Báo cáo khoa học: Concerted mutation of Phe residues belonging to the b-dystroglycan ectodomain strongly inhibits the interaction with a-dystroglycan in vitro pot

Concerted mutation of Phe residues belonging
to the b-dystroglycan ectodomain strongly inhibits the
interaction with a-dystroglycan in vitro
Manuela Bozzi1,*, Francesca Sciandra2,*, Lorenzo Ferri2, Paola Torreri3, Ernesto Pavoni2,
Tamara C. Petrucci3, Bruno Giardina2 and Andrea Brancaccio2
`
1 Istituto di Biochimica e Biochimica Clinica, Universita Cattolica del Sacro Cuore, Rome, Italy
`
2 CNR, Istituto di Chimica del Riconoscimento Molecolare c ⁄ o Istituto di Biochimica e Biochimica Clinica, Universita Cattolica del Sacro
Cuore, Rome, Italy
`
3 Dipartimento di Biologia Cellulare e Neuroscienze, Istituto Superiore di Sanita, Rome, Italy

Keywords
alanine scanning; cell transfection;
dystroglycan; protein–protein interaction;
site-directed mutagenesis
Correspondence
A. Brancaccio, CNR, Istituto di Chimica del
Riconoscimento Molecolare c ⁄ o Istituto di
`
Biochimica e Biochimica Clinica, Universita
Cattolica del Sacro Cuore, Largo Francesco
Vito 1, 00168 Rome, Italy
Fax: +39 6 3053598
Tel: +39 6 3057612
E-mail:
*These authors contributed equally to this
work
(Received 10 July 2006, revised 1 September
2006, accepted 6 September 2006)

doi:10.1111/j.1742-4658.2006.05492.x

The dystroglycan adhesion complex consists of two noncovalently interacting proteins: a-dystroglycan, a peripheral extracellular subunit that is
extensively glycosylated, and the transmembrane b-dystroglycan, whose
cytosolic tail interacts with dystrophin, thus linking the F-actin cytoskeleton to the extracellular matrix. Dystroglycan is thought to play a crucial
role in the stability of the plasmalemma, and forms strong contacts
between the extracellular matrix and the cytoskeleton in a wide variety of
tissues. Abnormal membrane targeting of dystroglycan subunits and ⁄ or
their aberrant post-translational modification are often associated with
several pathologic conditions, ranging from neuromuscular disorders to
carcinomas. A putative functional hotspot of dystroglycan is represented
by its intersubunit surface, which is contributed by two amino acid stretches: approximately 30 amino acids of b-dystroglycan (691–719), and
approximately 15 amino acids of a-dystroglycan (550–565). Exploiting
alanine scanning, we have produced a panel of site-directed mutants of
our two consolidated recombinant peptides b-dystroglycan (654–750),
corresponding to the ectodomain of b-dystroglycan, and a-dystroglycan
(485–630), spanning the C-terminal domain of a-dystroglycan. By solidphase binding assays and surface plasmon resonance, we have determined
the binding affinities of mutated peptides in comparison to those of wildtype a-dystroglycan and b-dystroglycan, and shown the crucial role of two
b-dystroglycan phenylalanines, namely Phe692 and Phe718, for the a–b
interaction. Substitution of the a-dystroglycan residues Trp551, Phe554
and Asn555 by Ala does not affect the interaction between dystroglycan
subunits in vitro. As a preliminary analysis of the possible effects of the
aforementioned mutations in vivo, detection through immunofluorescence
and western blot of the two dystroglycan subunits was pursued in dystroglycan-transfected 293-Ebna cells.

Dystroglycan (DG) is an adhesion molecule composed
of two subunits, a-DG and b-DG [1], encoded by a
single gene, dag1, which produces a unique polypeptide

precursor consisting of 895 amino acids. A post-translational cleavage, performed by a still unidentified protease at the Gly653-Ser654 site, produces two subunits,

Abbreviations
DG, dystroglycan; DGC, dystroglycan–glycoprotein complex; EGFP, enhanced green fluorescent protein; SPR, surface plasmon
resonance.

FEBS Journal 273 (2006) 4929–4943 ª 2006 The Authors Journal compilation ª 2006 FEBS

4929


Mutagenesis at the a–b dystroglycan interface

M. Bozzi et al.

a-DG and b-DG. a-DG is a highly glycosylated peripheral membrane protein that interacts with several
extracellular matrix proteins such as laminin, perlecan
and agrin [2]. b-DG spans the membrane and binds
a-DG in a noncovalent way, providing a connection
between the extracellular matrix and the cytoskeleton
inside the cells, where it interacts with dystrophin,
utrophin and other cytosolic proteins, such as rapsyn,
caveolin-3 and Grb2 [3–5]. Together with sarcoglycans,
dystrobrevins, syntrophins, and sarcospan, DG forms
the dystrophin–glycoprotein complex (DCG), which
plays an essential role as a scaffold for cells in muscle
and in a wide variety of nonmuscle tissues [6,7], including the central and peripheral nervous systems, and
several epithelial tissues [8].
The importance of the DCG is dramatically apparent in several forms of muscular dystrophy, where
mutations in DCG proteins lead to instability and progressive weakness of the muscle fibers [9]. Although no
natural mutations have been detected in DG, it is substantially altered or absent in muscular dystrophies.

For this reason, detailed molecular characterization of
the subunit interface should be considered of primary
importance for our understanding of the overall stability of the DGG, and perhaps in the future for surgical
modulation of its function with the purpose of alleviating severe human diseases [10].
Primary structure analysis and electron microscopy
have shown that a-DG has a dumbbell-like structure
organized in two globular domains, the N-terminal and
C-terminal domains, connected by an elongated central
mucin-like region that contains highly glycosylated
sequences, rich in prolines, serines and threonines [11].
A structural characterization of the N-terminal domain
was recently obtained by a crystallographic analysis
carried out on a murine a-DG N-terminal fragment,
and revealed the presence of two autonomous modules
connected by a long and flexible linker. The N-terminal
module shows Ig-like folding, whereas the C-terminal
module appears to be very similar to the ribosomal
RNA-binding proteins [12]. The only structural hints
concerning the C-terminal domain of a-DG come from
a sequence alignment approach, which has shown some
similarities with cadherin domains [13].
Previous studies, carried out employing a series of
independent techniques such as IR, CD [14] and NMR
spectroscopy [15], have revealed the absence of any
classic secondary structural element in the recombinant
b-DG ectodomain, which shows high conformational
plasticity, typical of a natively unfolded protein.
The noncovalent interaction between the two DG
subunits occurs between the C-terminal region of
a-DG and the N-terminal ectodomain of b-DG, and is

4930

apparently independent of glycosylation [16]. Solidphase binding assays, performed with recombinant
fragments corresponding to the C-terminal domain of
a-DG harboring progressive deletions, have shown
that the b-DG-binding epitope resides between amino
acids 550 and 585 [17], and further NMR analysis has
narrowed this location to amino acids 550–565 [18]. In
addition, extensive NMR structural characterization
of our 15N ⁄ 13C b-DG(654–750) recombinant fragment,
spanning the b-DG ectodomain, suggested that the
a-DG-binding epitope corresponds to an amino acid
stretch located between positions 691 and 719 [15].
In order to identify the specific amino acids within
the linear interacting epitopes involved in the complex
between a-DG and b-DG, alanine scanning of some of
the residues that were mainly influenced in NMR titrations [15] was performed on recombinant fragments
a-DG(485–630) and b-DG(654–750). The reciprocal
affinities of wild-type a-DG and b-DG peptides vs. the
panel of mutated recombinant fragments were measured using two independent techniques: solid-phase
binding assays, exploiting biotinylated recombinant ligands, and surface plasmon resonance (SPR), in which
one peptide is covalently immobilized on a sensor chip
while the other is used in soluble phase without labels.
Such mutations were also imported into full-length
DG constructs cloned into an appropriate vector to
transfect eukaryotic cells, in order to set up a suitable
cellular system to study the effect of site-directed mutagenesis on the processing and targeting of DG in vivo.

