
) mutant was impossible to determine by
activity measurements. Although the thermal unfolding
profiles for the mutant and wild-type laccases were
broad, with no clear folded–unfolded transition, it was
evident that the mutants were less thermostable than
the wild-type ScMaL. However, the similarities
between the far-UV CD spectra of the mutants and
that of the wild-type ScMaL do not support any major
conformational changes of the deletion mutant. The
reduced thermostability of the Sc(L559A) mutant was
also confirmed by residual activity measurements at
different temperatures. The crystal structure of the
Sc(L559A) mutant revealed T2 copper and chloride
ion depletion in the trinuclear site. It has been
observed that the first step in the denaturation of
laccases, before actual denaturation, is the loss of one
copper atom [26]. The clearly lowered protein stability
of the Sc(L559A) mutant protein is probably due to
T2 copper depletion.
A well-known laccase inhibitor, azide, has been
shown to bind to the trinuclear site in the crystal
structure of BsL [5], thus preventing binding of oxygen.
We analyzed the azide inhibition and determined the
inhibition constants for sodium azide, in order to see
the effect of the mutation (L559A) on the binding
properties in the trinuclear center. The inhibition of
MaL by azide was determined to be mixed inhibition
in which both specific and catalytic effects are present.
Thus, azide can bind both to the free laccase and

to the laccase–substrate complex. By comparing the
inhibition constants for azide of wild-type ScMaL and
Fig. 6. Multiple sequence alignment of the C-termini of some ascomycete laccases. Alignment of the C-terminal amino acid sequneces of
MaL (Q70KY3) with the laccases or putative laccases of My. thermophila (MtL, from patent CN1157008), Th. arenaria (TaLcc1, from patent
US2006063246), Ch. globosum (CgL1, XP_001228806; and CgL2, XP_001230068), Ma. grisea (MgL, XP_362544), P. anserina (PaL, P78722),
N. crassa (NcL, XP_956939), Cr. parasitica (CpL, Q03966), G. graminis var. tritici (GgL, CAD10749), and Botryotinia fuckeliana (BfL,
AAK77953). The protein abbreviation and the protein accession numbers are in parentheses.
Function of C-terminus in M. albomyces laccase M. Andberg et al.
6294 FEBS Journal 276 (2009) 6285–6300 ª 2009 The Authors Journal compilation ª 2009 FEBS
the Sc(L559A) mutant, we found that the inhibition
constants of azide were higher for the Sc(L559A)
mutant than for ScMaL with both ABTS and the phe-
nol substrate 2,6-DMP. This suggests that conforma-
tional changes have taken place in the trinuclear site.
The crystal structure of the Sc(L559A) mutant con-
firmed that the geometry of the trinuclear site was dis-
turbed. The His140, which is coordinated to the T3
copper, is slightly rotated as compared with the native
enzyme, and it forms a hydrogen bond with a water
molecule instead of a C-terminus. In addition, deple-
tion of the T2 copper and chloride ion was observed.
The changes seen in the trinuclear site of the
Sc(L559A) mutant may thus explain the more loose
binding of azide to the trinuclear copper center. As the
hydrogen bond between the C-terminus and His140 is
broken, and the stability of the trinuclear site is
decreased, the binding of azide to the trinuclear site
may be decreased. The depletion of the T2 copper and
chloride ion may also affect the azide binding. In fact,
it has been shown that the T2 copper is crucial for

dioxygen binding and that the depletion of the T2
copper inactivates the enzyme [13,22].
Notably, the effect of the mutation on the inhibi-
tion constant (K
i
) for azide was dependent on the sub-
strate. Similarly to the specificity constant on ABTS,
which was reduced 10-fold, the K
i
was increased
11-fold; however, the changes with the phenolic
substrates (2,6-DMP and syringaldazine) were not so
dramatic. The different behavior of the nonphenolic
ABTS and the phenolic substrates may be partly
caused by pH. When ABTS was used, kinetic analyses
were carried out at pH 4.5, whereas pH 6 was used
for the phenolic substrates. The oxidation of ABTS
does not involve proton transfer from the substrate to
the enzyme, in contrast to what occurs with the phe-
nolic substrates. When ABTS is used, many acidic
amino acids around the trinuclear site (mainly Asp
residues) can provide an immediate supply of protons
for the reduction of dioxygen. Therefore, the mutation
near the trinuclear site may have a more dramatic
impact, especially at low pH, for the nonphenolic
substrates.
Interestingly, the conformational changes in the
trinuclear site seen in the three-dimensional structure
of the mutant protein have a clear effect on the appar-
ent affinity of the substrates, as seen from increased

