Báo cáo khóa học: Mycoplasma pneumoniae HPr kinase/phosphorylase Assigning functional roles to the P-loop and the HPr kinase/phosphorylase signature sequence motif doc

Mycoplasma pneumoniae
HPr kinase/phosphorylase
Assigning functional roles to the P-loop and the HPr kinase/phosphorylase signature
sequence motif
Matthias Merzbacher, Christian Detsch, Wolfgang Hillen and Jo¨rg Stu¨ lke*
Lehrstuhl fu
¨
r Mikrobiologie, Institut fu
¨
r Mikrobiologie, Biochemie und Genetik der Friedrich-Alexander-Universita
¨
t
Erlangen-Nu
¨
rnberg, Germany
HPr kinase/phosphorylase (HPrK/P) is the key regulator
of carbon metabolism in many Gram-positive bacteria. It
phosphorylates/dephosphorylates the HPr protein of the
bacterial phosphotransferase system on a regulatory serine
residue in response to the nutrient status of the cell. In
Mycoplasma pneumoniae, HPrK/P is one of the very few
regulatory proteins encoded in the genome. The regulation
of this enzyme by metabolites is unique among HPrK/P
proteins studied so far: it is active as a kinase at low ATP
concentrations, whereas the proteins from other bacteria
need high ATP concentrations as an indicator of a good
nutrient supply for kinase activity. We studied the inter-
action of M. pneumoniae HPrK/P with ATP, Fru1,6P
2
and
P

i
by fluorescence spectroscopy. In agreement with the pre-
viously observed unique regulation, we found a very high
affinity for ATP (K
d
¼ 5.4 l
M
) compared with the HPrK/P
proteins from other bacteria. The K
d
for Fru1,6P
2
was three
orders of magnitude higher, which explains why Fru1,6P
2
has only a weak regulatory effect on M. pneumoniae HPrK/
P. Mutations of two important regions in the active site of
HPrK/P, the nucleotide binding P-loop and the HPrK/P
family signature sequence, had different effects. P-loop
region mutations strongly affect ATP binding and thus all
enzymatic functions, whereas the signature sequence motif
seems to be important for the catalytic mechanism rather
than for nucleotide binding.
Keywords: Gram-positive bacteria; HPr kinase/phosphory-
lase; Mycoplasma pneumoniae; nutrients; regulation.
All organisms need to compete for scarce resources of
nutrients and energy. Therefore, it is essential to have not
only highly efficient metabolic pathways but also sophis-
ticated regulatory systems that allow rapid adaptation to
changing environmental conditions. In bacteria, the ability

to live in many different ecosystems is directly related to
the genetic equipment with regulatory systems. Bacteria
that are metabolically versatile and able to live in a wide
variety of different habitats such as Pseudomonas aerugi-
nosa reserve about 10% of their genomes for regulatory
genes [1]. At the other extreme, mycoplasmas, which
depend on nutrient-rich habitats, contain the smallest
genomes of all self-replicating organisms known so far
and encode very few regulatory proteins [2]. The genome
of Mycoplasma pneumoniae encodes only nine regulatory
proteins, among them no alternative sigma factors and
no two-component system. However, M. pneumoniae and
the other mycoplasmas studied so far possess one of the
key regulatory proteins of carbon metabolism in Gram-
positive bacteria, the HPr kinase/phosphorylase (HPrK/P)
[3–6].
HPrK/P is a metabolite-sensitive enzyme that phos-
phorylates/dephosphorylates the HPr protein of the
bacterial phosphoenolpyruvate–sugar phosphotransferase
system (PTS) on a serine residue [7–9]. It is present in
many but not all Gram-positive and Gram-negative
bacteria. However, it is absent from enteric bacteria such
as Escherichia coli and their close relatives [7,8]. Phos-
phorylation of HPr by HPrK/P has different conse-
quences. (a) The protein can no longer take part in the
phosphotransfer reactions of the PTS because of a greatly
reduced affinity for the PTS phosphoryl donor, enzyme I;
this leads to inhibition of PTS-dependent sugar transport
activity [10,11]. (b) In Gram-positive bacteria with a low
GC content such as Bacillus subtilis, HPr(Ser-P) is a