Results
Mutations within the b-DG(654–750) recombinant

fragment
The phenylalanine in position 718, belonging to the
putative a-DG-binding epitope (691–719) within
the ectodomain of b-DG, was found to be one of the
most influenced residues during the titration of
[15N]b-DG(654–750) with thioredoxin-a-DG(485–620)
[15]. Therefore, we decided to mutate it to an alanine,
together with two other phenylalanines, Phe692 and
Phe700, the only other aromatic residues located
within the a-DG-binding epitope that are highly conserved in all the species so far analyzed. A more drastic alteration of the protein primary structure
was produced by deleting six amino acids, located
within the a-DG-binding epitope, between positions
701 and 706. A previous NMR characterization of the
b-DG ectodomain [15] revealed that the amino acids
between positions 701 and 704 are so flexible as to be
undetectable under the experimental conditions used

FEBS Journal 273 (2006) 4929–4943 ª 2006 The Authors Journal compilation ª 2006 FEBS


M. Bozzi et al.

for NMR analysis. We believed that it would be interesting to verify whether such a flexible amino acid
stretch, located within the a-DG-binding epitope,
might play a role in the interaction between the a-DG
and b-DG subunits. Three additional mutations were
introduced outside the putative a-DG-binding epitope
to check whether perturbing the b-DG ectodomain
elsewhere might also influence its interaction with
a-DG. We produced two mutations upstream of the

a-DG-binding epitope, such as Trp659 fi Ala, because
Trp659 is the only aromatic residue in this portion of
the protein, and Glu667 fi Ala; only one mutation,
Val736 fi Ala, was generated within the C-terminal
region of the b-DG ectodomain, downstream of
the a-DG-binding epitope. A map of all the mutations
produced
within
the
recombinant
fragments
b-DG(654–750) and a-DG(485–620) is given in Fig. 1.
In order to measure the affinity of such mutants
for a-DG(485–630), a series of solid-phase binding
assays was carried out. Typically, in solid-phase binding
assays, a-DG(485–630) was coated onto microtiter plates, whereas b-DG(654–750) and its
b-DG(654–
mutants,
b-DG(654–750)Trp659 fi Ala,
Glu667 fi Ala
, b-DG(654–750)Phe692 fi Ala, b-DG(654–
750)
750)Phe700 fi Ala, b-DG(654–750)Phe718 fi Ala, b-DG(654–
750)Val736 fi Ala, b-DG(654–750)Phe692 fi Ala ⁄ Phe718 fi Ala,
b-DG(654–750)Phe692 fi Ala ⁄ Phe700 fi Ala ⁄ Phe718 fi Ala and
b-DG(654–750)D(701)706), were biotinylated and used as
soluble ligand at increasing concentrations (up to 20 lm).

Fig. 1. A panel of mutations hitting the reciprocal a-DG–b-DG binding epitopes was generated. In the C-terminal region of a-DG,
between amino acids 550 and 565, Trp551, Phe554 and Asn555

were mutated to alanine. In the a-DG-binding epitope comprising
residues 691–719 of the b-DG ectodomain, the mutations
Phe692 fi Ala, Phe700 fi Ala and Phe718 fi Ala were generated
while the residues from 701 to 706 were knocked-in. Three additional mutations were introduced: Glu667 fi Ala and Trp659 fi Ala
upstream, and Val736 fi Ala downstream, of the a-DG-binding epitope.

Mutagenesis at the a–b dystroglycan interface

The apparent affinity for a-DG(485–630), exhibited
by the mutants b-DG(654–750)Glu667 fi Ala and
b-DG(654–750)Val736 fi Ala and evaluated by solid-phase
binding assays, was very similar to that displayed by
b-DG(654–750) (Fig. 2A, Table 1), whereas all the other
single mutants, namely b-DG(654–750)Trp659 fi Ala,
b-DG(654–750)Phe692 fi Ala, b-DG(654–750)Phe700 fi Ala
and b-DG(654–750)Phe718 fi Ala, showed reduced affinity
for a-DG(485–630) (Fig. 2B). Also, the deletion mutant
b-DG(654–750)D(701)706) was able to bind a-DG(485–
630) with the same affinity as the wild type, demonstrating that the highly flexible stretch corresponding to
positions 701–706 is not involved in the interaction with
a-DG(485–630) and does not alter significantly the
b-DG ectodomain conformation (Fig. 2A, Table 1). On
the other hand, double and triple mutations, such as
Phe692 fi Ala ⁄ Phe718 fi Ala and Phe692 fi Ala ⁄
Phe700 fi Ala ⁄ Phe718 fi Ala, completely abolished
the binding between b-DG(654–750) and a-DG(485–
630), at least in the ligand concentration range explored
(Fig. 2C). To rule out the possibility that the lower
affinity for a-DG(485–630) exhibited by some b-DG
mutants might be due to some major proteolytic event,

all the samples used to perform solid-phase binding
assays were checked by Tricine ⁄ SDS ⁄ PAGE before and
after biotinylation, and showed the same mobility as
wild-type b-DG(654–750), indicating that no degradation occurred within mutated recombinant fragments;
similarly, we did not observe any evident aggregation
behavior when analyzing the various mutated b-DG
peptides by native gel electrophoresis (data not shown).
The solid-phase binding assay data were confirmed
by SPR experiments, in which a-DG(485–630) was
immobilized on a sensor chip, and b-DG(654–750) and
its mutants were used in soluble phase as analytes.
First, the dissociation equilibrium constant KD was
measured for the interaction between the two wildtype recombinant fragments a-DG(485–630) and
b-DG(654–750). It should be noted that the affinity
constant value for the b-DG(654–750)–a-DG(485–630)
interaction, measured by immobilizing b-DG(654–750)
and using a-DG(485–630) as analyte (KD 2.73 lm)
(Table 1, Supplementary Fig. S1), was fully comparable to the value obtained when a-DG(485–630) was
immobilized and b-DG(654–750) was used as analyte
(KD 2.66 lm) (Table 1). The thermodynamic constant
KD was also measured for the interaction between the
wild-type recombinant fragment a-DG(485–630) and
the mutant b-DG(654–750)Phe700 fi Ala, and confirmed
its reduced affinity for a-DG(485–630) with respect to
the wild type (KD 7.00 lm; Table 1).
The kinetic SPR profiles obtained for all the
single mutants b-DG(654–750)Phe692 fi Ala, b-DG(654–

FEBS Journal 273 (2006) 4929–4943 ª 2006 The Authors Journal compilation ª 2006 FEBS

4931


Mutagenesis at the a–b dystroglycan interface

M. Bozzi et al.

Table 1. (A) Equilibrium dissociation constants (KD) calculated by
solid-phase binding assays and SPR. Mean apparent KD values and
relative standard deviations, calculated for the interaction between
wild-type and mutated recombinant fragments, b-DG(654–750)
and a-DG(485–630), by solid-phase binding assays. The values are
averaged over a number of independent experiments, indicated in
parentheses. For the b-DG mutants showing reduced affinity for
a-DG(485–630), KD values cannot be calculated (ND, not determined;
see Experimental procedures). (B) KD values for the interaction
between wild-type recombinant fragments, b-DG(654–750) and
a-DG(485–630), and b-DG(654–750)Phe700 fi Ala and a-DG(485–630),
as measured by SPR.
(A) Solid-phase binding assays

A

Immobilized protein ⁄ biotinylated protein
wt

wt

a-DG ⁄ b-DG
a-DGwt ⁄ b-DGGlu667 fi Ala

a-DGwt ⁄ b-DGD(701–706)
a-DGwt ⁄ b-DGVal736 fi Ala
a-DGwt ⁄ b-DGTrp659 fi Ala
a-DGwt ⁄ b-DGPhe692 fi Ala
a-DGwt ⁄ b-DGPhe700 fi Ala
a-DGwt ⁄ b-DGPhe718 fi Ala
a-DGwt ⁄ b-DGPhe692 fi Ala ⁄ Phe718 fi Ala
a-DGwt ⁄ b-DGPhe692 fi Ala ⁄ Phe700 fi Ala ⁄ Phe718 fi Ala
a-DGTrp551 fi Ala ⁄ b-DGwt
a-DGPhe554–Ala ⁄ b-DGwt
a-DGAsn555 fi Ala ⁄ b-DGwt
a-DGTrp551 fi Ala ⁄ Phe554 fi Ala ⁄ b-DGwt

B

Apparent KD (lM)
2.8 ± 0.9 (9)
3.5 ± 0.9 (3)
2.9 ± 0.8 (3)
2.9 ± 2 (4)
ND (10)
ND (8)
ND (3)
ND (8)
ND (3)
ND (3)
1.3 ± 0.8 (4)
2.3 ± 0.9 (5)
1.5 ± 0.8 (6)
2.4 ± 0.7 (3)

(B) SPR

C

Immobilized protein ⁄ analyte
a-DGwt ⁄ b-DGwt
b-DGwt ⁄ a-DGwt
a-DGwt ⁄ b-DGPhe700 fi Ala

Fig. 2. Solid-phase binding assays. a-DG(485–630) was immobilized
on plates, whereas b-DG(654–750) (black) and its mutants
b-DG(654–750)Glu667 fi Ala (blue), b-DG(654–750)Val736 fi Ala (red),
b-DG(654–750)D(701)706) (green) (A), b-DG(654–750)Trp659 fi Ala
(magenta),
b-DG(654–750)Phe692 fi Ala
(green),
b-DG(654–
Phe700 fi Ala
750)
(blue), b-DG(654–750)Phe718 fi Ala (yellow) (B),
b-DG(654–750)Phe692 fi Ala ⁄ Phe718 fi Ala (cyan), and b-DG(654–
750)Phe692 fi Ala ⁄ Phe700 fi Ala ⁄ Phe718 fi Ala (red) (C), were used as biotinylated ligands. Every point is an average of three or more independent experiments. The continuous line represents fitting of
experimental data using a single class of equivalent binding sites
equation. The maximal binding of control b-DG(654–750), extrapolated by fitting experimental data, was set as 100% (see Experimental procedures).

