Báo cáo khoa học: The effects of a-secretase ADAM10 on the proteolysis of neuregulin-1 pot

The effects of a-secretase ADAM10 on the proteolysis of
neuregulin-1
Christian Freese
1,
*, Alistair N. Garratt
2
, Falk Fahrenholz
1
and Kristina Endres
1
1 Institute of Biochemistry, Johannes Gutenberg-University, Mainz, Germany
2 Department of Neurosciences, Max-Delbru
¨
ck-Centre, Berlin, Germany
Neuregulin-1 (NRG-1) belongs to a family of growth
factors that transduce cellular signals by binding to
ErbB receptors [1,2]. At least sixteen different gene
products of NRG-1 have been identified [3,4], which
display a wide range of functions in the developing as
well as in the adult organism. Besides organs such as
the heart [5,6] or breasts [7], certain isoforms of
NRG-1 mediate important properties in the central
and peripheral nervous system: synapse formation [8]
and transmission [9], expression of neurotransmitter
receptors [10–12] and synaptic plasticity [13]. Addi-
tionally, general features of neurones or Schwann
cells, such as proliferation, differentiation, migratory
processes and regeneration, depend on NRG-1
activity [14–17].
Although some of these functions are restricted to
the developing embryonic brain, expression of NRG-1

or at least some of its isoforms [18,19] and the ErbB
receptors [13,17,20,21] persists throughout the adult
rodent and human nervous system. Within hippo-
campal synapses of adult mice, for example, NRG-1b
is implicated in activity dependent remodulation by
reversing long-term potentiation [22]. Moreover, it
induces neurite extension and arborization of primary
Keywords
Alzheimer; ErbB; metalloproteinase;
myelination; shedding
Correspondence
K. Endres, Institute of Biochemistry,
Johannes Gutenberg-University,
Johann-Joachim-Becherweg 30,
55128 Mainz, Germany
Fax: +49 6131 3925348
Tel: +49 6131 3926182
E-mail:
*Present address
Institute of Pathology, Johannes Gutenberg-
University, Mainz, Germany
(Received 28 August 2008, revised 22
December 2008, accepted 6 January 2009)
doi:10.1111/j.1742-4658.2009.06889.x
Although ADAM10 is a major a-secretase involved in non-amyloidogenic
processing of the amyloid precursor protein, several additional substrates
have been identified, most of them in vitro. Thus, therapeutical
approaches for the prevention of Alzheimer’s disease by upregulation of
this metalloproteinase may have severe side effects. In the present study,
we examined whether the ErbB receptor ligand neuregulin-1, which is

essential for myelination and other important neuronal functions, is
cleaved by ADAM10. Studies with b- and c-secretase inhibitors, as well
as with the metalloproteinase inhibitor GM6001, revealed an inhibition of
neuregulin-1 processing in human astroglioma cell line U373; however,
specific RNA interference-induced knockdown of ADAM10 remained
without effect. In vivo investigations of mice overexpressing either
ADAM10 or dominant negative ADAM10 showed unaltered cleavage of
neuregulin-1 compared to wild-type animals. As a consequence, the mye-
lin sheath thickness of peripheral nerves was unaffected in mice with
altered ADAM10 activity. Thus, although the b-secretase BACE-1 acts as
a neuregulin-1 sheddase, ADAM10 does not lead to altered neuregulin-1
processing either in cell culture or in vivo. Adverse reactions of an
ADAM10-based therapy of Alzheimer’s disease due to neuregulin-1 cleav-
age are therefore unlikely.
Abbreviations
APLP, amyloid precursor-like protein; APP, amyloid precursor protein; APPs, soluble APP fragment; DAPT, N-[N-(3,5-difluorophenacetyl)-
L-alanyl]-S-phenylglycine t-butyl ester; NRG-1, neuregulin-1; RNAi, RNA interference.
1568 FEBS Journal 276 (2009) 1568–1580 ª 2009 The Authors Journal compilation ª 2009 FEBS
cultures derived from adult murine hippocampi [21].
There is substantial genetic evidence that single nucleo-
tide polymorphisms of NRG-1 are associated with the
pathogenesis of schizophrenia [23–25]. In addition,
NRG-1 has been found to be involved in the patho-
genesis of other diseases such as multiple sclerosis
[26,27] or breast cancer [7].
How proteins derived from the gene for NRG-1 ful-
fil their different functions exactly remains elusive: iso-
forms of type I and III exist as transmembrane forms
or can be proteolytically processed [8,28–30] to release
soluble fragments. It is not known in detail whether

the transmembrane protein or its proteolytic products
are mainly responsible for the different functions.
Because recombinant soluble NRG-1 often is sufficient
to induce morphological or biochemical phenotypes
[21,31] and shedding of NRG-1 is activity dependent,
as shown for electrically stimulated neurones [8], an
important role of the cleavage fragments is implicated.
The proteinases involved in NRG-1 proteolysis have
been partly characterized: cleavage by the amyloid
precursor protein (APP)-processing c-secretase [32,33]
and, more recently, b-secretase BACE-1 [29,34] was
analyzed both in vitro as well as in vivo. Additional
data have also been reported with respect to metallo-
proteinase-derived proteolysis of NRG-1 isoforms.
For example, ADAM19 was shown to participate in
NRG-1-b shedding, whereas NRG-1-a2 was not
affected by coexpression of this enzyme [35]. Cleavage
of the a2 isoform of NRG-1, on the other hand, was
impaired in fibroblasts with catalytically inactive
ADAM17 [30].
b- and c-secretase are responsible for processing of
the Alzheimer associated APP and its paralogues amy-
loid precursor-like protein (APLP) 1 and APLP2 [36].
Furthermore, the distribution of NRG-1 and the local-
ization of its receptor ErbB4 have been found to be
altered in Alzheimer’s disease patients [19,37] and a
mouse model of the disease [19]. ADAM10 was found
to act as a-secretase in vitro and in cultured cells
[38,39]. It competes with BACE-1 for the substrate
APP and is able to prevent the formation of Ab pla-

ques in a mouse model of the disease [40]. Moreover,
ADAM10 restores long-term potentiation and
increases cognitive function in transgenic mice [40,41]
and enhances cortical synaptogenesis [42]. Due to the
overlap of substrate specificity of BACE-1 and
ADAM10 with respect to substrates such as APP or
the APLPs and partial phenotypic overlap of
ADAM10 and NRG-1 knockout mice [43–45], it was
considered important to investigate the possible role of
ADAM10 in NRG-1 processing in cells and in the
living animal.
Results
Identification of NRG-1 isoforms expressed in the
human astroglioma cell line U373
The expression and processing of NRG-1 was
described previously in different astroglioma cell lines
[31]. Therefore, we chose the human astroglioma cell
line U373 to examine the relevance of ADAM10 for
NRG-1 shedding. The investigated cell line stably
overexpresses the human neuron specific APP isoform
695 to provide an appropriate control substrate for
a- as well as b- and c-secretases [39,46].
Recently, sixteen different isoforms of NRG-1 gen-
erated by alternative promoter usage, transcription
initiation sites or splicing [4,47,48] have been
described, and a wide variety of these isoforms are
found in brain-derived cell types [49–51]. To charac-
terize the isoforms present in the U373 cell line, we
performed RT-PCR with domain specific primers
[52,53]. Type I as well as type III specific PCR prod-