K
m
values (especially for ABTS). One may speculate
that this effect would be caused by altered electron
and ⁄ or proton transfer between the mononuclear site
and the trinuclear site in the mutant protein, which
might also indicate an interaction between the C-termi-
nus and the mononuclear site.
Our results clearly show the critical role of the last
amino acids in the C-terminus of MaL. Deletion of the
four last amino acids strongly reduced the expression
of the protein in T. reesei and S. cerevisiae. Further-
more, the deletion resulted in practically inactive
protein, although the CD spectra suggested that the
secondary structure of the mutant was not significantly
altered. Even a single amino acid change in the
C-terminus of MaL (L559A) changed the catalytic
properties of the laccase. The solved three-dimensional
structure of the protein with the L559A mutation
revealed conformational changes in the trinuclear site.
Experimental procedures
Construction of the Tr(delDSGL
559
) and Tr(L559G)
mutants for expression in T. reesei
Two mutants were produced by site-directed mutagenesis
on the plasmid pLLK8, a T. reesei expression vector
containing the cDNA coding for MaL between the cbh1
promoter and terminator [20]. The mutated fragments were
generated by overlap extension PCR with 5¢-TCGCAGCA

GCGCTTCGTGTT-3¢ and 5¢-GGGTTATGAACGGGAT
GTTT-3¢ as upstream and downstream primers, respec-
tively, and for construction of the Tr(L559G) mutant,
the primers 5¢-ACCCCAAGATCGACTGGGCGG TAAG
CGTCGCGCTGGGTGGAGGA-3¢ and 5¢-TCCTCCACC
CAGCGGCGACGCTTACCGCCCGAGTCGATCTTGG
GGT-3¢ were used as forward and reverse primers, respec-
tively. For construction of the Tr(delDSGL
559
) mutant, the
forward primer 5¢-CGAATCCCTACCCCAAGATCTGAT
CGGGCCTGAAGCGTCGCCG-3¢ and the reverse primer
5¢-CGGCGACGCTTCAGGCCCGATCAGATCTTGGGG
TAGGGATTCG-3¢ were used. Briefly, the mutagenesis
was achieved by PCR with the use of specifically designed
primers with the desired substitutions included in their
sequence. Two independent PCR reactions were carried out
with the mutagenic primer and an outer flanking primer to
produce a forward and reverse fragment. The overlapping
fragments containing the mutation were then fused together
in a subsequent PCR reaction with the outside primers.
The plasmid pLLK8 was digested with SacII and NsiI, and
a fragment coding for the wild-type MaL was removed and
replaced by the mutated fragments. The laccase mutant
clones in plasmid pLLK8 were verified by sequencing to
confirm that no other changes in the nucleotide sequence
had occurred.
Production of the the Tr(delDSGL
559
) and

Tr(L559G) mutants in T. reesei
The linearized expression constructs of the mutated laccases
as well as the wild-type laccase construct pLLK13 [20],
M. Andberg et al. Function of C-terminus in M. albomyces laccase
FEBS Journal 276 (2009) 6285–6300 ª 2009 The Authors Journal compilation ª 2009 FEBS 6295
containing the full-length laccase cDNA between the cbh1
promoter and terminator sequences, were transformed into
T. reesei RutC-30 essentially as described by Penttila
¨
[27].
A MaL-producing strain in which the major cellulase gene
cbh1 (Cel7A) of T. reesei was disrupted was also con-
structed and transformed into T. reesei. The disruption
plasmid construct was made by introducing a long cbh1 ter-
minator fragment into the MaL expression plasmid
pLLK13. In the new construct pMS176, the laccase gene is
between a long cbh1 promoter (2.3 kb) and a 0.8 kb termi-
nator, followed by the long terminator fragment of 1.7 kb.
The long promoter and terminator fragments are needed to
improve the frequency of replacement of the cbh1 gene by
homologous recombination. The purified transformants of
mutated MaL, Tr(L559G) (VTT-D-03932) and Tr(del-
DSGL
559
) (VTT-D-0393), as well as wild-type MaL
pLLK13 [20] and pMS176, were cultured in shake flasks in
minimal medium [27] supplemented with 40 gÆL
)1
lactose,
20 gÆL