4932

KD (lM)
2.66

2.73
7.00

750)Phe700 fi Ala and b-DG(654–750)Phe718 fi Ala were in
line with the reduction of affinity measured by solidphase binding assays, indicating a lower association
rate and a higher dissociation rate with respect to
wild-type a-DG. The only exception was the mutant
b-DG(654–750)Phe700 fi Ala, which showed a higher
association rate but also a higher dissociation rate in
comparison to the wild type; the double mutant
b-DG(654–750)Phe692 fi Ala ⁄ Phe718 fi Ala did not bind
a-DG(485–630) at all (Fig. 3).
Mutations within the a-DG(485–630) recombinant
fragment
Our previous NMR analysis using a synthetic peptide
corresponding to a-DG(550–585) and the recombinant
fragment b-DG(654–750) indicated that the residues
between positions 550 and 565 of a-DG belong to an
amino acid stretch that is likely to be involved in the

FEBS Journal 273 (2006) 4929–4943 ª 2006 The Authors Journal compilation ª 2006 FEBS


M. Bozzi et al.

Mutagenesis at the a–b dystroglycan interface

630), indicating that the effect measured can be
ascribed to the mutations within the b-DG ectodomain
(data not shown). Interestingly, a western blot experiment showed that Trp551, Phe554 and Asn555 are also

not likely to be key residues for the interaction with
the mAb sx ⁄ 3 ⁄ 50 ⁄ 25 directed against the b-DG-binding epitope (residues 549–567 of a-DG) [19], as the
antibody is able to recognize the bands relative to
a-DG recombinant peptides in western blot experiments (Fig. 4A). Moreover, the antibody is also able
to bind a-DG mutated peptides in solid-phase binding
assays, as it inhibits the interaction between
b-DG(654–750)
and
the
mutant
a-DG(485–
630)Phe554 fi Ala (Fig. 4B), as previously shown for
wild-type a-DG(485–600) [19].
Fig. 3. SPR kinetic profiles of the interaction between immobilized
a-DG(485–630) and b-DG(654–750) (black) and its mutants,
b-DG(654–750)Phe692 fi Ala (green), b-DG(654–750)Phe700 fi Ala (blue),
b-DG(654–750)Phe718 fi Ala (yellow), b-DG(654–750)Phe692–Ala ⁄ Phe718 fi Ala
(cyan), used as analytes at a fixed concentration of 10 lM.

interaction with b-DG(654–750), based on data collected at the level of their NH and CHa [18].
In order to test the role of individual amino acid
side chains at the a-DG–b-DG interface, alanine scanning of positions Trp551, Phe554 and Asn555 was
carried out. Solid-phase binding assays were carried
out, in which a-DG(485–630) and its mutants,
a-DG(485–630)Trp551 fi Ala, a-DG(485–630)Phe554 fi Ala,
and
a-DG(485–
a-DG(485–630)Asn555 fi Ala
630)Trp551 fi Ala ⁄ Phe554 fi Ala were coated onto the
microtiter plate and biotinylated b-DG(654–750) was

used as soluble ligand. All the mutants showed the
same affinity for b-DG(654–750) as the wild type, indicating that such mutations are not likely to have major
effects on the interaction between a-DG and b-DG
(Supplementary Fig. S2). Accordingly, the apparent
dissociation constant values obtained by fitting the
experimental data are very similar to the values calculated for the interaction between the wild-type peptides
a-DG(485–630) and b-DG(654–750) (Table 1). To further confirm that residues Trp551, Phe554 and Asn555
are not involved in the interaction with b-DG, the
affinities of some b-DG mutants for the mutants
a-DG(485–630)Trp551 fi Ala, a-DG(485–630)Phe554 fi Ala
and a-DG(485–630)Asn555 fi Ala were also estimated
by solid-phase binding assays. The affinities of
b-DG(654–750)Trp659 fi Ala, b-DG(654–750)Phe692 fi Ala,
b-DG(654–750)Phe700 fi Ala, b-DG(654–750)Phe718 fi Ala
and b-DG(654–750)Phe692 fi Ala ⁄ Phe700 fi Ala ⁄ Phe718 fi Ala
for immobilized a-DG mutants were very similar to
the reduced affinity exhibited for wild-type a-DG(485–

A

B

Fig. 4. (A) Western blot on 12% SDS ⁄ PAGE of wild-type and
mutated recombinant fragments of a-DG. Recombinant fragments
were detected using mAb sx ⁄ 3 ⁄ 50 ⁄ 25. Lane 1: a-DG(485–
630)Trp551–Ala ⁄ Phe554 fi Ala. Lane 2: a-DG(485–630)Asn555 fi Ala. Lane
3: a-DG(485–630)Phe554 fi Ala. Lane 4: a-DG(485–630)Trp551 fi Ala.
Lane 5 (control): a-DG(485–630). (B) Solid-phase binding assays
were performed by immobilizing a-DG(485–630) (d) and a-DG(485–
630)Phe554 fi Ala (h) and using biotinylated b-DG(654–750) as soluble

ligand, in the presence (empty symbols) and in the absence (full
symbols) of mAb sx ⁄ 3 ⁄ 50 ⁄ 25.

FEBS Journal 273 (2006) 4929–4943 ª 2006 The Authors Journal compilation ª 2006 FEBS

4933


Mutagenesis at the a–b dystroglycan interface

M. Bozzi et al.

Transfection of 293-Ebna cells with wild-type and
mutated DG constructs
In order to verify the correct membrane targeting
of mutated DG, DNA constructs spanning the entire
DG gene, including its signal peptide, and carrying
the mutations analysed in vitro, such as Trp551 fi
Ala, Phe554 fi Ala, Asn555 fi Ala, Glu667 fi Ala,

Phe692 fi Ala,
Phe700 fi Ala,
Phe718 fi Ala,
Phe692 fi Ala ⁄ Phe718 fi Ala and Val736 fi Ala,
were included in an appropriate mammalian expression
vector and then transfected into human 293-Ebna cells.
The cytomegalovirus promoter drives the efficient transcription of the DG exogenous gene, which was
strongly expressed in the transfected cells (Fig. 5).
None of the mutations seemed to significantly alter the

A

Fig. 5. Immunostaining of wild-type DG and its mutants in transiently transfected 293-Ebna cells. (A) The a-subunits were stained with a
polyclonal antibody directed against the C-terminal domain of a-DG on intact 293-Ebna cells. (B) Detection of b-DG was carried out using
b-DG antibody in permeabilized 293-Ebna cells. Both subunits of wild-type and mutated DG were clearly overexpressed with respect to nontransfected cells displaying a much lower and diffuse staining due to endogenous DG; the double mutation Phe692 fi Ala ⁄
Phe718 fi Ala does not alter the membrane targeting of a-DG.

4934

FEBS Journal 273 (2006) 4929–4943 ª 2006 The Authors Journal compilation ª 2006 FEBS


M. Bozzi et al.

Mutagenesis at the a–b dystroglycan interface

B

Fig. 5. (Continued).

correct membrane localization of a-DG and b-DG, at
least 24 h after transfection, as all the mutants could
be stained with a polyclonal antibody directed against
the C-terminal region of a-DG [20] and with a commercial antibody directed against the cytoplasmic tail
of b-DG (Fig. 5A,B). Also, the double mutation
Phe692 fi Ala ⁄ Phe718 fi Ala, which greatly reduces
the affinity of b-DG for the a-subunit in vitro, did not
influence the localization of the two DG subunits
(Fig. 5A,B). In order to detect any effect of the double
mutation Phe692 fi Ala ⁄ Phe718 fi Ala, which may

have evaded the immunostaining analysis [21], the
entire DG carrying this mutation was cloned into the
pEGFP vector, which codes for the enhanced green
fluorescence protein (EGFP) fused at the C-terminus
of b-DG. This vector was used to transiently transfect
293-Ebna cells. Other two pEGFP vectors were
produced, carrying wild-type DG and its mutant
DGPhe554 fi Ala, respectively, to be used as a control
(Fig. 6).
EGFP increases the molecular mass of b-DG
by 25 kDa, allowing us to distinguish between the

FEBS Journal 273 (2006) 4929–4943 ª 2006 The Authors Journal compilation ª 2006 FEBS

4935


Mutagenesis at the a–b dystroglycan interface

M. Bozzi et al.

A

B

C

D

exogenous b-DG and the endogenous b-DG in western
blot experiments. Western blot analysis carried out on
total protein extracts from 293-Ebna cells transiently
transfected with wild-type and mutated (Phe554 fi Ala
or Phe692 fi Ala ⁄ Phe718 fi Ala) DG genes did not
show any aberrant processing or glycosylation patterns
of DG. Although lower expression of a-DG was
detected in all transfected cells (including those
transfected with empty pEGFP or wild-type pDG–
EGFP; Fig. 7A), the amount of a-DG in the cells
transfected with the double-mutated (Phe692 fi Ala ⁄
Phe718 fi Ala) DG construct was similar to that
measured in wild-type DG-transfected cells (Fig. 7).