ucts (schematically shown in Fig. 1A: immunoglobu-
lin-like domain and glycosylation site or cysteine rich
domain sequences) were produced, whereas those
characteristic of the type II Kringle domain coding
region were not detectable (Fig. 1B). Both a- as well
as b-type indicating PCR products were generated.
We amplified the juxtamembrane region coding
sequence with primers independent of a-orb-type
(primers jD_for and TM_rev; Table 1) and subcloned
the resulting DNA fragments into pUC19. Sequencing
analysis revealed that seven out of eight clones were
the a2-type, whereas only one was identified as b2
(for sequences, see Fig. 1B; NM_013964 and
NM_13957). Hence, the predominant NRG-1 isoform
present in U373 cells is the a2-type with respect to
the juxtamembrane region. Because ADAMs such as
ADAM10 cleave their substrates in close proximity to
the membrane, knowledge of this region of the puta-
tive substrate NRG-1 in the investigated cell line was
mandatory.
On the protein level, the NRG-1 antibody against
the C-terminal domain detected a prominent band of
approximately 90 kDA in the lysate of U373 cells
(Fig. 1C). This is consistent with full length NRG-1 in
its glycosylated state [31] for a panel of glioma cells.
Protein bands with a higher molecular weight might
indicate the immature proform and the band with a
reduced molecular weight might represent an incom-
pletely glycosylated intermediate. Additionally,
between 40 and 50 kDa, two C-terminal fragments

were detectable. After serum free incubation of cells
for 4 h, a band of approximately 60 kDa (N-terminal
C. Freese et al. ADAM10 and neuregulin-1 processing
FEBS Journal 276 (2009) 1568–1580 ª 2009 The Authors Journal compilation ª 2009 FEBS 1569
fragment) was detected in cell supernatants using the
pan-NRG-1 antibody against the ectodomain, which
recognizes a- as well as b-isoforms (Fig. 1C). This pro-
tein reveals a slightly lower molecular weight com-
pared to the results obtained by Ritch et al. [31] where
secreted NRG-1 had a molecular mass of 70 kDa.
Because at least two Asn residues and 11 Thr ⁄ Ser resi-
dues were identified as potential sites for N- or O-gly-
cosylation of NRG-1 [54], the deviation in the size of
the soluble protein fragment may depend on different
glycosylation patterns in the investigated cell lines. In
mouse brain membranes, a panel of proteins in the
approximate range of 160–70 kDa was observed
(Fig. 1C), which corresponds to NRG-1 species
described for mouse brain as well as human brain
material [19]. Similar to cell supernatants, the soluble
fraction of mouse brain contained a secreted form of
NRG-1 of 55–60 kDa.
Fig. 1. Isoforms of NRG-1 expressed in the human astroglioma cell line U373 and mouse brain. (A) In general, three major types of
NRG-1 are generated, which all share an EGF-like domain; further variation is achieved through differences in the sequences of the
C-terminal part of the EGF domain (a or b) isoforms, and the juxtamembrane region (e.g. a2orb1 isoforms) and other domains such
as the type II specific Kringle or the type III specific cysteine-rich domain. (B) To identify mRNA species of NRG-1 present in the
human astroglioma cell line U373, RT-PCR was performed. A sample lacking RNA was used as a no template control (NT) and a
GAPDH sequence was amplified for the reaction control. (C) NRG-1 protein expression in U373 cells and mouse brain was analyzed
using the antibody against the C-terminus or against the extracellular domain. Cell lysate or the membrane fraction from mouse brain
was subjected to 4–12% NuPAGE and cell supernatants (medium) or soluble proteins from mouse brain were subjected to 8%

SDS ⁄ PAGE. NRG-1 protein species (FL, full length; NTF, N-terminal fragment; CTF, C-terminal fragment) were visualized after transfer
onto poly(vinylidene difluoride) membrane.
ADAM10 and neuregulin-1 processing C. Freese et al.
1570 FEBS Journal 276 (2009) 1568–1580 ª 2009 The Authors Journal compilation ª 2009 FEBS
Table 1. Primer sequences used for NRG-1 isoform analysis.
Specificity Primer Sequence (5¢-to3¢)
Length of amplificate
(bp)
Juxtamembrane region NRG-jD_for
NRG-TM_rev
TGAAAGACCTTTCAAACCCCTC
GTTTTGCAGTAGGCCACCAC
Approximately 200
(depending on isoform)
Immunoglobulin domain
(type I and II)
NRG-IG_for
NRG-TM_rev
GCCAGGGAAGTCAGAACTTC
GTTTTGCAGTAGGCCACCAC
543
Glycosylation sites (type I) NRG-Glyc_for
NRG-TM_rev
CCACAGAAGGAGCAAATACTTC
GTTTTGCAGTAGGCCACCAC
339
Kringle (type II) NRG-Kringle_for
NRG-Kringle_rev
AGGAGGAGGAGTGGTGCTG
GTCCCCAGCAGCAGCAGTA

239
Cysteine rich domain (type III) NRG-CRD_for
NRG-CRD_rev
GAGGTGAGCCGATGGAGATTTA
CCTCTCAGGCGCTCAGCTTC
219
a NRG-5¢_for
NRG-a_rev
TCTCCGGCGAGATGTCCGA
GCTCCAGTGAATCCAGGTTG
668
b NRG-5¢_for
NRG-Beta_rev
TCTCCGGCGAGATGTCCGA
GGCAGCGATCACCAGTAAAC
677
GAPDH GAPDH_for
GAPDH_rev
GAAGGGCTCATGACCACAGTCCAT
TCATTGTCGTACCAGGAAATGAGCTT
450
Fig. 2. Proteolytical processing of APP and NRG-1 in U373 cells. U373 cells overexpressing human APP695 were incubated with inhibitors
for b-secretase, c-secretase or metalloproteinases, or stimulated with phorbol 12-myristate 13-acetate. Proteolytic processing products of
APP or NRG-1 were detected in culture supernatants after precipitation or in lysed cells with appropriate antibodies. (A) Cells were incubated
with the tripeptidic inhibitor of the b-secretase (25 l
M) and shedded APPs-b or NRG-1 was visualized by western blotting. (B) Full length pro-
tein (FL) or C-terminal membrane tethered fragments (CTF) of either APP or NRG-1 were detected in cell lysates after an incubation period
of 48 h with 2 l
M DAPT. (C) Phorbol 12-myristate 13-acetate (PMA) (1 lM, 4 h) or GM6001 (10 lM, 26 h) were added to the cells to investi-
gate the influence of metalloproteinases on secretion of NRG-1 ectodomain (NTF, N-terminal fragment) in U373 cells. APPs-a served as a