cofactor of the pleiotropic transcriptional regulator CcpA
which controls the expression of about 100 genes involved
in carbon metabolism [12,13]. (c) HPr(HisP) is required
to phosphorylate and thereby stimulate the activity of
several transcriptional regulators, enzymes and transport-
ers. This stimulation cannot occur if HPr becomes
phosphorylated by HPrK/P [14]. Although the function
of HPrK/P is well established in B. subtilis and its relatives,
much less is known about its role in mycoplasmas and
Correspondence to J. Stu
¨
lke, Abteilung fu
¨
r Allgemeine Mikrobiologie,
Institut fu
¨
r Mikrobiologie und Genetik, Georg-August – Universita
¨
t
Go
¨
ttingen, Grisebachstr. 8, D-37077 Go
¨
ttingen, Germany.
Fax: + 49 551 393808, Tel.: + 49 551 393781,
E-mail:
Abbreviations: HPrK/P, HPr kinase/phosphorylase; PTS, phos-
phoenolpyruvate-dependent sugar phosphotransferase system; HPr,
histidine-containing phosphocarrier protein of the PTS.
*Present address: Abteilung fu

¨
r Allgemeine Mikrobiologie, Institut fu
¨
r
Mikrobiologie und Genetik, Georg-August – Universita
¨
tGo
¨
ttingen,
Grisebachstr. 8, D-37077 Go
¨
ttingen, Germany.
(Received 26 September 2003, revised 11 November 2003,
accepted 20 November 2003)
Eur. J. Biochem. 271, 367–374 (2004) Ó FEBS 2003 doi:10.1046/j.1432-1033.2003.03935.x
Gram-negative bacteria. Recently, it was proposed that
HPrK/P might control the activity of certain two-compo-
nent regulatory systems and the alternative sigma factor,
r
N
, in Gram-negative proteobacteria [15]. As neither two-
component systems nor alternative sigma factors are
present in M. pneumoniae, HPrK/P must fulfil other
functions in this bacterium.
To determine the role of HPrK/P in M. pneumoniae, we
analyzed the biochemical activity, its regulation and the
structure of this enzyme and compared it with the HPrK/P
from other organisms. All HPrK/Ps have the same basic
activity: they phosphorylate/dephosphorylate HPr. How-
ever, enzymes from different organisms differ in their

regulation: the HPrK/P from B. subtilis and related
bacteria is dependent on high ATP concentrations for
activity, and this is stimulated in a co-operative manner by
Fru1,6P
2
. The phosphorylase activity is stimulated by P
i
[16]. Thus, the kinase activity may prevail under conditions
of good nutrient supply, whereas the phosphorylase
activity is dominant if carbon and energy sources become
limiting. In contrast, HPrK/P from M. pneumoniae already
exhibits kinase activity at low ATP concentrations and is
not stimulated by Fru1,6P
2
. As observed in other bacteria,
P
i
triggers phosphorylase activity, and Fru1,6P
2
antagon-
izes the action of P
i
[4]. This unique mode of control of
HPrK/P activity was proposed to reflect the lifestyle of
M. pneumoniae.WhereasM. pneumoniae is strictly adapted
to its ecological niche on nutrient-rich human mucous
membranes, B. subtilis typically faces nutrient limitations
in its natural environments. Thus, the default state of
HPrK/P indicates a good (M. pneumoniae, kinase activity)
or a poor (B. subtilis, phosphorylase activity) nutrient

supply.
Recently, the HPrK/P proteins of Lactobacillus casei,
Staphylococcus xylosus and M. pneumoniae were crystal-
lized and their structures determined [17–20]. All three
enzymes form homohexamers which are arranged as
bilayered trimers. The monomers are composed of two
domains. The N-terminal domains are exposed to the
environment, whereas the C-terminal domains form the
compact core of the protein. The C-terminal domains
alone are sufficient for the formation of hexamers and for
all known enzymatic activities. The active site of the
protein contains the well-conserved ATP-binding P-loop
motif, a so-called Ôkinase-2 motifÕ composed of two
neighbouring aspartate residues and the HPrK/P family
signature sequence motif [19–21]. The function of the
N-terminal domains is so far unknown. Analysis of
the structure did not reveal any specific features of the
M. pneumoniae enzyme that would explain how its
activity is regulated differently from the other enzymes
[19].
In this work, we studied the interaction of the M. pneu-
moniae HPrK/P with its low molecular mass effectors using
fluorescence spectroscopy. We found that the enzyme has a
very high affinity for ATP, explaining kinase activity even at
low ATP concentrations. Binding of ATP is affected in the
presence of Fru1,6P
2
allowing a more rapid phosphoryl
transfer to HPr. Fru1,6P
2