)1
spent grain, 0.1 mm CuSO
4
and 10 gÆL
)1
sodium
phthalate to buffer the medium to pH 6, for 7 days at
28 °C and 200 r.p.m.
Construction of the Sc(delDSGL
559
) and
Sc(L559A) mutants for expression in S. cerevisiae
All of the mutant laccase genes were cloned into the plas-
mid vector pMS175 [16] containing the mature MaL
sequence without the presequence and prosequence and the
C-terminal extension of the native protein. The plasmid
pMS175 is built on the S. cerevisiae expression vector
pYES2 (Invitrogen, Carlsbad, CA, USA), and contains the
a-factor prepro sequence of S. cerevisiae as a secretion
sequence for improved yeast expression. The mutant laccase
genes were created with Stratagene’s (La Jolla, CA, USA)
QuickChange XL kit designed for large plasmids, according
to the manufacturer’s instructions, with 18 cycles of PCR
and transforming the PCR product to XL10 Gold ultra-
competent Escherichia coli cells. Primers (Sigma-Aldrich)
for construction of the Sc(L559A) mutant for PCR reac-
tions were as follows: forward, 5 ¢-CCAAGATCGACTCG
GGCGCTTAGCGTCGC-3¢; and reverse, 5¢-GCGACGCT
AAGCGCCCGAGTCGATCTTGG-3¢. For construction of
the Sc(delDSGL

559
) mutant, the primers used were as fol-
lows: forward, 5¢-ACCCCAAGATCTAATCGGGCCTG
TAGC-3¢; and reverse, 5¢-GCTACAGGCCCGATTAGAT
CTTGGGGT-3¢. All of the laccase mutant clones in plas-
mid pMS175 were sequenced to verify the mutations and to
confirm that no other changes in the nucleotide sequence
had occurred.
The mutant plasmids were extracted and purified by
Qiagen’s (Valencia, CA, USA) maxi-prep protocol and
transformed into the yeast strain INVSc1 (MATa his3D1
leu2 trp1-289 ura3-52 ⁄ MATa his3D1 leu2 trp1-289 ura3-52;
Invitrogen) with Gietz’s yeast transformation kit (Tetra
Link, Amherst, NY, USA), according to the manufacturer’s
instructions. The transformants were grown on SC-URA
[28] plates at 30 °C for 3 days.
Production of the recombinant MaL and the
Sc(delDSGL
559
) and Sc(L559A) mutants in
S. cerevisiae
The recombinant wild-type MaL (pMS175) [16] and mutant
proteins Sc(delDSGL
559
) and Sc(L559A) were produced in
S. cerevisiae under the inducible GAL1 promoter in shake
flask cultures. The yeast cells were grown in SC-URA med-
ium buffered to pH 6 with succinate and supplemented with
2gÆL
)1

raffinose and 1 mm CuSO
4
for 2 days (to a D
600 nm
of approximately 7) at 30 °C and 250 r.p.m. The well-grown
inoculumn (8 · 50 mL) was used to inoculate 8 · 500 mL of
fresh medium, and the cells were grown for an additional
1 day (D
600 nm
of 5–10), after which the cells were collected
by centrifugation (5000 g for 10 min), washed with one vol-
ume of sterile 0.9% NaCl solution, centrifuged again (5000 g
for 10 min), and finally suspended in induction medium (one
volume). The induction medium was similar to the inocula-
tion medium, except that 2 gÆL
)1
galactose was used instead
of 2 gÆL
)1
raffinose. After 3 days, the cells were removed by
centrifugation (5000 g for 10 min), and the clear culture
supernatant was collected and concentrated 10–20-fold by
ultrafiltration (molecular mass cut-off of 10 000 Da).
The Sc(L559A) mutant was also produced in a 20 L
laboratory-scale bioreactor. Culture was performed in
synthetic complete medium (SC-URA) buffered to pH 6 with
succinate and supplemented with 1 mm CuSO
4
. The yeast
cells were grown on glucose (40 gÆL