Discussion
In vitro inhibition of the a-DG–b-DG interaction
via Phe to Ala mutations within the ectodomain
of b-DG
We investigated the interaction between a-DG and
b-DG recombinant peptides carrying a series of sitedirected mutations. We performed amino acid substitutions using alanine, because this residue does not show
any propensity for a specific secondary structure, and
therefore does not perturb the overall protein conformation while highlighting the role of the side chain
functional group that it replaces [22,23]. This charac4936

Fig. 6. 293-Ebna cells transiently
transfected with the vector pEGFP, empty
(A) or containing DNA constructs
corresponding to wild-type DG (B) and its
mutants DGPhe554 fi Ala (C) and
DGPhe692 fi Ala ⁄ Phe718 fi Ala (D), where

enhanced green fluorescent protein
(EGFP) was fused at the C-terminus of
b-DG. All the images are magnified 10·.
EGFP alone was uniformly distributed
throughout the cytoplasm, whereas
DG–EGFP and its two mutants were mostly
localized around the cellular periphery. In
order to better visualize the DG complex
location at the cellular periphery, a 40·
magnified image was obtained referring to
wild-type DG–EGFP, which clearly
shows the membrane targeting of
the chimeric wild-type DG–EGFP
construct [inset in (B), red arrowheads].

teristic makes alanine the amino acid of choice for
site-directed mutagenesis [22–26]. For the first time, we
have measured the affinity between recombinant peptides spanning the C-terminal domain of a-DG and
the b-DG ectodomain by solid-phase binding assays
and SPR, demonstrating that despite the intrinsic pitfalls of solid-phase binding techniques, extensively
reviewed by Tangemann & Engel [27], the apparent
KD values measured with our ‘two-step’ biotin enzymelinked streptavidin approach are in full agreement with
those measured with an independent and accurate
technique such as SPR, whose reliability has been demonstrated in recent years for protein–protein interactions displaying very low affinity [28]. Our SPR
measurements simply demonstrate that the apparent
constants that we have estimated with the solid-phase
binding approach are reliable. In this case, it seems
that even a complex displaying a relatively low affinity
(KD about 3 lm; Table 1) can be populated, when rapidly washed without major perturbations and then
titrated with streptavidin [17,29].

In previous studies, we had already estimated that
the a-DG-binding epitope of b-DG might involve a
relatively extended region of approximately 30 amino
acids, between positions 691 and 719 [15]. In order to
obtain a deeper insight into the a–b interface, we have
introduced a series of mutations within the b-DG ectodomain located in three different protein regions:

FEBS Journal 273 (2006) 4929–4943 ª 2006 The Authors Journal compilation ª 2006 FEBS


M. Bozzi et al.

A

B

Fig. 7. Immunoblot of total protein extracts from 293-Ebna cells
nontransfected (lane 1) or transfected with the empty pEGFP
vector (lane 2), or containing DG–EGFP (lane 3) and its mutants
DGPhe554 fi Ala–EGFP (lane 4) and DGPhe692 fi Ala ⁄ Phe718 fi Ala–EGFP
(lane 5). (A) a-DG bound to the plasma membrane was probed
with the commercial antibody VIA4-1 (Upstate, Charlottesville, VA,
USA). (B) The amount of b-DG–EGFP (68 kDa) compared with that
of endogenous b-DG (43 kDa) was detected with the commercial
antibody directed against the cytoplasmatic tail of b-DG (upper
panel) and with antisera against EGFP (middle panel). Anti-actin
serum was used as loading control (lower panel).

upstream, downstream and inside the putative a-DGbinding epitope. By measuring the affinity of these
mutants for the recombinant fragment a-DG(485–630),

corresponding to the C-terminal domain of a-DG, via
solid-phase binding assays and SPR experiments, we
have found three different behaviors: some mutants,
b-DG(654–
namely
b-DG(654–750)Glu667 fi Ala,
Val736 fi Ala
and b-DG(654–750)D(701)706), show the
750)
same affinity for a-DG(485–630) as the wild-type
recombinant fragment; a second intermediate group,
comprising b-DG(654–750)Trp659 fi Ala, b-DG(654–
b-DG(654–750)Phe700 fi Ala
and
750)Phe692 fi Ala,
Phe718 fi Ala
, shows a reduced affinity
b-DG(654–750)
for a-DG(485–630); the double and triple mutants,
such as b-DG(654–750)Phe692 fi Ala ⁄ Phe718 fi Ala and
b-DG(654–750)Phe692 fi Ala ⁄ Phe700 fi Ala ⁄ Phe718 fi Ala are
completely unable to bind a-DG(485–630).
The behavior of b-DG(654–750)Glu667 fi Ala and
b-DG(654–750)Val736 fi Ala is not surprising, as these
point mutations are located upstream and downstream

Mutagenesis at the a–b dystroglycan interface

of the a-DG-binding epitope, respectively, in portions of the protein that are not involved in the formation of the a–b interface [15]. However, this simple
argument cannot be applied to explain the reduced

affinity for a-DG(485–630) shown by the mutant
b-DG(654–750)Trp659 fi Ala, whose amino acid substitution is located upstream of the a-DG-binding epitope.
A possible interpretation of this result can be suggested on the basis of previous studies showing that the
recombinant fragment b-DG(654–750) is organized
into an N-terminal region, consisting of approximately
70 amino acids, which is characterized by restricted
conformational mobility, and a highly flexible C-terminal region of approximately 30 residues [15]. In
this context, an amino acid substitution introduced
within the region of restricted mobility, such as
Trp659 fi Ala, although located outside the putative
a-DG-binding epitope, may perturb the b-DG(654–
750) conformational equilibrium, driving it to adopt
non-native conformations unable to efficiently bind
a-DG(485–630).
All the point mutations located inside the putative a-DG-binding epitope, namely b-DG(654–
b-DG(654–750)Phe700 fi Ala
and
750)Phe692 fi Ala,
Phe718 fi Ala
, result in reduced affinity
b-DG(654–750)
between a-DG and b-DG recombinant peptides, which
completely lose their ability to interact when two
phenylalanines, Phe692 and Phe718, are simultaneously
substituted with alanine. Surprisingly, the deletion of
six residues corresponding to amino acids 701–706,
located between the two important phenylalanines
Phe692 and Phe718, does not perturb the interaction
between a-DG and b-DG recombinant peptides,
as can be deduced by comparing the values of the

apparent KD for the b-DG(654–750)wt–a-DG(485–630)
interaction
and
the
b-DG(654–750)D(701)706)–aDG(485–630) interaction, as measured by solid-phase
binding assays (Table 1). It should be noted that the
choice to delete these specific amino acids (701–706) is
based on the observation that the residues between
positions 701 and 704, although belonging to the
region of restricted mobility, are so flexible to be undetectable under the experimental conditions used for
NMR experiments [15].
The stretch 701–706 may be part of a flexible linker
that could bring two separate regions of the a-DGbinding epitope (carrying Phe692 and Phe718, respectively) closer to each other when they bind a-DG.
Apparently, deleting the amino acid stretch 701–706
has no effect on the a–b interaction, so it is likely
that the knock-in does not significantly alter the
spatial distance between the two important phenylalanines.