and ATP must be bound by
different sites of the enzyme, as proposed for the B. subtilis
HPrK/P by Pompeo et al. [29], as the P-loop is required for
binding of ATP but not Fru1,6P
2
.
Materials and methods
Bacterial strains and growth conditions
E.coli DH5a and BL21(DE3)/pLysS [22] were used for
cloning experiments and overexpression of recombinant
proteins, respectively. The cells were grown in Luria–
Bertani medium, and transformants were selected on plates
containing ampicillin (100 lgÆmL
)1
).
DNA manipulation and plasmid constructions
Transformation of E.coli and plasmid DNA extraction
were performed using standard procedures [22]. Restriction
enzymes, T4 DNA ligase and DNA polymerase were used
as recommended by the manufacturers. DNA fragments
were purified from agarose gels using a Nucleospin Gel
Extraction kit (Macherey & Nagel, Du
¨
ren, Germany).
DNA sequences were determined using the dideoxy chain
termination method [22].
Plasmids pGP204 and pGP217 [4] were used for the
overexpression of His-tagged forms of M. pneumoniae
HPrK/P and HPr, respectively.
To express a variant of HPrK/P with a single Trp residue

(F200W), we constructed plasmid pGP628 by a two-step
PCR protocol as described previously using the muta-
genic primer MZ6 (5¢-GTAGCGAAAAAGT
GGATGGA
AATCCGT; the mutation is underlined) and the cloning
primers KS9 and KS10 [4]. The resulting PCR product was
cloned between the SalIandHindIII sites of the expression
vector pWH844 [23].
To attach a Strep-tag to recombinant proteins, we used
the vector pGP172. This plasmid was obtained by cloning a
fragment encoding the Strep-tagÒ II from pASK-IBA5
(IBA, Go
¨
ttingen, Germany) into the expression vector
pET3c (Novagen). For this purpose, the fragment encoding
the Strep-tag II was amplified using the primers CD13
(5¢-AAA
CATATGGCTAGCTGGAGCCACCCGCAG
TTC, a NdeI site introduced by the primer is underlined)
and CD14 (5¢-AAGCTTAGTTAGATATCAGAGACC
ATG). The PCR product was digested with NdeIand
BamHIandclonedintopET3ccutwiththesameenzymes.
The wild-type and F200W forms of HPrK/P were tagged
by amplifying the hprK alleles of pGP204 and pGP628 using
the primers SH1 (5¢-AAA
CCGCGGCAATGAAAAAG
TTATTAGTCAAGGAG) and SH3 (5¢-AAA
GGATCC
GGTCTGCTACTAACACTAGGATTCATC). The PCR
fragments were cut with SacII and BamHI and cloned into

pGP172 linearized with the same enzymes. The resulting
plasmids were pGP611 and pGP612 for the wild-type and
F200W forms of hprK, respectively. Mutagenesis of the
hprK-F200W allele was performed by two-step PCR as
described [4].
Protein purification
E.coliBL21(DE3)/pLysS was used as host for the over-
expression of recombinant proteins. Expression was indu-
ced by the addition of isopropyl thio-b-
D
-galactoside (final
concentration 1 m
M
) to exponentially growing cultures
(A
600
¼ 0.8). Cells were lysed using sonication (6 · 30 s,
4 °C, 50 W). After lysis the crude extracts were centrifuged
368 M. Merzbacher et al.(Eur. J. Biochem. 271) Ó FEBS 2003
at 15 000 g for 30 min. For purification of His-tagged
proteins, the resulting supernatants were passed over a Ni
2+
HiTrap chelating column (5 mL bed volume; Pharmacia)
followed by elution with an imidazole gradient (from 0
to 500 m
M
imidazole in buffer containing 10 m
M
Tris/HCl,
pH 7.5, 600 m