control. All blots show samples from solvent-treated cells in lanes 1 and 3, whereas lanes 2 and 4 show samples from compound-treated
cells. Blots are representative for at least three independently performed experiments per treatment. Quantifications display the mean ± SD;
values from solvent-treated cells were set to 100% (Student’s t-test: ***P < 0.001; **P < 0.01; *P < 0.05).
C. Freese et al. ADAM10 and neuregulin-1 processing
FEBS Journal 276 (2009) 1568–1580 ª 2009 The Authors Journal compilation ª 2009 FEBS 1571
Proteolytical processing of NRG-1 in the human
astroglioma cell line U373
The tripeptidic b-secretase inhibitor II led to an 80%
reduction of soluble b-secretase cleaved APP (APPs-b)
in cell culture supernatants and also diminished signifi-
cantly the 60 kDa soluble NRG-1 in cell conditioned
medium (N-terminal fragment; Fig. 2A). Furthermore,
the c-secretase inhibitor N-[N-(3,5-difluorophenacetyl)-
l-alanyl ]-S-phenylglycine t-butyl ester (DAPT), which
induced accumulation of C-terminal fragments of APP
in cell lysates (C-terminal fragment; Fig. 2B), increased
the NRG-1 C-terminal fragment of approximately
50 kDa six-fold as compared to solvent-treated cells.
These results demonstrate cleavage of NRG-1 in U373
cell line by both b- and c-secretase.
Phorbol 12-myristate 13-acetate, a known inducer of
shedding events, significantly elevated soluble APPs-a,
as well as the soluble N-terminal fragment of NRG-1
in those cells, by 200% and 150% (Fig. 2C). For this
reason, we analyzed metalloproteinase dependent shed-
ding of NRG-1: APPs-a that acted as a control was
reduced to 40% by the broad spectrum metalloprotein-
ase inhibitor GM6001 as compared to solvent-treated
cells, and NRG-1 cleavage also was reduced signifi-
cantly, although to a lower extent (65% of control

cells; Fig. 2C). Therefore, metalloproteinases appear to
be involved in NRG-1 processing in the astrocytoma
cell line U373, as previously described for other cell
lines [28,55].
RNA interference (RNAi)-induced knockdown of
ADAM10 has no influence on NRG-1 shedding
Because GM6001, which was used for inhibitory stud-
ies, is a broad spectrum inhibitor of MMPs as well as
ADAMs, we chose the RNAi approach to analyze in
particular the role of ADAM10 in NRG-1 cleavage. As
a control for unspecific RNAi-induced effects, MMP2
knockdown was examined as well. RNAi treatment tar-
geted against endogenous ADAM10 of the U373 cells
resulted in a 60% reduction of mature ADAM10,
whereas MMP2 targeted oligomers had no influence
(Fig. 3A). The decrease of ADAM10 due to RNAi was
accompanied by a 30% decrease in APPs-a shedding
(Fig. 3B) serving as an internal control. Because APP is
Immature
Mature
Fig. 3. Influence of siRNA mediated knock-
down of ADAM10 on APP or NRG-1
processing in U373 cells. U373 cells were
transfected with a set of RNA oligomers
targeted to ADAM10 (AD). Mock-transfect-
ed cells (C) or cells transfected with RNA
oligomers against MMP2 (M) were used as
controls. Forty-eight hours after transfection,
cells were investigated with respect to
ADAM10 and products of APP or NRG-1

proteolysis. (A) The mature and immature
forms of ADAM10 in the cell lysates were
detected by western blotting and the
mature, catalytically active form of the
enzyme was quantified. (B) APPs-a was
enriched by trichloroacetic acid precipitation
and visualized by the specific antibody
6E10. (C) Secreted (NTF, N-terminal frag-
ment) and membrane bound NRG-1 species
(CTF, C-terminal fragment) were detected in
cell supernatants or lysates. All western
blottings show two sets of independent
samples. Quantifications are based on four
independent experiments and show the
mean ± SD; values from mock-transfected
cells were set to 100% (one-way analysis of
variance ⁄ Bonferroni post hoc test:
***P < 0.001; **P < 0.01).
ADAM10 and neuregulin-1 processing C. Freese et al.
1572 FEBS Journal 276 (2009) 1568–1580 ª 2009 The Authors Journal compilation ª 2009 FEBS
not only a substrate for ADAM10, but also, for exam-
ple, TACE, the absolute effect of ADAM10 knockdown
was small but reached significance. By contrast, for
NRG-1, we observed no alteration of soluble NRG-1 in
cell culture supernatants, as well as for the membrane-
bound protein species. Because of a potential compensa-
tion of reduced NRG-1 cleavage by other secretases, we
cannot exclude the possibility that ADAM10 might
have an effect on proteolytic processing of NRG-1 in
U373 cells but, if this is the case, ADAM10 at least is

not a major sheddase of this protein (Fig. 3C).
In vivo effect of ADAM10 on NRG-1 proteolysis
Because ADAM10 was not implicated in the shedding
of distinct NRG-1 isoforms of cultured human astro-
glioma cells (a2 and b2; Fig. 1B), we analyzed NRG-1
processing in ADAM10 overexpressing mice to take
into account all of the expressed isoforms. Two trans-
genic mouse lines with different expression levels of
ADAM10 (moderate, ADAM10mo; high, ADAM10hi)
and a mouse line transgenic for a dominant negative
ADAM10 mutant (ADAM10dn) were included in this
investigation. All mouse lines have been examined in
detail elsewhere with respect to APP processing, learn-
ing and behaviour [40,41,56]. The expression of the
proteinase itself is illustrated in Fig. 4A (lower part).
In soluble protein fractions of brains derived from the
three transgenic lines, the amount of the N-terminal
fragment of NRG-1 (approximately 60 kDa; Fig. 4)
was not changed compared to the wild-type. Addition-
ally, neither full length NRG-1, nor C-terminal frag-
ments in the brain membrane fraction were influenced
by an altered ADAM10 amount or activity (Fig. 4).
We therefore conclude that, in vivo, the proteolytic
processing of NRG-1 does not depend on the a-secre-
tase ADAM10.
For further confirmation of these findings, we exam-
ined the myelination of peripheral nerves in ADAM10
transgenic mice and mice overexpressing dominant
negative ADAM10. Because myelination strongly
depends on NRG-1-ErbB signalling of Schwann cells