FEBS Journal 273 (2006) 4929–4943 ª 2006 The Authors Journal compilation ª 2006 FEBS

4937


Mutagenesis at the a–b dystroglycan interface

M. Bozzi et al.

Our previous results indicate that although the ectodomain of b-DG is a natively unfolded protein, its
conformation is still maintained by a delicate network
of long-range reciprocal interactions that govern major

structural–functional events [30], to which the two phenylalanine residues, which are quite distant within the
b-DG ectodomain linear sequence, may make an
important contribution.
When the binding experiments were performed with
a-DG(485–630) and its mutants, we found that
Trp551, Phe554 and Asn555 are not key residues
for the interaction with b-DG(654–750), because no
reduction of the affinity of the mutants a-DG
a-DG(485–630)Phe554 fi Ala,
(485–630)Trp551 fi Ala,
Asn555 fi Ala
and
a-DG(485–
a-DG(485–630)
630)Trp551 fi Ala ⁄ Phe554 fi Ala for b-DG(654–750), compared to wild-type a-DG(485–630), was measured by
solid-phase binding assays (Supplementary Fig. S2). It
should be pointed out that our previous NMR experiments showed that a-DG residues Trp551, Phe554 and
Asn555, among others, were significantly influenced by
the presence of b-DG(654–750) at the level of the protein backbone (i.e. at their NH and CHa), although at
that time no data were collected on their side chains,
which therefore could be substantially unaffected by
b-DG binding [18], as is now strongly suggested by the
results herein presented.
A possible implication of our results is that the
specificity of a-DG(485–630) binding to b-DG(654–
750) could depend mainly on its local conformation
and only to a lesser extent on the chemical nature
of the amino acid side chains involved in the binding. To further analyze this hypothesis, it will be
necessary to introduce, within residues 550–565 of
a-DG, amino acids that require stringent steric constraints, such as proline or isoleucine, which may

significantly perturb the local structural characteristics of the b-DG-binding epitope. Interestingly, the
amino acid substitutions that we analyzed do not
impair binding to a monoclonal antibody, mAb
sx ⁄ 3 ⁄ 50 ⁄ 25, as suggested by the western blot in
Fig. 4A. Moreover, mAb sx ⁄ 3 ⁄ 50 ⁄ 25 is able to efficiently inhibit the interaction between wild-type
a-DG and b-DG peptides [19] and also between
mutated a-DG and b-DG (Fig. 4B), suggesting that
other a-DG residues, belonging to the approximately
550–565 residues epitope, but located in the C-terminal region downstream of those so far analyzed,
may be involved in the interaction both with mAb
sx ⁄ 3 ⁄ 50 ⁄ 25 and b-DG(654–750). Therefore, additional
amino acid substitutions, such as Ser556 fi Ala,
Gly563 fi Ala and Pro565 fi Ala, will be tested in
the future [18].
4938

Analysis of DG subunit targeting in vivo:
detection of DG subunits in 293-Ebna cells
Few studies are currently available that focus on the
identification and analysis of polymorphisms and ⁄ or
point mutations within the DG gene in human populations [31,32]; nevertheless, it has been shown in a cellular system that single mutations may strongly influence
the processing of the DG precursor and targeting at
the cell surface of its subunits [33]. Mutations affecting
some putative glycosylation sites lead to impaired
membrane targeting of DG and also to defective cleavage of the precursor into the two subunits [33]. Furthermore, mutation at the precursor maturation
cleavage site (Gly653-Ser654) induces muscular dystrophy in mice [34].
To investigate whether the amino acid substitutions
tested in vitro influence the stability and the localization
of DG at the plasma membrane, we transfected
293-Ebna cells with the full-length murine DG gene

harboring the mutations Trp551 fi Ala, Phe554 fi Ala,
Phe692 fi Ala,
Asn555 fi Ala,
Glu667 fi Ala,
Phe700 fi Ala, Phe718 fi Ala, Val736 fi Ala and
Phe692 fi Ala ⁄ Phe718 fi Ala. Cell-staining experiments showed that none of these mutations significantly
affects the subcellular trafficking and plasmalemmal targeting of exogenous murine DG in transfected human
293-Ebna cells (Fig. 5). In fact, all the mutants were
overexpressed, and a strong fluorescent signal was detected at the plasmalemma, exploiting a monoclonal antibody directed against the cytoplasmic tail of b-DG.
Apparently, even the double mutation Phe692 fi Ala ⁄
Phe718 fi Ala, which greatly impairs binding between
the two DG subunits in vitro, has no evident effect on
the plasmalemmal targeting of b-DG (Fig. 5B). The correct membrane targeting of DG was also confirmed by
the immunodetection of the a-subunit in human cells
transfected with all the mutants (Fig. 5A). In order to
further analyze possible effects of the double mutation
Phe692 fi Ala ⁄ Phe718 fi Ala in vivo, we also cloned
the mutant DGPhe692 fi Ala ⁄ Phe718 fi Ala within the pEGFP vector, together with wild-type DG and the mutant
DGPhe554 fi Ala as controls (Fig. 6). Western blot analysis of total protein extracts from 293-Ebna cells, transiently transfected with these constructs, confirmed the
results of cell-staining experiments (Fig. 7). The amount
of a-DG in cells transfected with the mutant
DGPhe692 fi Ala ⁄ Phe718 fi Ala is in fact fully comparable
with that observed in cells transfected with the empty
pEGFP vector or containing wild-type DG or
DGPhe554 fi Ala (Fig. 7A). The reduced amount of a-DG
detected by VIA4-1 in all the 293-Ebna transfected cell
lines probably results from reduction and ⁄ or modifica-

FEBS Journal 273 (2006) 4929–4943 ª 2006 The Authors Journal compilation ª 2006 FEBS

M. Bozzi et al.

tion of the glycosylation moieties of a-DG in 293-Ebna
[35] cells.
In order to better understand the meaning of the
observed discrepancies between in vitro and in vivo
conditions, one must consider that DG in living cells
and tissues is embedded in a quite heterogeneous and
crowded matrix–membrane milieu in which multiple
and additional factors, such as the interaction with sarcoglycans or with matrix-binding partners (laminin
and perlecan, among others), might influence and stabilize the DG intersubunit interaction. Interestingly, a
recent study showed that a-DG is correctly targeted to
the cellular surface in the absence of the b-subunit in
DG– ⁄ – myotubes infected with deleted mutants of the
DG gene [36]. It was proposed that the low-affinity
interaction between a-DG and b-DG serves to dissociate the two subunits, which can independently play
distinct roles by interacting with other proteins [36].
Further experiments will be carried out to identify
which additional extracellular or membrane proteins
may stabilize the membrane localization of a-DG.
Moreover, it will be interesting to determine whether
the mutations at the a-DG–b-DG interface may influence cellular functions such as proliferation, adhesion
and motility, by analyzing transfected cells for more
than 24 h after transfection. These latter issues might
be particularly relevant when considering the specific
role played by the DG complex at the cell–basement
membrane interface and ⁄ or in mediating cellular signaling in pathologic conditions such as dystrophies or
even carcinogenesis [37].

Experimental procedures
DNA manipulation
The full-length cDNA encoding for murine DG [16] was
used as a template to generate by PCR two DNA
constructs, one corresponding to the N-terminal region
of b-DG, b-DG(654–750), and the other to the C-terminal
region of a-DG, a-DG(485–630) [17]. Appropriate primers
were used to amplify the DNA sequences of interest:
for b-DG(654–750), forward 5¢-CCCGGATCCTCTATCG
TGGTGGAATGGACCAACA-3¢ and reverse 5¢-CCCGA
ATTCTTAGTAAACATCGTCCTCACTGCTCTCTTC-3¢
(BamHI and EcoRI restriction sites in bold); for
a-DG(485–630),
forward
5¢-CCCGTCGACAGTGGA
GTGCCCCGTGGGGGAGAAC-3¢
and
reverse
5¢CCCGAATTCTTATACCAAAGCAATTTTTCTTGTGAA
TG-3¢ (SalI and EcoRI restriction sites in bold). DNA constructs corresponding to mutated fragments of a-DG
(485–630), namely a-DG(485–630)Trp551 fi Ala, a-DG(485–
630)Phe554 fi Ala, a-DG(485–630)Asn555 fi Ala and a-DG(485–

Mutagenesis at the a–b dystroglycan interface

630)Trp551 fi Ala ⁄ Phe554 fi Ala), were amplified by PCR
using the megaprimer technique, with the wild-type
a-DG(485–630) DNA construct as a template and appropriate primers. For all the a-DG mutants, the a-DG(485–
630) forward primer was used together with different
reverse primers for the first PCR (mutated nucleotides are