M
NaCl, 10 m
M
2-mercaptoethanol) over
30 mL at a flow rate of 0.5 mLÆmin
)1
. For HPrK/P carrying
an N-terminal Strep-tag, the crude extract was passed over
a Streptactin column (IBA). The recombinant protein was
eluted with desthiobiotin (Sigma; final concentration
2.5 m
M
).
For the recombinant HPr protein, the overproduced
protein was purified from the pellet fraction of the lysate by
urea extraction and renatured as described previously [4].
After elution, the fractions were tested for the desired
protein using SDS/12.5% (w/v) polyacrylamide gels for
HPrK/P and 10% (v/v) Tris/Tricine gels [24] for HPr. The
relevant fractions were combined and dialysed overnight.
Purified proteins were concentrated using Microsep
TM
Microconcentrators with a molecular mass cut-off of
3 kDa and 10 kDa for HPr and HPrK/P, respectively (Pall
Filtron, Northborough, MA, USA). Protein concentration
was determined by the method of Bradford [25] using the
Bio-rad dye-binding assay with BSA as standard.
Assay of HPrK/P activity
Activity assays were carried out with purified HPrK/P in
assay buffer (10 m

M
MgCl
2
, 25 m
M
Tris/HCl, pH 7.6,
1m
M
dithiothreitol) using purified (His
6
)HPr or (His
6
)HPr-
Ser-P. ATP, potassium phosphate and Fru1,6P
2
were added
as indicated. The assays were carried out at 37 °Cfor
15 min followed by thermal inactivation of the enzyme
(4 min at 95 °C). The assay mixtures were analyzed on 10%
native polyacrylamide gels as described previously [26].
Proteins were visualized by Coomassie staining.
(His
6
)HPr-Ser-P of M. pneumoniae was prepared as
described previously [4].
Fluorescence measurements
All experiments were performed at 25 ± 0.1 °Cusinga
Fluorolog-3 Jobin Yvon–Spex spectrofluorimeter. All spec-
tra were corrected for buffer fluorescence. Fluorescence
measurements were carried out after dilution of HPrK/P

(170 n
M
final concentration) and equilibration for 30 min in
2 mL buffer containing 200 m
M
NaCl, 10 m
M
Tris/HCl,
pH 7.5 and 5 m
M
dithiothreitol. After each titration step
with ATP/MgCl
2
, Fru1,6P
2
or P
i
, the mixture was stirred
for 1 min and equilibrated for 4 min at 25 ± 0.1 °C. After
specific excitation of the tryptophan residue at 295 nm, the
fluorescence emission was recorded at 300–450 nm. Binding
of ligands was monitored by the variation in intrinsic
tryptophan fluorescence after addition of increasing con-
centrations of effectors and corrections for the variation in
volume. For quantitative analysis, all fluorescence peaks
were integrated between 320 and 380 nm, and the formation
of the HPrK/P–ligand complex was described as saturation
f ¼ (f
x
) f

0
)/(f
f
) f
0
), where f
x
is the integrated relative
fluorescence intensity between 320 and 380 nm at each
single titration step, f
0
before addition of any ligand, and
f
f
at the end of the titration. Fitting of the curves
was performed using the
GRAPHPAD PRISM
software
(GraphPad Software, Inc.) and a one-site binding model
f ¼ [mK
A
c
(ligand)
]/[1 + K
A
c
(ligand)
], where m is the overall
concentration of binding sites and K
A

is an equilibrium
association constant [27]. The equilibrium dissociation
constants K
d
were calculated from K
d
¼ 1/K
A
.
Results
Construction and characterization of an HPrK/P variant
with a single tryptophan fluorescence probe
ATP is the substrate of HPrK/P, but at the same time it
is an effector molecule of HPrK/P from B. subtilis and
related bacteria [16]. It was therefore interesting to study
the interaction of HPrK/P with ATP and other potential
effectors. Changes in intrinsic fluorescence of tryptophan
residues in proteins can provide a sensitive assay for such
interactions. However, the M. pneumoniae HPrK/P does
not contain any Trp residues. Therefore, we constructed,
expressed, and purified a variant of HPrK/P with a single
Trp residue. We chose to place the Trp residue at
position 200 of HPrK/P in order to have it close to the
P-loop ATP-binding motif and the signature sequence of
HPrK/P. Moreover, the Trp replaces another aromatic
amino acid, Phe200, in this mutant [19]. The mutant
alleles were obtained as described in Materials and
methods, and the proteins were purified as versions with
aHis-oraStrep-tag. In a previous study, we determined
the structure of the His-tagged HPrK/P from M. pneumo-