and neurones [57], any relevant change of this pathway
induced by altered ADAM10 activity should be obser-
vable as a physiological consequence. Again, the
ADAM10 transgenes remained without effect in
all investigated mouse lines (Fig. 5A). G-ratios of
ADAM10mo as well as of ADAM10dn mice at
postnatal day 17 were identical to nontransgenic litter-
mates. Furthermore, Akt-phosphorylation, which also
Fig. 4. Processing products of NRG-1 in ADAM10 transgenic mice. Soluble and membrane tethered fractions of NRG-1 from brains of
ADAM10mo, ADAM10hi and ADAM10dn mice were detected by western blotting with antibodies against the N- (NT) or the C-terminus (CT)
of the protein. Nontransgenic littermates (Wt, wild-type) were used as controls. Each western blot for NRG-1 shows samples from two indi-
viduals: lanes 1 and 3 are from wild-type animals and lanes 2 and 4 are from transgenic mice. For ADAM10 (detection by HA-antibody), one
exemplary blot from the brain membrane fraction of four individuals is shown. The proform of the proteinase is indicated by a black arrow
head and the catalytically active form is indicated by a grey arrow head. (B) Protein bands with respect to shedded (N-terminal fragment; 60
kDa) or one exemplary C-terminal fragment (50 kDa) of NRG-1 were quantified and values from wild-type mice were set to 100% (mean ±
SEM; n = 6 for each mouse line, P > 0.05).
C. Freese et al. ADAM10 and neuregulin-1 processing
FEBS Journal 276 (2009) 1568–1580 ª 2009 The Authors Journal compilation ª 2009 FEBS 1573
Fig. 5. ADAM10 transgenic mice display no disturbance in peripheral myelination. (A) Sciatic nerves of ADAM10mo, ADAM10dn and wild-
type (Wt) mice (postnatal day 17) were analyzed for myelin sheath thickness by electron microscopy. Two exemplary microscopic images
are shown for each mouse line. G-ratios were evaluated taking into account at least 350 individual axons per group (n = 3 animals for each
group). (B) Myelination was analyzed in adult, aged ADAM10hi mice (15–17 months) in analogy to (A). Two electron microscopy images at
two different magnifications (see scale bars) of transgenic mice and age-matched control mice are shown. Tomacula-like structures are
indicated by black arrows.
ADAM10 and neuregulin-1 processing C. Freese et al.
1574 FEBS Journal 276 (2009) 1568–1580 ª 2009 The Authors Journal compilation ª 2009 FEBS
is partly controlled by NRG-1 signaling [31,58,59], was
unaffected in both mouse lines (Fig. 6). In adult mice
with a high expression level of ADAM10
(ADAM10hi), G-ratios were also unaltered (Fig. 5B),

but tomacula-like structures (local myelin thickenings
[60]) were observed. Additionally, in the mouse line
with higher ADAM10 expression (ADAM10hi), Akt-
phosphorylation was significantly reduced to 40%
compared to wild-type mice. This probably reflects
effects that do not depend on NRG-1 cleavage.
Discussion
The data obtained in the present study for the human
astroglioma cell line U373 clearly reveal BACE-1 and
c-secretase dependent shedding of the endogenous
ErbB receptor ligand, which we identified predomi-
nantly as type a2-NRG-1 and, to a lesser extent, as
the b2 isoform. Additionally, GM6001, a broad spec-
trum metalloproteinase inhibitor, was able to reduce
NRG-1 shedding but a specific knockdown of
ADAM10 by RNAi remained without any effect
within the cellular system. Therefore, the present study
demonstrates that ADAM10 is not a major sheddase
of neuregulin-1 and enhancement of ADAM10 will
probably have no side effects due to NRG-1 cleavage.
Because catalytically active ADAM10 is found on
the plasma membrane [38] and neuregulin-1b1 cleav-
age, for example, is restricted to the Golgi apparatus
[28], it is plausible that distinct localization of
ADAM10 and NRG-1 might inhibit a functional sub-
strate–proteinase interaction. Furthermore, NRG-1 is
mainly found in cholesterol rich lipid rafts [61,62],
favouring its role as a BACE-1 substrate, whereas
ADAM10 and its catalytic activity (at least for APP)
were shown to be localized in cholesterol-poor nonraft

regions of the membrane [39]. Nevertheless, a possible
in vivo relevance of ADAM10 to NRG-1 shedding
required investigation due to the fact that NRG-1 pro-
teolysis also depends on, for example, electric stimula-
tion of cells [8], which might be accompanied by
translocation within the cell. Furthermore, the animal
model offers a more complex representation because of
the wide variety of cells that express NRG-1 and
which might interact.
Reconstitution experiments with transfection of
ADAM10 in ADAM17) ⁄ ) embryonic mouse fibro-
blasts [55] suggested only a minor influence of
ADAM10 on neuregulin-1 shedding, but any positive
proof in the living animal was still missing. Therefore,
we investigated neuregulin-1 processing in mice with
postnatal expression of ADAM10 or its dominant neg-
ative variant. The Thy.1-promoter driven expression of
both ADAM10-constructs [40] occurs at postnatal
day 1 (data not shown). Thy.1-based expression in
general is predominantly found in postmitotic neuro-
nes of the perinatal period, but also occurs in dorsal
root ganglia and in spinal cord [63]. Hence, the animal
model is sufficient to study early ontogenetic phenom-
ena after birth without disturbances due to impeded
embryonic development in the central or peripheral
nervous systems.
In a recent study, the age-dependency of NRG-1
cleavage by BACE-1 was demonstrated [64]. Although
the accumulation of full length neuregulin-1 in
BACE) ⁄ ) mice aged 15 days confirmed previous data

[29,34], mice at postnatal day 30 or even older
(2 years) showed no abnormalities with respect to neu-
regulin-1 processing. In the case of ADAM10, investi-
gations of adult mice moderately overexpressing
Fig. 6. Akt-phosphorylation in ADAM10 transgenic mice. (A) Total-
Akt and phospho-Akt were detected by western blotting in soluble
fractions of brains from ADAM10mo, ADAM10hi and ADAM10dn
mice. Nontransgenic littermates (Wt, wild-type) were used as con-
trols. (B) Phospho-Akt was normalized by total-Akt and quotients
from wild-type mice were set to 100%. Values represent
the mean ± SEM (n = 4 for each mouse line; one-way analysis of
variance ⁄ Bonferroni post hoc test: **P < 0.01).
C. Freese et al. ADAM10 and neuregulin-1 processing
FEBS Journal 276 (2009) 1568–1580 ª 2009 The Authors Journal compilation ª 2009 FEBS 1575
ADAM10 or its dominant negative variant resulted in
totally unchanged amounts of NRG-1 processing
products.
Therefore, the influence of ADAM10 on NRG-1 was
additionally analyzed in young mice (postnatal day 17)
by the status of peripheral nerve ensheathment. In the
second postnatal week, myelination is almost finished in
mice (central nervous system [65]; peripheral nervous
system [66]); therefore, alterations should be apparent.
However, neither moderate ADAM10 overexpressing
mice, nor mice with a restriction of enzyme activity by
dominant negative ADAM10, revealed differences in
axon myelination parameters compared to wild-type
littermates at postnatal day 17.
Surprisingly, adult mice with high levels of
ADAM10 overexpression showed myelin infoldings