)1
) for 2 days, and glu-
cose was then fed into the culture for 3 days. The cells were
collected by centrifugation (5000 g for 10 min) and washed
with 0.9% sterile NaCl, and transferred into 12 L of induc-
tion medium containing galactose (20 gÆL
)1
). After 100 h, the
galactose had been used up, and more galactose was fed into
the culture for an additional 60 h. The cells were removed by
centrifugation (5000 g for 10 min), and the supernatant was
collected and concentrated approximately 20-fold by
ultrafiltration (molecular mass cut-off of 10 000 Da).
Purification of the ScMaL and the Sc(delDSGL
559
)
and Sc(L559A) mutants from S. cerevisiae
The concentrated culture supernatant, in 20 mm Tris ⁄ HCl
(pH 7.5), of the wild-type or mutant MaL was applied to a
weak anion exchange column (DEAE Sepharose FF) in
20 mm Tris ⁄ HCl (pH 7.5) and eluted with a linear
0–400 mm Na
2
SO
4
gradient. Laccase-containing fractions
were pooled and concentrated, and the buffer was changed
to 20 mm Tris ⁄ HCl (pH 7.5) (Vivaspin; molecular mass
cut-off of 10 000 Da). Typically, the laccase was further
purified with a high-resolution anion exchange column

(Resource Q). The bound proteins were eluted with a linear
Function of C-terminus in M. albomyces laccase M. Andberg et al.
6296 FEBS Journal 276 (2009) 6285–6300 ª 2009 The Authors Journal compilation ª 2009 FEBS
Na
2
SO
4
gradient (0–300 mm). The Sc(delDSGL
559
) mutant
was further purified by hydrophobic interaction chromato-
graphy. The sample was applied to a Phenyl Sepharose FF
column pre-equilibrated with 700 mm Na
2
SO
4
in 20 mm
Tris ⁄ HCl (pH 7.5). Proteins were eluted with a 700–0 mm
Na
2
SO
4
gradient. Active fractions were concentrated and
further loaded onto a gel filtration column (Sephacryl
S-100) in 20 mm Tris ⁄ HCl (pH 7.5). Pooling of the
Sc(delDSGL
559
) mutant-containing fractions was performed
on the basis of antibody detection on dot blots. Purification
of the laccases was followed by SDS ⁄ PAGE analysis.

Determination of protein concentration,
SDS ⁄ PAGE, and western blot
The protein concentration was determined using the
Bio-Rad DC protein assay kit (Bio-Rad Laboratories Inc.,
Hercules, CA, USA), with BSA as standard or calculated
from the UV absorbance at 280 nm, using a molar extinction
coefficient, e, of 115 720 m
)1
Æcm
)1
. The purity of the
enzymes was analyzed by SDS ⁄ PAGE (12% Tris ⁄ HCl
Ready Gel; Bio-Rad, Laboratories Inc., Hercules, CA,
USA), according to Laemmli [29]. The gels were stained with
Coomassie brilliant blue for visualization of the protein
bands. For western blot analysis, the proteins were trans-
ferred to Hybond P poly(vinylidene difluoride) membranes
(GE Healthcare Life Sciences, Uppsala, Sweden), and lac-
case was detected with polyclonal antibodies raised against
the native MaL and thereafter recognized by alkaline phos-
phatase-conjugated goat anti-(rabbit IgG) as secondary
antibody (Bio-Rad Laboratories Inc., Hercules, CA, USA).
Determination of laccase activities and kinetic
constants
The laccase activity was measured by monitoring the oxida-
tion of 4.7 mm ABTS in 25 mm succinate buffer (pH 4.5)
at 25 °C. [30]. The activity was calculated by spectroscopic
measurements at 436 nm, with an absorption coefficient (e)
of 29 300 m
)1