niae [19], which thus serves as the standard. However,
some mutant variants precipitated during purification if
a His-tag was present. These proteins were studied using
the Strep-tag. Kinase and phosphorylase activities of the
single Trp mutants were assayed and found to be very
similar to those of the wild-type protein [4] (data not
shown). Thus, these proteins could be used to determine
ligand affinities.
Binding of ATP to
M. pneumoniae
HPrK/P
The HPrK/P from B. subtilis is active as a kinase only at
high ATP concentrations or at a low ATP concentration in
the presence of Fru1,6P
2
[16]. In contrast, the protein of
M. pneumoniae already exhibits kinase activity at very low
ATP concentrations. We were therefore interested to study
the ATP-binding characteristics of the M. pneumoniae
enzyme by fluorescence measurements. HPrK/P(F200W)
was excited at 295 nm, and the emission spectrum was
recorded. As shown in Fig. 1A, fluorescence reached a
maximum at 350 nm. The emission was constant over more
than an hour (data not shown), indicating that the protein
was sufficiently stable for analysis of ATP binding. HPrK/
P(F200W) was incubated with increasing concentrations of
ATP, and the changes in fluorescence were recorded
(Fig. 1A). With increasing ATP concentrations, the fluor-
escence intensities decreased until a minimum was reached.
To be sure that the observed effects were indeed specific,

we tested the changes in fluorescence on addition of AMP.
No decrease in fluorescence was detected. Moreover, we
incubated wild-type HPrK/P carrying a Strep-tag with
ATP. Again, no changes in fluorescence were observed.
Ó FEBS 2003 M. pneumoniae HPr kinase/phosphatase (Eur. J. Biochem. 271) 369
Thus, the Trp residue is placed at a suitable position for
specifically detecting interaction with ATP.
To quantify the binding of ATP to HPrK/P, the
saturation (f) of HPrK/P with ATP was plotted against
the ATP concentrations (Fig. 1B). In contrast with the
results with the B. subtilis HPrK/P, no sigmoidal curve
indicative of co-operative binding was obtained. The
dissociation constant K
d
was calculated to be
5.4 ± 1.3 l
M
.
For the HPrK/P of B. subtilis, it was shown that P
i
inhibits binding of nucleotides [28]. To test whether this
applies also to the M. pneumoniae enzyme, we analyzed the
effect of increasing P
i
concentrations on the binding of
HPrK/P to ATP. HPrK/P(F200W) was incubated with a
saturating ATP concentration (50 l
M
)andP
i

was added. As
shown in Fig. 2, the fluorescence intensity was substantially
decreased in the presence of ATP if no additional ligand
was present (ligand concentration 0 m
M
). However, with
increasing concentrations of P
i
, an increase in fluorescence
intensity was detected, suggesting that P
i
can inhibit ATP
binding to M. pneumoniae HPrK/P. Incubation of HPrK/
P(F200W) with P
i
did not result in any changes in
fluorescence intensity. Thus, the Trp at position 200 may
not be suitable for detecting phosphate binding. Moreover,
we studied the effect of the chloride anion on ATP binding.
No effect was observed, even on addition of 150 m
M
chloride. Thus, the negative effect of phosphate on ATP
binding results from a specific interaction with HPrK/P.
Interaction of
M. pneumoniae
HPrK/P with Fru1,6
P
2
High concentrations of Fru1,6P
2

indicate high glycolytic
activity and stimulate kinase activity of HPrK/P in B. sub-
tilis and related bacteria [16]. In M. pneumoniae, Fru1,6P
2
is
involved in the control of phosphorylase rather than kinase
activity [4]. We wished therefore to study the binding
of Fru1,6P
2
to M. pneumoniae HPrK/P by fluorescence
measurements. As described for ATP-binding assays,
HPrK/P(F200W) was incubated with increasing amounts
of Fru1,6P
2
, and changes in fluorescence were recorded.
Fig. 1. ATP binding to HPrK/P. (A) Increasing concentrations of
ATP/MgCl
2
from 0 to 200 l
M
were added to 2 mL 170 n
M
HPrK/P in
buffer containing 200 m
M
NaCl, 10 m
M
Tris/HCl, pH 7.5, and 5 m
M
dithiothreitol. The fluorescence intensity was recorded from 300 to