(tomacula-like structures). This observation has not
been made in the context of reduced or enhanced
NRG-1 signalling in mice [67]. We therefore suggest
that mechanisms beside NRG-1 signal transduction
might be responsible for the neuropathological pheno-
type. It will be interesting to analyze these observa-
tions in future studies.
Additionally, Akt phosphorylation, a consequence
of NRG-1-ErbB signalling [31,59], was unaltered by
moderate overexpression or by inhibiting ADAM10
activity by its negative mutant form. However, mice
with high overexpression of ADAM10 showed a strong
decrease of phosphorylated Akt compared to non-
transgenic mice. This observation may relate to recent
findings demonstrating that a high level of ADAM10
overexpression in the mouse increases susceptibility to
kainate-induced seizures and neuronal damage [56],
whereas the neuroprotective properties of ADAM10
were only evident in mice with APP overexpression.
In conclusion, ADAM10 was excluded both in cell
culture and in the animal model as a major candidate
secretase for neuregulin-1 shedding. We cannot rule
out that other secretases, such as TACE or ADAM19,
which were identified formerly as NRG-1 sheddases
[28,30,55], compensate for the lack of ADAM10 in
RNAi-treated cells or animals with overexpression of
the dominant negative mutant. In breast cancer cells,
ADAM10 was described to mediate the shedding of
the receptor ErbB2 [68]; therefore, an influence on
NRG-1-ErbB signalling could in principal have also

occurred by ErbB2 cleavage in our transgenic mice.
However, because we did not observe an influence on
myelination in ADAM10 transgenic mice, this observa-
tion might be restricted to tumour cells.
We also cannot exclude that, in non-neuronal tis-
sue, embryonic development or pathological stages
ADAM10 itself, or cleavage products of its other sub-
strates, might be involved in NRG-1-ErbB cross-talk.
In summary, however, we present evidence demonstrat-
ing that, in the healthy early postnatal and adult
mouse, moderate alterations in the amount of
ADAM10 do not interfere with neuregulin-1 signalling.
Accordingly, ADAM10 will have no impact on down-
stream physiological functions such as nerve remyelina-
tion or the schizophrenia-resembling psychiatric
changes as observed for BACE-1 knockout mice
[34,69]. The results obtained in the present study there-
fore suggest that a moderate upregulation of ADAM10
expression and its a-secretase activity with a preventive
or therapeutical intention is not impaired by side effects
resulting from the NRG-1-ErbB signalling network.
Experimental procedures
Antibodies, inhibitors and RNAi oligomers
The primary antibodies used were: 6E10 for the detection
of APPs-a (Senetek, St Louis, MO, USA; dilution
1 : 1000), anti-neuregulin-1 (H-210; dilution 1 : 200) for the
detection of secreted NRG-1 fragments, anti-neuregulin-
1a ⁄ b1 ⁄ 2 (C-20; dilution 1 : 500) (both Santa Cruz Biotech-
nology, Santa Cruz, CA, USA) for the detection of
membrane bound NRG-1, anti-ADAM10 (Chemicon,

Temecula, CA, USA; dilution 1 : 1000) for the detection of
the proteinase in cells and 6687 (C. Haass, LMU Munich,
Germany) for the detection of full length APP and C-termi-
nal protein fragments. Anti-P-Akt and anti-total Akt were
purchased from Cell Signaling [PhosphoPlus Akt (Ser473)
Antibody Kit; Cell Signaling, Danvers, MA, USA]. Overex-
pressed ADAM10 in mouse brain membranes was visual-
ized by HA-antibody Y-11 (Santa-Cruz Biotechnology).
The secondary antibodies were coupled to alkaline phos-
phatase (Tropix, Bedford, MA, USA; dilution 1 : 10000) or
horseradish peroxidase (Pierce, Rockford, IL, USA;
dilution 1 : 3000) and were used in combination with their
substrates CDP-Star (Tropix) or SuperSignalECL (Pierce).
The b-secretase-inhibitor II (Calbiochem, Bad Soden,
Germany) was applied at a concentration of 25 lm and the
c-secretase inhibitor DAPT (B. Schmitt, Clemens Scho
¨
pf-
Institute of Organic Chemistry and Biochemistry, Tech-
nische Universita
¨
t Darmstadt, Germany) was applied at a
concentration of 2 lm . GM6001 (Calbiochem, San Diego,
CA, USA) was used at a final concentration of 10 lm and
phorbol 12-myristate 13-acetate (Sigma, Deisenhofen, Ger-
many) was used at a concentration of 1 lm. All substances
were dissolved in dimethylsulfoxide as stock solutions.
For the RNAi experiments, the Stealth RNAis ADAM10
HSS165, HSS166, HSS167 and MMP2 HSS106612,
HSS106613, HSS106614 (Invitrogen, Karlsruhe, Germany)

were used. Transfections were performed with Opti-MEM
and Lipofectamine2000 (Invitrogen).
ADAM10 and neuregulin-1 processing C. Freese et al.
1576 FEBS Journal 276 (2009) 1568–1580 ª 2009 The Authors Journal compilation ª 2009 FEBS
RNA preparation and RT-PCR
The RNA of U373 cells was isolated by using confluent 6 cm
culture plates and the RNA isolation kit with on-column
DNA digestion as recommended in the manufacturer’s pro-
tocol (Macherey-Nagel, Du
¨
ren, Germany). Four hundred
nanograms of RNA were reverse transcribed in a 20 lL reac-
tion volume by the reverse-it-RT-PCR-kit from ABgene
(Hamburg, Germany) with intron-spanning specific primers
(0.2 lm each). Amplificates were analyzed on 1% agarose
gels and GAPDH amplification served as a control for the
RT-PCR reaction and PCR conditions. Primer sequences
and the amplificate length are provided in Table 1.
The amplificates from RT-PCR with primers NRG-
jD_for and NRG-TM_rev were ligated into pUC19 (Fer-
mentas, St Leon-Rot, Germany) and plasmid DNA from
eight positive clones (identified by blue–white selection) was
sequence analyzed with M13 universal primer.
Preparation of mouse brain samples
The generation of transgenic mice has been described
previously [40]. Seven- to 10-week-old mice were sacrificed,
the brains were dissected and stored on dry ice. Ice-cold
Tris buffer (20 m m Tris ⁄ HCl, pH 8.5) containing proteinase
inhibitors (Inhibitor Complete Mini; Roche Diagnostics
Corp., Mannheim, Germany) was added and tissue was

homogenized in a tissue lyser (Eppendorf, Hamburg, Ger-
many) with a frequency of 20 Hz for 2 min. The superna-
tants resulting from centrifugation at 13 500 g for 1.75 h
were used for the detection and quantification of soluble
NRG-1. NRG-1 membrane bound full length protein and
membrane bound NRG-1 fragments, as well as the protein-
ase ADAM10 itself, were detected in the membrane frac-
tions prepared from centrifugation pellets.
For total-Akt and phospho-Akt detection, brain hemi-
spheres were homogenized in lysis buffer supplemented with
additional phosphatase inhibitors (2.5 mm Na-pyrophos-
phate, 1 mm b-glycerophosphate and 1 mm Na
3
VO
4
) and
soluble proteins were isolated from membrane fractions by
centrifugation at 20 800 g for 20 min.
Cell culture, treatment with inhibitors and RNAi
silencing
U373 cells overexpressing human wild-type APP were main-
tained in MEM (Sigma, Taufkirchen, Germany) supple-
mented with 10% fetal bovine serum, 1% sodium pyruvate
and 1% glutamine.
To inhibit b-secretase or metalloproteinases, cells were
pretreated with the appropriate inhibitor ( b-secretase-inhibi-
tor II or GM6001) for 22 h. Then, the serum containing
culture medium was removed and medium without serum
supplemented with fatty acid free BSA (1 mg ÆmL
)1