Æcm
)1
. The laccase activities for 2 mm
2,6-DMP and 0.06 mm syringaldazine were calculated by
measuring the oxidation of these compounds in 40 mm
MES ⁄ NaOH buffer (pH 6) at 25 °C at 469 nm
(e =19600m
)1
Æcm
)1
) and 525 nm (e =65000m
)1
Æcm
)1
)
for 2,6-DMP and syringaldazine, respectively. Activities
were expressed as nanokatals.
Kinetic constants (K
m
and k
cat
values) for the different
laccase proteins were determined using nonphenolic ABTS
(pH 4.5) and phenolic 2,6-DMP and syringaldazine (pH
6.0) as substrates at 22 °C. Eight different substrate concen-
trations (0.06–4.7 mm, 0.006–1.7 mm and 0.001–0.12 mm
for ABTS, 2,6-DMP, and syringaldazine, respectively) were
used. Kinetic measurements were performed in microtiter
plates in a total reaction volume of 300 lL. All the
measurements were performed in triplicate. The reactions

were started by the addition of substrate, and the rate of
substrate oxidation was measured by monitoring the change
in absorbance over 5 min, using a Varioskan kinetic plate
reader (Thermo Electron Corporation, Waltham, MA,
USA). The apparent kinetic parameters were obtained by
curve fitting analysis using graphpad prism software 4.01
(GraphPad Software, Inc., San Diego, CA, USA).
For inhibitor studies, the enzyme was preincubated for
2 min at room temperature with various concentrations of
sodium azide (NaN
3
) prior to addition of substrate. Dou-
ble reciprocal plots (1 ⁄ V versus 1 ⁄ S) were used to analyze
the type of inhibition. The inhibition constants were
obtained by plotting the reciprocal rate (1 ⁄ V) against the
inhibitor concentration (I) at different substrate values (S).
This Dixon plot yields a series of straight lines that
intersect at a unique point giving the negative inhibition
constant ()K
i
).
Thermal stability and pH dependency
The temperature stabilities of the wild-type enzyme and the
Sc(L559A) mutant were determined by incubating 20 nkat
of enzyme in 60 mm sodium citrate buffer (pH 6) at 40, 50
and 60 °C. The stabilities of the laccases at different pH
values were determined in McIlvaine buffer in the pH range
2.5–8.2, at 22 °C and 4 °C. The enzyme solutions were
incubated for various time periods, and the residual activity
was measured with 4.7 mm ABTS as substrate in 25 m m

succinate buffer (pH 4.5). The pH optima of ScMaL and
the Sc(L559A) mutant on 4.7 mm ABTS and 2 mm 2,6-
DMP as substrates were determined in McIlvaine buffer
(pH 2.5–8.2) at 22 °C. The residual enzyme activities were
measured with ABTS or 2,6-DMP as substrates, as
described above.
CD spectroscopy
CD spectra were recorded on a JASCO model J-720 CD
spectrometer equipped with a PTC-38WI Peltier thermally
controlled cuvette holder. Far-UV (240–190 nm) CD mea-
surements were performed with 2 lm enzyme in 10 mm
sodium phosphate buffer (pH 7.1) at 25 °C, using a 1 mm
cell and a bandwith of 1 nm. Spectra were accumulated
four times, and the values were corrected for buffer contri-
butions. For comparison of the CD spectra, data smoothed
by the Savitzky–Golay method were normalized by calcula-
tions using the graphpad prism software.
Thermal unfolding curves were obtained by monitoring
the 202 nm ellipticity as a function of temperature. The
temperature was raised gradually at 1 °CÆmin
)1
from 30 °C
to 90 °C. For comparison of the unfolding curves, the data
measured at 202 nm were smoothed by an adjacent averag-
ing procedure, prior to normalization by graphpad prism
software.
M. Andberg et al. Function of C-terminus in M. albomyces laccase
FEBS Journal 276 (2009) 6285–6300 ª 2009 The Authors Journal compilation ª 2009 FEBS 6297
Redox titration
The redox potential of the mononuclear (T1) copper center

for the mutated laccase was measured using the ferrocya-
nide ⁄ ferricyanide redox buffer system (E
0,Fe
= 0.433 V)
[21] in 20 mm Tris ⁄ HCl (pH 7.5). The laccase concentration
used in the redox measurements was estimated from the
600 nm absorbance, using an extinction coefficient of
5700 m
)1
Æcm
)1
.
Deglycosylation
Deglycosylation of ScMaL and the Sc(L559A) mutant was
performed using endo-b-N-acetylglucosaminidase F1
(Sigma, USA), according to the manufacturer’s instruc-
tions. ScMaL and the Sc(L559A) mutant were incubated
for 2 h at 37 °C with endo-b-N-acetylglucosaminidase F1 in
50 mm sodum phosphate buffer (pH 5.5).
Mass analysis, N-terminal sequencing, and
C-terminal sequencing
The mass analyses were performed on a MALDI-TOF
Autoflex II (Bruker Daltonik GmbH, Bremen, Germany).
N-terminal sequence analysis was performed according to
Edman degradation chemistry, using a PE Biosystems
Procise Sequencer (PE Biosystems, Foster City, CA, USA).
C-terminal sequence analysis was carried out with a Procise
C instrument at the Protein Analysis Center, Karolinska
Institutet, Sweden.
Structure determination for the Sc(L559A)