450 nm after each titration step. From the upper to the lower curves,
the concentration of ATP was 0, 5, 10, 20, 50, 100 and 200 l
M
,
respectively. (B) All fluorescence curves were integrated between 320
and 380 nm, and the saturation f of HPrK/P with ATP was plotted
against the concentration of the ligand (s). The continuous curve
represents the fitted values of the saturation f.
Fig. 2. Influence of P
i
on ATP bound to HPrK/P. HPrK/P (170 n
M
)
was incubated in 2 mL buffer containing 200 m
M
NaCl, 10 m
M
Tris/
HCl, pH 7.5, and 5 m
M
dithiothreitol. After 30 min incubation at
25 °C, the fluorescence of the sample was recorded from 300 to 450 nm
(a). Then 50 l
M
ATP/MgCl
2
was added to the mixture and the
fluorescence of the sample was measured (b). The titrations with
K
2

HPO
4
or NaCl were performed between 10 and 150 m
M
ligand,
and, after each titration step, the fluorescence was recorded. All curves
were integrated between 320 and 380 nm and the relative fluorescence
intensity was plotted against the concentration of the ligand.
370 M. Merzbacher et al.(Eur. J. Biochem. 271) Ó FEBS 2003
Again, a reduction in fluorescence intensity was observed
with increasing concentrations of Fru1,6P
2
. The quantifi-
cation of Fru1,6P
2
binding revealed a K
d
of 4.5 ± 1 m
M
.
To test the specificity of binding, we studied the changes
in fluorescence after addition of Fru6P. No effect was
observed.
Effect of Fru1,6
P
2
on ATP binding by HPrK/P
Fru1,6P
2
is not required for kinase activity of M. pneumo-

niae HPrK/P but it inhibits the stimulation of phosphory-
lase activity by P
i
[4]. As P
i
itself antagonizes the binding of
ATP, it seemed reasonable to assume an effect of Fru1,6P
2
on ATP binding as well. Indeed, Fru1,6P
2
was able to
attenuate the decrease in fluorescence intensity of HPrK/
P(F200W) seen after addition of ATP and MgCl
2
(Fig. 3).
In the presence of 1 m
M
Fru1,6P
2
, the apparent K
d
for ATP
was increased to 31 ± 4 l
M
, as compared with 5.4 l
M
in its
absence. We may thus conclude that Fru1,6P
2
influences the

binding of ATP to HPrK/P. The specificity of this effect was
addressed by testing whether Fru6P would give the same
result. In agreement with the observation that Fru6P does
not bind to HPrK/P (see above), it had also no effect on
ATP binding (Fig. 3).
If Fru1,6P
2
interferes with ATP binding, it might also
affect HPrK/P activity. In our previous experiments, we
detected an effect of Fru1,6P
2
on phosphorylase but not on
kinase activity [4]. To test the role of Fru1,6P
2
in kinase
activity more rigorously, we studied the time course of the
kinase reaction in the presence and absence of Fru1,6P
2
.
Under the conditions used in this assay, about 50% of HPr
was phosphorylated after 4 min in the absence of Fru1,6P
2
(Fig. 4A). In the presence of Fru1,6P
2
, the reaction was
somewhat accelerated: significant HPr phosphorylation was
already detected after 2 min. The quantification of this
reaction and the values for the slope of the graphs in the
linear part between 0 and 4 min (without Fru1,6P
2

,
12.4 ± 2.4; with Fru1,6P
2
, 20.1 ± 0.3; Fig. 4B) indicate
that the kinase reaction is indeed faster in the presence of
Fru1,6P
2
. Although this was only a slight effect, it was
reproducible and is therefore considered to be relevant (see
the discussion).
Role of specific residues in the P-loop and the signature
sequence in the interaction with ATP and Fru1,6
P
2
Of the three strongly conserved regions in HPrK/P, the
kinase-2 motif was implicated in the catalytic mechanism
[21]. The P-loop is involved in nucleotide binding whereas
the function of the signature sequence is so far unknown.
Previous mutation analyses with M. pneumoniae HPrK/P
revealed that both regions were essential for enzymatic
Fig. 3. Effect of Fru1,6P
2
on ATP binding. Increasing concentrations
of ATP/MgCl
2
were added to the 2 mL mixture containing 170 n
M
HPrK/P and in addition 1 m
M
Fru1,6P