) and
fresh inhibitor was added for an additional 4 h. Phorbol
12-myristate 13-acetate-induced shedding was performed
for 4 h in serum free BSA supplemented medium. For inhi-
bition of c-secretase, cells were treated with DAPT for 48 h
in culture medium.
For RNAi experiments, cells were transfected with
750 pmol of RNAi oligomers (250 pmol each) in six-well
plates. After 5 h of transfection, the medium was replaced
by culture medium. After 44 h, cells were covered with
serum-free medium and incubated for 4 h for collection of
secreted proteins and cell lysates.
Western blotting
Proteins of cell culture supernatants were precipitated with
trichloroacetic acid and normalized by the protein content
of the cell lysates. Adequate amounts of soluble or mem-
brane tethered proteins were separated on 8% SDS-gels or
4–12% Bis–Tris NuPAGE gels (Invitrogen) and blotted on
a poly(vinylidene difluoride) membrane or nitrocellulose
(total-Akt and phospho-Akt). Proteins were then detected
with the appropriate primary antibodies. Chemiluminescent
signals from alkaline phosphatase or horseradish peroxidase
coupled secondary antibodies were visualized with a
charge-coupled device camera and the software versa doc
(Bio-Rad, Munich, Germany) and were quantified with
aida 3.5 (Raytest, Straubenhardt, Germany).
Electron microscopy and G-ratio determination
Seventeen-day-old or adult transgenic mice (15–17 months
old) and nontransgenic littermates were perfused with
NaCl ⁄ P

i
containing 60 lgÆmL
)1
heparin followed by 2.5%
glutaraldehyde ⁄ 4% parafomaldehyde in 0.1 m phosphate
buffer. Afterwards, sciatic nerves were removed, postfixed
and contrasted with osmium tetroxide and processed for
electron microscopy [70]. biovision software (Soft Imaging
System GmbH, Mu
¨
nster, Germany) was used for determi-
nation of the G-ratio by measuring the inner and outer
myelinated fibres.
All animal procedures were performed according to the
German guidelines for the care and the use of laboratory
animals and in accordance with the European Communities
Council Directive of 24 November 1986 (86/609/EEC).
Acknowledgements
We thank C. Griffel (MDC, Berlin) for excellent tech-
nical support in the analysis of sciatic nerve myelina-
tion; A. Schro
¨
der (ZVTE, Mainz) for coordination of
animal husbandry and M. Willem (LMU, Munich) for
fruitful discussion. This work was supported by
grants from the DFG priority program 1040 (to F.F.)
C. Freese et al. ADAM10 and neuregulin-1 processing
FEBS Journal 276 (2009) 1568–1580 ª 2009 The Authors Journal compilation ª 2009 FEBS 1577
and from the NGFN integrated consortium ‘Gene
Identification and Functional analyses in Alzheimer’s

disease’ funded by the Federal Ministry of Education
and Research (to A.N.G.).
References
1 Buonanno A & Fischbach GD (2001) Neuregulin and
ErbB receptor signaling pathways in the nervous sys-
tem. Curr Opin Neurobiol 11, 287–296.
2 Esper RM, Pankonin MS & Loeb JA (2006) Neuregu-
lins: versatile growth and differentiation factors in ner-
vous system development and human disease. Brain Res
Rev 51, 161–175.
3 Falls DL (2003) Neuregulins: functions, forms, and sig-
naling strategies. Exp Cell Res 284, 14–30.
4 Steinthorsdottir V, Stefansson H, Ghosh S, Birgisdottir
B, Bjornsdottir S, Fasquel AC, Olafsson O, Stefansson
K & Gulcher JR (2004) Multiple novel transcription ini-
tiation sites for NRG1. Gene 342, 97–105.
5 Garratt AN, Ozcelik C & Birchmeier C (2003) ErbB2
pathways in heart and neural diseases. Trends Cardio-
vasc Med 13, 80–86.
6 Negro A, Brar BK & Lee KF (2004) Essential roles of
Her2 ⁄ erbB2 in cardiac development and function.
Recent Prog Horm Res 59, 1–12.
7 Britsch S (2007) The neuregulin-I ⁄ ErbB signaling sys-
tem in development and disease. Adv Anat Embryol Cell
Biol 190, 1–65.
8 Ozaki M, Sasner M, Yano R, Lu HS & Buonanno A
(1997) Neuregulin-beta induces expression of an
NMDA-receptor subunit. Nature 390, 691–694.
9 Roysommuti S, Carroll SL & Wyss JM (2003) Neuregu-
lin-1beta modulates in vivo entorhinal-hippocampal

synaptic transmission in adult rats. Neuroscience 121,
779–785.
10 Rieff HI, Raetzman LT, Sapp DW, Yeh HH, Siegel RE
& Corfas G (1999) Neuregulin induces GABA(A) recep-
tor subunit expression and neurite outgrowth in cerebel-
lar granule cells. J Neurosci 19 , 10757–10766.
11 Liu Y, Ford B, Mann MA & Fischbach GD (2001)
Neuregulins increase alpha7 nicotinic acetylcholine
receptors and enhance excitatory synaptic transmission
in GABAergic interneurons of the hippocampus. J Neu-
rosci 21, 5660–5669.
12 Yang X, Kuo Y, Devay P, Yu C & Role L (1998) A
cysteine-rich isoform of neuregulin controls the level of
expression of neuronal nicotinic receptor channels
during synaptogenesis. Neuron 20, 255–270.
13 Huang YZ, Won S, Ali DW, Wang Q, Tanowitz M,
Du QS, Pelkey KA, Yang DJ, Xiong WC, Salter MW
et al. (2000) Regulation of neuregulin signaling by PSD-
95 interacting with ErbB4 at CNS synapses. Neuron 26,
443–455.
14 Dong Z, Brennan A, Liu N, Yarden Y, Lefkowitz G,
Mirsky R & Jessen KR (1995) Neu differentiation fac-
tor is a neuron-glia signal and regulates survival, prolif-
eration, and maturation of rat Schwann cell precursors.
Neuron 15, 585–596.
15 Lai C (2005) Peripheral glia: Schwann cells in motion.
Curr Biol 15, R332–R334.
16 Edwards JM & Bottenstein JE (2006) Neuregulin 1
growth factors regulate proliferation but not apoptosis
of a CNS neuronal progenitor cell line. Brain Res 1108,