mutant
Crystals of the Sc(L559A) mutant were grown by the vapor
diffusion method at 20 °C, using 15% PMME2000, 0.2 m
ammonium sulfate, and 0.1 m sodium acetate buffer (pH
4.5). The protein concentration was 10 mgÆmL
)1
. Better-
quality crystals were obtained with a microseeding method
using 13% PMME2000 and an equilibrium time of
4 h. Crystals were tiny, with dimensions of about
0.1 · 0.1 · < 0.05 mm. The crystal was harvested and
plunged into the liquid nitrogen, using 25% glycerol as
cryoprotectant.
Diffraction data were collected on a beamline X12
located at the DORIS storage ring at DESY, using a wave-
length of 1.365 A
˚
. The crystal was partly nonmerohedrally
twinned, but the data-processing program xds was able to
process it rather well and the data were scaled with xscale
(Table 5). The space group was C2, with two molecules per
asymmetric unit. The structure was solved by a molecular
replacement method, using the coordinates of rMaL. The
structure was refined by iterative cycles of manual fitting
with o and positional refinements with cns. Refinements
were carried out using an initial anisotropic B-factor and
bulk solvent corrections. Data statistics are shown in
Table 5. R-values of the final model are slightly high, but
the electron density map was of good quality. The coordi-
nates and structure factors of the Sc(L559A) mutant have

been deposited in the Protein Data Bank as 3DKH.
Acknowledgements
The authors wish to thank H. Boer for help with CD,
P. Matikainen for help with the MALDI-TOF analysis,
O. Liehunen and B. Hillebrandt-Chellaoui for excellent
technical assistance, and B. Smit for fermentor culture.
This work is a part of the research programme ‘VTT
Industrial Biotechnology’ (Academy of Finland;
Finnish Center of Excellence programme, 2000–2005,
Project no. 64330). The study was performed with
financial support from Tekes (Finnish Funding Agency
for Technology and Innovation) and the Academy of
Table 5. Data collection and refinement statistics for the Sc(L559A)
mutant. R
meas
= redundancy-independent R-factor. Values in paren-
theses are for the highest-resolution shell.
Data collection
Space group C2
Unit cell dimensions a = 173.5, b = 62.0, c = 125.7 A
˚
,
b = 99.92
Molecules per
asymmetric unit
2
Wavelength 1.365 A
˚
Resolution (A
˚

) 20–2.4 (2.5–2.4)
Unique reflections 50 624 (5497)
Completeness (%) 97.4 (92.3)
R
meas
(%) 13.8 (37.9)
R
sym
11.8 (32.3)
I ⁄ I(r) 9.0 (4.0)
Refinement
Number of reflections
in working set
48 093
Number of reflections
in test set
2532
R
work
(%) 22.4
R
free
(%) 28.2
rmsd from restraint target values
Bond lengths (A
˚
) 0.0119
Angle distances (A
˚
) 1.5852

Number of atoms 9858
Protein 8714
Water 708
Copper 8
Others 428
Average B-factors (A
˚
2
) 21.1
Protein 20.3
Water 20.2
Copper 28.5
Others 39.1
Function of C-terminus in M. albomyces laccase M. Andberg et al.
6298 FEBS Journal 276 (2009) 6285–6300 ª 2009 The Authors Journal compilation ª 2009 FEBS
Finland. Structure determination work was supported
by the Academy of Finland, Project 115085. Data
collection at EMBL ⁄ DESY was supported by the
European Community, Research Infrastructure Action,
under FP6, ‘Structuring the European Research Area
Programme’, contract number RII3-2004-506008. We
also thank the staff of the beamline X12 EMBL ⁄ DESY
Hamburg outstation.
References
1 Kiiskinen L-L, Viikari L & Kruus K (2002) Purification
and characterisation of a novel laccase from the
ascomycete Melanocarpus albomyces. Appl Microbiol
Biotechnol 59, 198–204.
2 Hakulinen N, Kiiskinen LL, Kruus K, Saloheimo M,
Paananen A, Koivula A & Rouvinen J (2002) Crystal