in bold): 5¢-GTTGCTGTTAAACTGAACCGCCGAT-3¢
(Trp551 fi Ala),
5¢-GTTGCTGTTAGCCTGAACCCAC
GAT-3¢ (Phe554 fi Ala), 5¢-GTTGCTTGCAAACTGAA
CCCACGAT-3¢ (Asn555 fi Ala) and 5¢-GTTGCTGTTA
GCCTGAACCGCCGAT (Trp551 fi Ala ⁄ Phe554 fi Ala).
The megaprimers obtained were used as forward primers
for the second PCR.
DNA constructs corresponding to mutated fragments
of b-DG(654–750), namely b-DG(654–750)Trp659 fi Ala,
b-DG(654–750)Glu667 fi Ala, b-DG(654–750)Phe692 fi Ala, bDG(654–750)Phe700 fi Ala, b-DG(654–750)Phe718 fi Ala, bDG(654–750)Val736 fi Ala and b-DG(654–750)Phe692 fi
Ala ⁄ Phe718 fi Ala, were amplified by PCR using the
megaprimer technique, with the wild-type b-DG(654–750)
DNA construct as a template and appropriate primers.
For b-DG(654–750)Trp659 fi Ala, b-DG(654–750)Glu667 fi Ala,
b-DG(654–750)Phe692 fi Ala and b-DG(654–750) Phe700 fi Ala,
the b-DG(654–750) forward primer was used together with
different reverse primers for the first PCR (mutated nucleotides are in bold): 5¢-AGTGTTGTTGGTCGCTTCCAC
CAC-3¢ (Trp659 fi Ala), 5¢- GGGGCAGGGCGCCAG
GGGCAGAG-3¢ (Glu667 fi Ala), 5¢-AGCATTGGAGGC
GGCAGGACGAGGC-3¢ (Phe692 fi Ala), and 5¢-TCA
GAGCCTTAGCGTCAGGCTCCAG-3¢ (Phe700 fi Ala).
The megaprimers obtained were used as forward primers
for the second PCR. For b-DG(654–750)Phe718 fi Ala and
b-DG(654–750)Val736 fi Ala, the b-DG(654–750) reverse primer was used together with different forward primers for the
first PCR: 5¢-GTGCCACAGGGATAGCCTGGAGGTG-3¢
(Phe718 fi Ala), and 5¢-CCAGCCACAGAGGCTCCAG
ACAGGGACAGG-3¢ (Val736 fi Ala). The megaprimers
obtained were used as reverse primers for the second PCR.
For b-DG(654–750)Phe692 fi Ala ⁄ Phe718 fi Ala, the megaprimer

obtained for the mutant b-DG(654–750)Phe692 fi Ala was used
as forward primer together with the b-DG(654–750) reverse
primer, and the b-DG(654–750)Phe718–Ala DNA construct
was used as a template for the second PCR. For b-DG(654–
750)Phe692 fi Ala ⁄ Phe700 fi Ala ⁄ Phe718 fi Ala, the b-DG(654–750)
forward primer and the reverse primer, 5¢-TCAGAGCCT
TAGCGTCAGGCTCCAG-3¢ (Phe700 fi Ala), were used
for the first PCR, and the b-DG(654–750)Phe692 fi
Ala ⁄ Phe718 fi Ala DNA construct was used as a template.
The megaprimer obtained was used as forward primer
together with the b-DG(654–750) reverse primer for the
second PCR, and the b-DG(654–750)Phe692 fi Ala ⁄ Phe718 fi Ala
DNA construct was used as a template. For the production of the b-DG(654–750)D(701)706) mutant, gene splicing by overlap extension method was used, with 5¢-GCT
CTGGAGCCTGACTTTGTGACGGGCTCTGGC-3¢ and

FEBS Journal 273 (2006) 4929–4943 ª 2006 The Authors Journal compilation ª 2006 FEBS

4939


Mutagenesis at the a–b dystroglycan interface

M. Bozzi et al.

5¢-AAAGTCAGGCTCCAGAGCATTGGAG-3¢ as forward
and reverse primers, respectively. The presence of mutations was confirmed by automated sequencing of DNA
constructs.

Protein expression, purification and biotinylation
The DNA constructs obtained were purified and cloned

into a bacterial vector that was appropriate for expression
of the protein as a thioredoxin fusion product, also containing an N-terminal 6His tag and a thrombin cleavage
site [38]. The recombinant fusion proteins were expressed in
Escherichia coli BL21(DE3) Codon Plus RIL strain and
purified using nickel affinity chromatography. The fragments of interest were obtained upon thrombin cleavage.
Tricine ⁄ SDS ⁄ PAGE was used to check the purity of
the recombinant proteins under analysis [39]. For solidphase binding assays, recombinant b-DG(654–750) and its
mutants were biotinylated in 5 mm sodium phosphate buffer at pH 7.4, with 0.5 mgỈmL)1 sulfo-N-hydroxylsuccinimido-biotin (S-NHS-biotin; Pierce, Rockford, IL, USA). The
reactions were carried out for 30 min on ice and in the dark,
and dialyzed overnight against 10 mm Tris ⁄ HCl ⁄ 150 mm
NaCl (pH 7.4). The optimal dilution for signal detection
was determined by dot blot analysis and revealed by
enhanced chemioluminescence (Pierce).

Solid-phase binding assays
To assess the properties of binding of recombinant
a-DG(485–630) and its mutants to biotinylated recombinant b-DG(654–750) (wild type and mutants), solid phase
assays were performed as follows. Approximately 0.5 lg of
a-DG(485–630), its mutants and BSA were immobilized on
microtiter plates in coated buffer (50 mm NaHCO3,
pH 9.6) overnight at 4 °C. After being washed with
NaCl ⁄ Pi buffer (2.5 mm KCl, 2 mm KH2PO4, 2 mm
Na2HPO4, 140 mm NaCl, pH 7.4) containing 0.05% (v ⁄ v)
Tween-20, 1.25 mm CaCl2 and 1 mm MgCl2, wells were
incubated with decreasing concentrations of recombinant
biotinylated constructs, b-DG(654–750) and its mutants, in
NaCl ⁄ Pi containing 0.05% (v ⁄ v) Tween-20, 3% (w ⁄ v) BSA,
1.25 mm CaCl2 and 1 mm MgCl2 for 3 h at room temperature. After washing, the biotinylated b-DG(654–750) bound
fraction was detected with alkaline phosphatase Vectastain
AB Complex (Vector Laboratories, Burlingame, CA, USA).

A solution was prepared dissolving five milligrams of
p-nitrophenyl phosphate in 10 mL of 10 mm diethanolamine and 0.5 m MgCl2. 100 lL of this solution was used
as a substrate for the reaction with alkaline phosphatase,
and absorbance values were recorded at 405 nm. For each
b-DG(654–750) concentration, the absorbance value (Ai)
originating from coated BSA was subtracted from the
values obtained with the coated wild-type or recombinant
a-DG samples under analysis. Data were fitted using a

4940

single class of equivalent binding sites equation, Ai ¼
Asat[c ⁄ (KD + c) + A0], where Ai represents the absorbance
measured at increasing concentrations of ligand, KD is the
dissociation constant, c is the concentration of ligand, biotinylated b-DG(654–750), and Asat and A0 are the absorbances at saturation and in the absence of ligand,
respectively. Data were normalized according to the equation (Ai ) A0) ⁄ (Asat ) A0) and reported as fractional saturation (%). For b-DG(654–750) mutants that displayed a
significant reduction of their binding affinity, data could
not be fitted according to this equation, and were normalized by setting the maximal binding of the control wild-type
b-DG(654–750), extrapolated by the fitting, as 100%.

SPR experiments
The kinetic parameters, association rate constant (kon) and
dissociation rate constant (koff), were determined using the
BIAcoreX system (Uppsala, Sweden) for SPR detection.
a-DG or b-DG recombinant fragments were immobilized
by covalently coupling the proteins to CM-5 sensor chips
as previously described [29]. Experiments were performed in
HBS (10 mm Hepes, 0.15 m NaCl, 0.005% (v ⁄ v) surfactant
P20, pH 7.4) with a flow rate of 30 lLỈmin)1. The analyte
(b-DG or a-DG) was applied in the concentration ranges

of 2.5–40 lm and 1.2–20 lm, respectively. The response
(response units, RU) was monitored as a function of time
(sensorgram) at 25 °C. b-DG and its mutants were applied
on an a-DG sensor chip at a concentration of 10 lm.
Wild-type a-DG was applied on a b-DG sensor chip at a
concentration of 3 lm. All data were interpreted using
biaevaluation software Version 3.0 (Biacore, Uppsala,
Sweden). The rate of complex formation during sample
injection is described by an equation of the type dR ⁄ dt ¼
kaC (Rmax ) R) – kdR (for 1 : 1 interaction), where R is the
SPR signal in RU, C is the concentration of analyte, Rmax is
the maximum analyte binding capacity in response units
(RU), and dR ⁄ dt is the rate of change in SPR signal.
The dissociation rate constant (koff) was evaluated from
sensorgrams obtained at saturation and used to calculate
the observed association rate constant (kon). The apparent
equilibrium dissociation constant KD, which is equal to the
ratio koff ⁄ kon, was calculated using the biaevaluation software. Residuals from the single-site binding model indicate
an excellent fit (v2 < 2).