63–75.
17 Kerber G, Streif R, Schwaiger FW, Kreutzberg GW &
Hager G (2003) Neuregulin-1 isoforms are differentially
expressed in the intact and regenerating adult rat ner-
vous system. J Mol Neurosci 21, 149–165.
18 Law AJ, Shannon WC, Hyde TM, Kleinman JE & Harri-
son PJ (2004) Neuregulin-1 (NRG-1) mRNA and protein
in the adult human brain. Neuroscience 127, 125–136.
19 Chaudhury AR, Gerecke KM, Wyss JM, Morgan DG,
Gordon MN & Carroll SL (2003) Neuregulin-1 and
erbB4 immunoreactivity is associated with neuritic pla-
ques in Alzheimer disease brain and in a transgenic
model of Alzheimer disease. J Neuropathol Exp Neurol
62, 42–54.
20 Garcia RA, Vasudevan K & Buonanno A (2000) The
neuregulin receptor ErbB-4 interacts with PDZ-contain-
ing proteins at neuronal synapses. Proc Natl Acad Sci
USA 97, 3596–3601.
21 Gerecke KM, Wyss JM & Carroll SL (2004) Neuregu-
lin-1beta induces neurite extension and arborization in
cultured hippocampal neurons. Mol Cell Neurosci 27,
379–393.
22 Kwon OB, Longart M, Vullhorst D, Hoffman DA &
Buonanno A (2005) Neuregulin-1 reverses long-term
potentiation at CA1 hippocampal synapses. J Neurosci
25, 9378–9383.
23 Stefansson H, Sigurdsson E, Steinthorsdottir V, Bjorns-
dottir S, Sigmundsson T, Ghosh S, Brynjolfsson J,
Gunnarsdottir S, Ivarsson O, Chou TT et al. (2002)
Neuregulin 1 and susceptibility to schizophrenia. Am J

Hum Genet 71, 877–892.
24 Williams NM, Preece A, Spurlock G, Norton N, Wil-
liams HJ, Zammit S, O’Donovan MC & Owen MJ
(2003) Support for genetic variation in neuregulin 1 and
susceptibility to schizophrenia. Mol Psychiatry 8, 485–
487.
25 Hashimoto R, Straub RE, Weickert CS, Hyde TM,
Kleinman JE & Weinberger DR (2004) Expression anal-
ysis of neuregulin-1 in the dorsolateral prefrontal cortex
in schizophrenia. Mol Psychiatry 9, 299–307.
26 Cannella B, Pitt D, Marchionni M & Raine CS (1999)
Neuregulin and erbB receptor expression in normal and
diseased human white matter. J Neuroimmunol 100,
233–242.
ADAM10 and neuregulin-1 processing C. Freese et al.
1578 FEBS Journal 276 (2009) 1568–1580 ª 2009 The Authors Journal compilation ª 2009 FEBS
27 Viehover A, Miller RH, Park SK, Fischbach G & Vart-
anian T (2001) Neuregulin: an oligodendrocyte growth
factor absent in active multiple sclerosis lesions. Dev
Neurosci 23, 377–386.
28 Yokozeki T, Wakatsuki S, Hatsuzawa K, Black RA,
Wada I & Sehara-Fujisawa A (2007) Meltrin beta
(ADAM19) mediates ectodomain shedding of Neuregu-
lin beta1 in the Golgi apparatus: fluorescence correla-
tion spectroscopic observation of the dynamics of
ectodomain shedding in living cells. Genes Cells 12,
329–343.
29 Willem M, Garratt AN, Novak B, Citron M, Kauf-
mann S, Rittger A, DeStrooper B, Saftig P, Birchmeier
C & Haass C (2006) Control of peripheral nerve myeli-

nation by the beta-secretase BACE1. Science 314, 664–
666.
30 Montero JC, Yuste L, az-Rodriguez E, Esparis-Ogando
A & Pandiella A (2000) Differential shedding of trans-
membrane neuregulin isoforms by the tumor necrosis
factor-alpha-converting enzyme. Mol Cell Neurosci 16,
631–648.
31 Ritch PS, Carroll SL & Sontheimer H (2005) Neuregu-
lin-1 enhances survival of human astrocytic glioma cells.
Glia 51, 217–228.
32 Bao J, Wolpowitz D, Role LW & Talmage DA (2003)
Back signaling by the Nrg-1 intracellular domain. J Cell
Biol 161, 1133–1141.
33 Zhang Z, Prentiss L, Heitzman D, Stahl RC, DiPino Jr
F & Carey DJ (2006) Neuregulin isoforms in dorsal
root ganglion neurons: effects of the cytoplasmic
domain on localization and membrane shedding of
Nrg-1 type I. J Neurosci Res 84, 1–12.
34 Hu X, Hicks CW, He W, Wong P, Macklin WB, Trapp
BD & Yan R (2006) Bace1 modulates myelination in
the central and peripheral nervous system. Nat Neurosci
9, 1520–1525.
35 Shirakabe K, Wakatsuki S, Kurisaki T & Fujisawa-
Sehara A (2001) Roles of Meltrin beta ⁄ ADAM19 in
the processing of neuregulin. J Biol Chem 276, 9352–
9358.
36 Walsh DM, Minogue AM, Sala FC, Fadeeva JV, Wasco
W & Selkoe DJ (2007) The APP family of proteins: simi-
larities and differences. Biochem Soc Trans 35, 416–420.
37 Schillo S, Pejovic V, Hunzinger C, Hansen T, Pozna-

novic S, Kriegsmann J, Schmidt WJ & Schrattenholz A
(2005) Integrative proteomics: functional and molecular
characterization of a particular glutamate-related neu-
regulin isoform. J Proteome Res 4, 900–908.
38 Lammich S, Kojro E, Postina R, Gilbert S, Pfeiffer R,
Jasionowski M, Haass C & Fahrenholz F (1999) Consti-
tutive and regulated alpha-secretase cleavage of
Alzheimer’s amyloid precursor protein by a disintegrin
metalloprotease. Proc Natl Acad Sci USA 96, 3922–3927.
39 Kojro E, Gimpl G, Lammich S, Marz W & Fahrenholz
F (2001) Low cholesterol stimulates the nonamyloido-
genic pathway by its effect on the alpha-secretase
ADAM 10. Proc Natl Acad Sci USA 98, 5815–5820.
40 Postina R, Schroeder A, Dewachter I, Bohl J, Schmitt
U, Kojro E, Prinzen C, Endres K, Hiemke C, Blessing
M et al. (2004) A disintegrin-metalloproteinase prevents
amyloid plaque formation and hippocampal defects in
an Alzheimer disease mouse model. J Clin Invest 113,
1456–1464.
41 Schmitt U, Hiemke C, Fahrenholz F & Schroeder A
(2006) Over-expression of two different forms of the
alpha-secretase ADAM10 affects learning and memory
in mice. Behav Brain Res 175, 278–284.
42 Bell KF, Ducatenzeiler A, Ribeiro-da-Silva A, Duff K,
Bennett DA & Cuello AC (2006) The amyloid pathol-
ogy progresses in a neurotransmitter-specific manner.
Neurobiol Aging 27, 1644–1657.
43 Meyer D & Birchmeier C (1995) Multiple essential func-
tions of neuregulin in development. Nature
378, 386–390.