structure of a laccase from Melanocarpus albomyces
with an intact trinuclear copper site. Nat Struct Biol 9,
601–605.
3 Hakulinen N, Kruus K, Koivula A & Rouvinen J
(2006) A crystallographic and spectroscopic study on
the effect of X-ray radiation on the crystal structure of
Melanocarpus albomyces laccase. Biochem Biophys Res
Commun 350, 929–934.
4 Hakulinen N, Andberg M, Kallio J, Koivula A, Kruus
K & Rouvinen J (2008) A near atomic resolution struc-
ture of a Melanocarpus albomyces laccase. J Struct Biol
162, 29–39.
5 Bento I, Martins LO, Lopes GG, Carrondo MA &
Lindley PF (2005) Dioxygen reduction by multi-copper
oxidases; a structural perspective. Dalton Trans 7, 3507–
3513.
6 Bento I, Peixoto C, Zaitsev VN & Lindley PF (2007)
Ceruloplasmin revisited: structural and functional roles
of various metal cation-binding sites. Acta Crystallogr
63, 240–248.
7 Piontek K, Antorini M & Choinowski T (2002) Crystal
structure of a laccase from the fungus Trametes versicol-
or at 1.90-A
˚
resolution containing a full complement of
coppers. J Biol Chem 277, 37663–37669.
8 Bertrand T, Jolivalt C, Briozzo P, Caminade E, Joly N,
Madzak C & Mougin C (2002) Crystal structure of a
four-copper laccase complexed with an arylamine:
insights into substrate recognition and correlation with

kinetics. Biochemistry 41, 7325–7333.
9 Garavaglia S, Teresa Cambria M, Miglio M, Ragusa S,
Iacobazzi V, Palmieri F, D’Ambrosio C, Scaloni A &
Rizzi M (2004) The structure of Rigidoporus lignosus
laccase containing a full complement of copper ions,
reveals an asymmetrical arrangement for the T3 copper
pair. J Mol Biol 342, 1519–1531.
10 Lyashenko A, Bento I, Zaitsev V, Zhukhlistova N,
Zhukova Y, Gabdoulkhakov A, Morgunova E, Voelter
W, Kachalova G, Stepanova V et al. (2006) X-ray
structural studies of the fungal laccase from
Cerrena maxima. J Biol Inorg Chem 11, 963–973.
11 Xu F (2001) Dioxygen reactivity of laccase. Dependence
on laccase source, pH, and anion inhibition. Appl
Biochem Biotechnol 95, 125–133.
12 Johannes C & Majcherczyk A (2000) Laccase activity
tests and laccase inhibitors. J Biotechnol 78, 193–199.
13 Solomon EI, Sundaram UM & Machonkin TE (1996)
Multicopper oxidases and oxygenases. Chem Rev 96,
2563–2606.
14 Solomon EI, Chen P, Metz M, Lee S-K & Palmer AE
(2001) Oxygen binding, activation, and reduction to
water by copper proteins. Angew Chem Int Ed 40,
4570–4590.
15 Messerschmidt A, Luecke H & Huber R (1993) X-ray
structures and mechanistic implications of three func-
tional derivatives of ascorbate oxidase from zucchini:
reduced, peroxide and azide forms. J Mol Biol 230,
997–1014.
16 Kiiskinen L-L & Saloheimo M (2004) Molecular