DNA manipulation for transfection of eukaryotic
cells
A DNA fragment corresponding to the whole murine DG
sequence, including its signal peptide, was amplified from
C2C12 muscle cells and cloned into the pcDNA3 expression
vector under the CMV strong promoter (Invitrogen, Carlsbad, CA, USA) as previously described [19], yielding the
construct pcDNA3DG. The QuikChange site-directed

FEBS Journal 273 (2006) 4929–4943 ª 2006 The Authors Journal compilation ª 2006 FEBS

M. Bozzi et al.

mutagenesis kit (Stratagene, La Jolla, CA, USA) was used
to create mutations in the DG gene; all constructs were
verified by automated sequencing. The primers used for
mutagenesis are reported in Table 2 with mutated codons
underlined.
The double mutant DGPhe692 fi Ala ⁄ Phe718 fi Ala was generated using the DNA construct corresponding to
DGPhe718 fi Ala as template and Phe692 fi Ala forward and
Phe692 fi Ala reverse primers.
The DNA constructs corresponding to the wild-type
and
DG
and
its
mutants
DGPhe554 fi Ala
DGPhe692 fi Ala ⁄ Phe718 fi Ala were also amplified using the
following primer with a mutated stop codon and cloned
into the pEGFP vector (Clontech, Mountain View, CA,
USA): 5¢-CCC GAA TTC G GCT AGG GGG AAC ATA
CGG AGG GGG-3¢ (EcoRI restriction sites are in bold,
and the mutated codons are underlined).

Mutagenesis at the a–b dystroglycan interface

UK) diluted 1 : 100 in permeabilization buffer. Cells were
then incubated with 10 lgỈmL)1 fluorescent secondary antibody labeled with isothiocyanate (FITC) (Vector Laboratories) for 1 h at room temperature. Preparations were
mounted with Vectashield (Vector Laboratories) and

observed under a fluorescence microscope (Nikon, Tokyo,
Japan).
About 20 lg of the empty pEGFP vector, or containing
DNA constructs corresponding to wild-type DG or
its mutants DGPhe554 fi Ala and DGPhe692 fi Ala ⁄ Phe718 fi Ala,
was used to transfect 293-Ebna cells, by the calcium phosphate method. Briefly, DNA was mixed with 125 mm CaCl2
and Bes-buffered saline, containing 50 mm Bes, 280 mm
NaCl, and 150 mm Na2HPO4. The DNA–calcium phosphate complex was add to the cells. After 24 h, cells were
collected and stored at ) 80 °C.

Total protein extraction and western blot
Cell culture, transfection and immunocytochemistry
293-Ebna cells were grown in DMEM supplemented with
antibiotics and 10% (v ⁄ v) fetal bovine serum. About 2 lg
of pcDNA3DG, wild type and mutated, was transiently
transfected into 293-Ebna cells using Fugene-6 (Roche,
Basel, Switzerland), according to the manufacturer’s
instructions. Upon transfection (24 h), cells were fixed with
4% (w ⁄ v) paraformaldehyde at room temperature for
30 min. For surface staining, cells were incubated overnight
with a polyclonal antibody directed against the C-terminus
of a-DG [20] diluted 1 : 150 in NaCl ⁄ Pi containing 3%
(w ⁄ v) BSA. For intracellular staining, cells were permeabilized with NaCl ⁄ Pi containing 0.1% (w ⁄ v) saponin and 3%
(w ⁄ v) BSA (permeabilization buffer) for 30 min, and then
incubated overnight with a monoclonal antibody directed
against the b-DG cytoplasmic tail (Novocastra, Newcastle,

Cells transfected with the empty pEGFP vector or containing
DNA constructs corresponding to wild-type DG or its
mutants DGPhe554 fi Ala and DGPhe692 fi Ala ⁄ Phe718 fi Ala were

lysed with NaCl ⁄ Pi containing 1% Triton X-100 and protease inhibitors, and centrifuged at 16 000 g for 10 min at 4 °C
with an Eppendorf 5804R centrifuge, rotor type F45-30-11
(Hamburg, Germany). Twenty micrograms of each lysate
was resolved on 7.5% and 10% SDS ⁄ PAGE. For western
blot analysis, proteins were transferred to nitrocellulose and
probed with the following antibodies: anti-a-DG [20], antib-DG (Novocastra, dilution 1 : 50), anti-EGFP (Clontech,
1 : 250) and anti-actin (BD Bioscience, Franklin Lakes,
NJ, USA; 1 : 50). The nitrocellulose was incubated with
horseradish peroxidase-conjugated secondary antibody
(Amersham, Uppsala, Sweden), diluted 1 : 1000, and the
reaction products were visualized using the luminol-based
ECL system (Pierce).

Table 2. Primers used for mutagenesis. Mutated codons are underlined.
Primer

Sequence (5¢- to 3¢)

Trp551 fi Ala forward
Trp551 fi Ala reverse
Phe554 fi Ala forward
Phe554 fi Ala reverse
Asn555 fi Ala forward
Asn555 fi Ala reverse
Glu667 fi Ala forward
Glu667 fi Ala reverse
Phe692 fi Ala forward
Phe692 fi Ala reverse
Phe700 fi Ala forward
Phe700 fi Ala reverse

Phe718 fi Ala forward
Phe718 fi Ala reverse
Val736 fi Ala forward
Val736 fi Ala reverse

GTTAGTAGGTGAGAAATCGGCGGTTCAGTTTAACAGCAACA
TGTTGCTGTTAAACTGAACCGCGCATTTCTCACCTACTAAC
GAGAAATCGTGGGTTCAGGCCAACAGCAACAGCCAGCTC
GAGCTGGCTGTTGCTGTTGGCCTGAACCCACGATTTCTC
TCGTGGGTTCAGTTTAACAGCAACAGCCAGCTC
GAGCTGGCTGTTGCTGTTAAACTGAACCCACGA
TCTGCCCCTGGAGCCCTGCCCCA
TGGGGCAGGGCTCCAGGGGCAGA
CCTCGTCCTGCCGCCTCCAATGCTCTGGA
TCCAGAGCATTGGAGGCGGCAGGACGAGG
GCTCTGGAGCCTGACGCCAAGGCTCTGAGTATTGC
GCAATACTCAGAGCCTTGGCGTCAGGCTCCAGAGC
TGTCGGCACCTCCAGGCTATCCCTGTGGCACCA
TGGTGCCACAGGGATAGCCTGGAGGTGCCGACA
ACCAGCCACAGAGGCGCCAGACAGGGACC
GGTCCCTGTCTGGCGCCTCTGTGGCTGGT

FEBS Journal 273 (2006) 4929–4943 ª 2006 The Authors Journal compilation ª 2006 FEBS

4941


Mutagenesis at the a–b dystroglycan interface

M. Bozzi et al.

Monoclonal antibody sx ⁄ 3 ⁄ 50 ⁄ 25 was used to detect the
recombinant fragment a-DG(485–630) and its mutants [19].
Samples (1.5 lg) were run on 12% SDS ⁄ PAGE and transferred to nitrocellulose. After 1 h of incubation with the
primary antibody (supernatant of hybridoma sx ⁄ 3 ⁄ 50 ⁄ 25),
the nitrocellulose was incubated with horseradish peroxidase-conjugated secondary antibody and the reaction products were visualized using the ECL system.

Acknowledgements
The authors would like to thank Dr Chiara Caputo
for her valuable help and Dr Maria Giulia Bigotti for
helpful discussions and critical reading of the manuscript. The financial support of Ministero della Salute
(Malattie Neurodegenerative ex art. 56) to TCP and of
Telethon-Italy (grant no. GGP030332) to AB is gratefully acknowledged.

References
1 Ibraghimov-Beskrovnaya O, Ervasti JM, Leveille CJ,
Slaughter CA, Sernett SW & Campbell KP (1992) Primary structure of dystrophin-associated glycoproteins
linking dystrophin to the extracellular matrix. Nature
355, 696–702.
2 Henry MD & Campbell KP (1999) Dystroglycan inside
and out. Curr Opin Cell Biol 11, 602–607.
3 Cartaud A, Coutant S, Petrucci TC & Cartaud J (1998)
Evidence for in situ and in vitro association between
b-dystroglycan and the subsynaptic 43K rapsyn protein.
Consequence for acetylcholine receptor clustering at the
synapse. J Biol Chem 273, 11321–11326.
4 Jung D, Yang B, Meyer J, Chamberlain JS & Campbell
KP (1995) Identification and characterization of the dystrophin anchoring site on b-dystroglycan. J Biol Chem
270, 27305–27310.
5 Yang B, Jung D, Motto D, Meyer J, Koretzky G &

Campbell KP (1995) SH3 domain-mediated interaction
of dystroglycan and Grb2. J Biol Chem 270, 11711–
11714.
6 Winder SJ (2001) The complexities of dystroglycan.
Trends Biochem Sci 26, 118–124.
7 Ervasti JM & Campbell KP (1993) A role for the dystrophin–glycoprotein complex as a transmembrane linker between laminin and actin. J Cell Biol 122, 809–823.
8 Durbeej M, Henry MD, Ferletta M, Campbell KP &
Ekblom P (1998) Distribution of dystroglycan in normal
adult mouse tissues. J Histochem Cytochem 46, 449–457.
9 Cohn RD & Campbell KP (2000) Molecular basis of
muscular dystrophies. Muscle Nerve 23, 1456–1471.
10 Durbeej M, Henry MD & Campbell KP (1998) Dystroglycan in development and disease. Curr Opin Cell Biol
10, 594–601.