44 Kramer R, Bucay N, Kane DJ, Martin LE, Tarpley JE
& Theill LE (1996) Neuregulins with an Ig-like domain
are essential for mouse myocardial and neuronal devel-
opment. Proc Natl Acad Sci USA 93, 4833–4838.
45 Hartmann D, de Strooper B, Serneels L, Craessaerts K,
Herreman A, Annaert W, Umans L, Lubke T, Lena
IA, von Figura K et al. (2002) The disintegrin ⁄ metallo-
protease ADAM 10 is essential for Notch signalling but
not for alpha-secretase activity in fibroblasts. Hum Mol
Genet 11, 2615–2624.
46 Endres K, Postina R, Schroeder A, Mueller U &
Fahrenholz F (2005) Shedding of the amyloid precursor
protein-like protein APLP2 by disintegrin-metallopro-
teinases. FEBS J 272, 5808–5820.
47 Tan W, Wang Y, Gold B, Chen J, Dean M, Harrison
PJ, Weinberger DR & Law AJ (2007) Molecular clon-
ing of a brain-specific, developmentally regulated
neuregulin 1 (NRG1) isoform and identification of a
functional promoter variant associated with schizophre-
nia. J Biol Chem 282, 24343–24351.
48 Peles E & Yarden Y (1993) Neu and its ligands: from
an oncogene to neural factors. Bioessays 15, 815–824.
49 Lacroix-Fralish ML, Tawfik VL, Nutile-McMenemy N,
Harris BT & Deleo JA (2006) Differential regulation of
neuregulin 1 expression by progesterone in astrocytes
and neurons. Neuron Glia Biol 2, 227–234.
50 Tokita Y, Keino H, Matsui F, Aono S, Ishiguro H,
Higashiyama S & Oohira A (2001) Regulation of neu-
regulin expression in the injured rat brain and cultured
astrocytes. J Neurosci 21, 1257–1264.

51 Thompson RJ, Roberts B, Alexander CL, Williams SK
& Barnett SC (2000) Comparison of neuregulin-1
expression in olfactory ensheathing cells, Schwann cells
and astrocytes. J Neurosci Res 61, 172–185.
52 Oberto M, Soncin I, Bovolin P, Voyron S, De BM,
Dati C, Fasolo A & Perroteau I (2001) ErbB-4 and neu-
regulin expression in the adult mouse olfactory bulb
C. Freese et al. ADAM10 and neuregulin-1 processing
FEBS Journal 276 (2009) 1568–1580 ª 2009 The Authors Journal compilation ª 2009 FEBS 1579
after peripheral denervation. Eur J Neurosci 14, 513–
521.
53 Cote GM, Miller TA, Lebrasseur NK, Kuramochi Y &
Sawyer DB (2005) Neuregulin-1alpha and beta isoform
expression in cardiac microvascular endothelial cells
and function in cardiac myocytes in vitro. Exp Cell Res
311, 135–146.
54 Lu HS, Chang D, Philo JS, Zhang K, Narhi LO, Liu
N, Zhang M, Sun J, Wen J & Yanagihara D (1995)
Studies on the structure and function of glycosylated
and nonglycosylated neu differentiation factors.
Similarities and differences of the alpha and beta
isoforms. J Biol Chem 270, 4784–4791.
55 Horiuchi K, Zhou HM, Kelly K, Manova K & Blobel
CP (2005) Evaluation of the contributions of ADAMs
9, 12, 15, 17, and 19 to heart development and
ectodomain shedding of neuregulins beta 1 and beta 2.
Dev Biol 283, 459–471.
56 Clement AB, Hanstein R, Schroder A, Nagel H, Endres
K, Fahrenholz F & Behl C (2008) Effects of neuron-
specific ADAM10 modulation in an in vivo model of

acute excytotoxic stress. Neuroscience 152, 459–468.
57 Nave KA & Salzer JL (2006) Axonal regulation of myeli-
nation by neuregulin 1. Curr Opin Neurobiol 16, 492–500.
58 Hellyer NJ, Kim MS & Koland JG (2001) Heregulin-
dependent activation of phosphoinositide 3-kinase and
Akt via the ErbB2 ⁄ ErbB3 co-receptor. J Biol Chem
276, 42153–42161.
59 Monje PV, Bunge MB & Wood PM (2006) Cyclic AMP
synergistically enhances neuregulin-dependent ERK and
Akt activation and cell cycle progression in Schwann
cells. Glia 53, 649–659.
60 Adlkofer K, Frei R, Neuberg DH, Zielasek J, Toyka
KV & Suter U (1997) Heterozygous peripheral myelin
protein 22-deficient mice are affected by a progressive
demyelinating tomaculous neuropathy. J Neurosci 17,
4662–4671.
61 Frenzel KE & Falls DL (2001) Neuregulin-1 proteins in
rat brain and transfected cells are localized to lipid
rafts. J Neurochem 77, 1–12.
62 Wakatsuki S, Kurisaki T & Sehara-Fujisawa A (2004)
Lipid rafts identified as locations of ectodomain
shedding mediated by Meltrin beta ⁄ ADAM19. J Neuro-
chem 89, 119–123.
63 Campsall KD, Mazerolle CJ, De RY, Kothary R &
Wallace VA (2002) Characterization of transgene
expression and Cre recombinase activity in a panel of
Thy-1 promoter-Cre transgenic mice. Dev Dyn 224,
135–143.
64 Sankaranarayanan S, Price EA, Wu G, Crouthamel
MC, Shi XP, Tugusheva K, Tyler KX, Kahana J, Ellis

J, Jin L et al. (2008) In vivo beta-secretase 1 inhibition
leads to brain Abeta lowering and increased alpha-sec-
retase processing of amyloid precursor protein without
effect on neuregulin-1. J Pharmacol Exp Ther 324,
957–969.
65 Foran DR & Peterson AC (1992) Myelin acquisition
in the central nervous system of the mouse revealed
by an MBP-Lac Z transgene. J Neurosci 12,
4890–4897.
66 Low PA (1976) Hereditary hypertrophic neuropathy
in the trembler mouse. Part 2. Histopathological
studies: electron microscopy. J Neurol Sci 30,
343–368.
67 Michailov GV, Sereda MW, Brinkmann BG, Fischer
TM, Haug B, Birchmeier C, Role L, Lai C, Schwab
MH & Nave KA (2004) Axonal neuregulin-1
regulates myelin sheath thickness. Science 304,
700–703.
68 Liu PC, Liu X, Li Y, Covington M, Wynn R, Huber
R, Hillman M, Yang G, Ellis D, Marando C et al.
(2006) Identification of ADAM10 as a major source of
HER2 ectodomain sheddase activity in HER2
overexpressing breast cancer cells. Cancer Biol Ther 5,
657–664.
69 Savonenko AV, Melnikova T, Laird FM, Stewart KA,
Price DL & Wong PC (2008) Alteration of BACE1-
dependent NRG1 ⁄ ErbB4 signaling and schizophrenia-
like phenotypes in BACE1-null mice. Proc Natl Acad
Sci USA 105, 5585–5590.
70 Garratt AN, Voiculescu O, Topilko P, Charnay P &

Birchmeier C (2000) A dual role of erbB2 in myelina-
tion and in expansion of the schwann cell precursor
pool. J Cell Biol 148, 1035–1046.
ADAM10 and neuregulin-1 processing C. Freese et al.
1580 FEBS Journal 276 (2009) 1568–1580 ª 2009 The Authors Journal compilation ª 2009 FEBS