cloning and expression in Saccharomyces cerevisiae of a
laccase gene from the ascomycete Melanocarpus
albomyces. Appl Environ Microbiol 70, 137–144.
17 Germann U, Muller G, Hunziker P & Lerch K (1988)
Characterization of two allelic forms of Neuros-
pora crassa laccase. Amino- and carboxyl-terminal
processing of a precursor. J Biol Chem 263, 885–896.
18 Fernandez-Larrea J & Stahl U (1996) Isolation and
characterization of a laccase gene from Podospora
anserina. Mol Gen Genet 252, 539–551.
19 Bulter T, Alcalde M, Sieber V, Meinhold P, Schlacht-
bauer C & Arnold FH (2003) Functional expression of
a fungal laccase in Saccharomyces cerevisiae by directed
evolution. Appl Environ Microbiol 69, 987–995.
20 Kiiskinen L-L, Kruus K, Bailey M, Ylosmaki E,
Siika-aho M & Saloheimo M (2004) Expression of
Melanocarpus albomyces laccase in Trichoderma reesei
and characterization of the purified enzyme.
Microbiology 150, 3065–3074.
21 Xu F, Shin W, Brown SH, Wahleithner JA, Sundaram
UM & Solomon EI (1996) A study of a series of recom-
binant fungal laccases and bilirubin oxidase that exhibit
significant differences in redox potential, substrate speci-
ficity, and stability. Biochim Biophys Acta 1292, 303–311.
22 Ducros V, Brzozowski AM, Wilson KS, Brown SH,
O
¨
stergaard P, Schneider P, Yaver DS, Pedersen AH &
Davies GJ (1998) Crystal structure of the type-2 Cu
depleted laccase from Coprinus cinereus at 2.2 A

˚
resolu-
tion. Nat Struct Biol 5, 310–316.
23 Berka R, Schneider P, Golightly E, Brown S, Madden
M, Brown K, Halkier T, Mondorf K & Xu F (1997)
Characterization of the gene encoding an extracellular
laccase of Myceliophthora thermophila and analysis of
the recombinant enzyme expressed in Aspergillus oryzae.
Appl Environ Microbiol 63, 3151–3157.
M. Andberg et al. Function of C-terminus in M. albomyces laccase
FEBS Journal 276 (2009) 6285–6300 ª 2009 The Authors Journal compilation ª 2009 FEBS 6299
24 Yaver DS, Overjero MDC, Xu F, Nelson BA, Brown
KM, Halkier T, Bernauer S, Brown SH & Kauppinen S
(1999) Molecular characterization of laccase genes from
the basidiomycete Coprinus cinereus and heterologous
expression of the laccase Lcc1. Appl Environ Microbiol
65, 4943–4948.
25 Zuma
´
rraga M, Camarero S, Shleev SV, Martı
´
nez-Arias
A, Ballesteros A, Plou FJ & Alcalde M (2008) Altering
the laccase functionality by in vivo assembly of mutant
libraries with different mutational spectra. Proteins
Struc, Funct Bioinf 71, 250–260.
26 Marjasvaara A, Kruus K & Vainiotalo P (2006) A lac-
case study by electrospray ionization Fourier transform
ion cyclotron resonance MS: copper depletion, glyco-
forms and stability. J Mass Spectrom 41, 91–97.

27 Penttila
¨
M, Nevalainen H, Ra
¨
tto
¨
M, Salminen E &
Knowles J (1987) A versatile transformation system for
the cellulolytic filamentous fungus Trichoderma reesei.
Gene 61, 155–164.
28 Sherman F (1991) Getting started with yeast. Methods
Enzymol 194, 3–21.
29 Laemmli UK (1970) Cleavage of structural proteins
during the assembly of the head of bacteriophage T4.
Nature 227, 680–685.
30 Niku-Paavola M-L, Karhunen E, Salola P & Raunio V
(1988) Ligninolytic enzymes of the white-rot fungus
Phlebia radiata. Biochem J 254, 877–884.
Supporting information
The following supplementary material is available:
Fig. S1. Western blot analysis of culture supernatants
of T. reesei strains producing wild-type and mutant
MaL.
Fig. S2. SDS ⁄ PAGE of purified deglycosylated
Sc(L559A) mutant.
This supplementary material can be found in the
online version of this article.
Please note: As a service to our authors and readers,
this journal provides supporting information supplied
by the authors. Such materials are peer-reviewed and

may be re-organized for online delivery, but are not
copy-edited or typeset. Technical support issues arising
from supporting information (other than missing files)
should be addressed to the authors.
Function of C-terminus in M. albomyces laccase M. Andberg et al.
6300 FEBS Journal 276 (2009) 6285–6300 ª 2009 The Authors Journal compilation ª 2009 FEBS