4942

11 Brancaccio A, Schulthess T, Gesemann M & Engel J
(1995) Electron microscopic evidence for a mucin-like
region in chick muscle a-dystroglycan. FEBS Lett 368,
139–142.
12 Bozic D, Sciandra F, Lamba D & Brancaccio A (2004)
The structure of the N-terminal region of murine skeletal muscle a-dystroglycan discloses a modular architecture. J Biol Chem 279, 44812–44816.
13 Dickens NJ, Beatson S & Ponting CP (2002)
Cadherin-like domains in a-dystroglycan, a ⁄ e-sarcoglycan
and yeast and bacterial proteins. Curr Biol 2, 197–
199.
14 Boffi A, Bozzi M, Sciandra F, Woellner C, Bigotti MG,
Ilari A & Brancaccio A (2001) Plasticity of secondary
structure in the N-terminal region of b-dystroglycan.
Biochim Biophys Acta 1546, 114–121.

15 Bozzi M, Bianchi M, Sciandra F, Paci M, Giardina B,
Brancaccio A & Cicero DO (2003) Structural characterization by NMR of the natively unfolded extracellular
domain of b-dystroglycan: toward the identification of
the binding epitope for a-dystroglycan. Biochemistry 42,
13717–13724.
16 Di Stasio E, Sciandra F, Maras B, Di Tommaso F,
Petrucci TC, Giardina B & Brancaccio A (1999) Structural and functional analysis of the N-terminal extracellular region of b-dystroglycan. Biochem Biophys Res
Commun 266, 274–278.
17 Sciandra F, Schneider M, Giardina B, Baumgartner S,
Petrucci TC & Brancaccio A (2001) Identification of
the b-dystroglycan binding epitope within the C-terminal
region of a-dystroglycan. Eur J Biochem 268, 4590–
4597.
18 Bozzi M, Veglia G, Paci M, Sciandra F, Giardina B &
Brancaccio A (2001) A synthetic peptide corresponding
to the 550–585 region of a-dystroglycan binds b-dystroglycan as revealed by NMR spectroscopy. FEBS Lett
499, 210–214.
19 Pavoni E, Sciandra F, Barca S, Giardina B, Petrucci TC
& Brancaccio A (2005) Immunodetection of partially
glycosylated isoforms of a-dystroglycan by a new monoclonal antibody against its b-dystroglycan-binding epitope. FEBS Lett 579, 493–499.
20 Zaccaria ML, Di Tommaso F, Brancaccio A, Paggi P &
Petrucci TC (2001) Dystroglycan distribution in adult
mouse brain: a light and electron microscopy study.
Neuroscience 104, 311–324.
21 Duclos F, Straub V, Moore SA, Venzke DP, Hrstka
RF, Crosbie RH, Durbeej M, Lebakken CS, Ettinger
AJ, van der Meulen J et al. (1998) Progressive muscular
dystrophy in alpha-sarcoglycan-deficient mice. J Cell
Biol 142, 1461–1471.
22 Zhu Z-Y & Blundell TL (1996) The use of amino acid

patterns of classified helices and strands in secondary
structure prediction. J Mol Biol 260, 261–276.

FEBS Journal 273 (2006) 4929–4943 ª 2006 The Authors Journal compilation ª 2006 FEBS


M. Bozzi et al.

23 Morrison KL & Weiss GA (2001) Combinatorial alanine-scanning. Curr Opin Chem Biol 5, 302–307.
24 Cunningham BC & Wells JA (1989) High-resolution
epitope mapping of hGH–receptor interactions by alanine-scanning mutagenesis. Science 244, 1081–1085.
25 Bass SH, Mulkerrin MG & Wells JA (1991) A systematic mutational analysis of hormone-binding determinants in the human growth hormone receptor. Proc
Natl Acad Sci USA 88, 4498–4502.
26 Ashkenazi A, Presta LG, Marsters SA, Camerato TR,
Rosenthal KA, Fendly BM & Capon DJ (1990) Mapping the CD4 binding site for human immunodeficiency
virus by alanine-scanning mutagenesis. Proc Natl Acad
Sci USA 87, 7150–7154.
27 Tangemann K & Engel J (1995) Demonstration of nonlinear detection in ELISA resulting in up to 1000-fold
too high affinities of fibrinogen binding to integrin
alpha IIb beta 3. FEBS Lett 358, 179–181.
28 Ying M & Flatmark T (2006) Binding of the viral
immunogenic octapeptide VSV8 to native glucose-regulated protein Grp94 (gp96) and its inhibition by the
physiological ligands ATP and Ca2+. FEBS J 273,
513–522.
29 Russo K, Di Stasio E, Macchia G, Rosa G, Brancaccio
A & Petrucci TC (2000) Characterization of the b-dystroglycan-growth factor receptor 2 (Grb2) interaction.
Biochem Biophys Res Commun 274, 93–98.
30 Bozzi M, Di Stasio E, Cicero DO, Giardina B, Paci M
& Brancaccio A (2004) The effect of an ionic detergent
on the natively unfolded b-dystroglycan ectodomain

and on its interaction with a-dystroglycan. Protein Sci
13, 2437–2445.
31 Brancaccio A (2005) a-Dystroglycan, the usual suspect?
Neuromuscul Disord 15, 825–828.
32 Gottlieb E, Ciccone C, Darvish D, Naiem-Cohen S,
Dalakas MC, Savelkoul PJ, Krasnewich DM, Gahl WA
& Huizing M (2005) Single nucleotide polymorphisms
in the dystroglycan gene do not correlate with disease
severity in hereditary inclusion body myopathy. Mol
Genet Metab 86, 244–249.
33 Esapa CT, Bentham GR, Schroder JE, Kroger S &
Blake DJ (2003) The effects of post-translational processing on dystroglycan synthesis and trafficking. FEBS
Lett 555, 209–216.
34 Jayasinha V, Nguyen HH, Xia B, Kammesheidt A,
Hoyte K & Martin PT (2003) Inhibition of dystroglycan
cleavage causes muscular dystrophy in transgenic mice.
Neuromuscul Disord 13, 365–375.

Mutagenesis at the a–b dystroglycan interface

35 Kanakawa M, Saito F, Kunz S, Yoshida-Moriquchi T,
Barresi R, Kobayashi YM, Muschler J, Dumanski JP,
Michele DE, Oldstone MB et al. (2004) Molecular
recognition by LARGE is essential for expression of
functional dystroglycan. Cell 117, 953–964.
36 Tremblay MR & Carbonetto S, (2006) An extracellular
pathway for dystroglycan function in acetylcholine
receptor aggregation and laminin deposition in skeletal
myotubes. J Biol Chem 281, 13365–13373.
37 Losasso C, Di Tommaso F, Sgambato A, Ardito R,

Cittadini A, Giardina B, Petrucci TC & Brancaccio A
(2000) Anomalous dystroglycan in carcinoma cell lines.
FEBS Lett 484, 194–198.
38 Kammerer RA, Schulthess T, Landwehr R, Lustig A,
Fischer D & Engel J (1998) Tenascin-C hexabrachion
assembly is a sequential two-step process initiated by
coiled-coil a-helices. J Biol Chem 273, 10602–10608.
39 Schagger H & von Jagow G (1987) Tricine-sodium
dodecyl sulfate-polyacrylamide gel electrophoresis for
the separation of proteins in the range from 1 to 100
kDa. Anal Biochem 166, 368–379.

Supplementary material
The following Supplementary material is available
online:
Fig. S1. Surface plasmon resonance (SPR) kinetic profiles obtained upon incubation and subsequent washing
of immobilized b-dystroglycan (DG)(654–750) with
increasing amounts of soluble a-DG(485–630). The
concentrations of a-DG(485–630) are, from bottom to
top, 1.0 lm, 1.25 lm, 2.5 lm, 3.0 lm, 5.0 lm, 6.0 lm,
and 10 lm.
Fig. S2. Solid-phase binding assays carried out using
biotinylated b-dystroglycan (DG)(654–750) as soluble
ligand on immobilized a-DG(485–630) (black),
(blue),
a-DG(485–
a-DG(485–630)Trp551 fi Ala
(red),
a-DG(485–630)Asn555 fi Ala
630)Phe554 fi Ala

(magenta) and a-DG(485–630)Trp551 fi Ala ⁄ Phe554 fi Ala
(green) on microtiter plates. Every point is an average
of three or more independent experiments. Curves represent fitting of experimental data using a single class
of equivalent binding sites equation (see Experimental
procedures).
This material is available as part of the online article
from

FEBS Journal 273 (2006) 4929–4943 ª 2006 The Authors Journal compilation ª 2006 FEBS

4943