2
or as a control 5 m
M
Fru6P.
The fluorescence intensity was measured after each titration, and the
decrease in fluorescence plotted against the ligand concentration.
Fig. 4. Time-dependent HPr phosphorylation in the presence or absence
of Fru1,6P
2
. (A) 20 l
M
HPr was incubated with 500 n
M
HPrK/P and
100 l
M
ATP in reaction buffer in the presence or absence of 5 m
M
Fru1,6P
2
. Before and 1, 2, 4 and 6 min after the start of the reaction,
20 lLmixturewastransferredtoafreshreactiontubeandthereaction
was stopped (96 °C, 4 min). The fractions were then separated on a
native polyacrylamide gel, analyzed using the TINA quantification
software (raytest; Isotopenmessgera
¨
te GmbH, Straubenhardt, Ger-
many), and the amount of remaining unphosphorylated HPr was
plotted against time (B).
Ó FEBS 2003 M. pneumoniae HPr kinase/phosphatase (Eur. J. Biochem. 271) 371

activity. However, some mutations strongly reduced or
abolished the phosphorylase activity without affecting
kinase activity [4]. It was therefore interesting to study
these mutants in more detail.
For this purpose, a series of previously described
mutations was introduced into the Strep-tagged variant
of HPrK/P(F200W). This allows easy purification of the
mutant proteins and analysis of the effects of the mutations
by fluorescence measurements. Binding of ATP was studied
as described for the wild-type protein. As observed previ-
ously, the fluorescence intensity of the wild-type protein
decreased greatly after ATP addition (Fig. 5). Similarly, the
proteins with mutations at positions S161T, R204 and G207
showed good ATP binding. The G154A mutant protein
exhibited greatly reduced ATP binding with K
d
about
sevenfold increased (Fig. 5, Table 1). In contrast, the
G159A and K160A proteins were not able to bind ATP.
This finding is in good agreement with the observation that
these proteins had lost all enzymatic activity [4]. Binding
of Fru1,6P
2
was not significantly altered in the mutant
proteins, as judged from the dissociation constants
(Table 1). In the presence of Fru1,6P
2
, the apparent K
d
for ATP was greatly increased for the wild-type protein.

Similar effects were found for the S161T, R204K, and
G207A mutant proteins. In contrast, the apparent K
d
values
for ATP were increased even more for the G154A and the
S161A proteins (Table 1). These two proteins exhibit
reduced kinase activity and have lost their phosphorylase
activity [4].
Discussion
In contrast with its counterparts from B. subtilis and other
low-GC Gram-positive bacteria, the M. pneumoniae HPrK/
P is already active at very low ATP concentrations,
suggesting that ATP does not control the activity of the
enzyme in this organism. In this work, we demonstrate that
the K
d
of M. pneumoniae HPrK/P for ATP is indeed very
low (5.4 l
M
) compared with the value determined for the
B. subtilis enzyme (100 … 300 l
M
) [16,21,29]. Thus, the
B. subtilis enzyme requires an ATP concentration that is
only present in the cell at high metabolic activity. Alternat-
ively, Fru1,6P
2
as an intracellular signal of glycolytic
activity, stimulates activity of B. subtilis HPrK/P at low
ATP concentrations. Although binding of Fru1,6P

2
does
not affect the affinity of B. subtilis HPrK/P for ATP [16,29],
an altered affinity for ATP was observed in this study for the
M. pneumoniae enzyme. The presence of Fru1,6P
2
may be
important for the reaction rate of M. pneumoniae HPrK/P:
a weak but reproducible acceleration of the kinase reaction
was observed if Fru1,6P
2
was added to the reaction.
Similarly, an acceleration of HPrK/P kinase activity was
recently demonstrated for the enzyme from Streptococcus
salivarius. As found here for M. pneumoniae HPrK/P, this
enzyme exhibits kinase activity in the absence of Fru1,6P
2
,
although much higher ATP concentrations are required
[30].
It is of interest to investigate the structural determinants
of the altered regulation of M. pneumoniae HPrK/P. With
the crystallization and solution of the 3D structure of the
protein to a resolution of 2.5 A
˚
, it is now possible to directly
compare structures of the M. pneumoniae, S. xylosus and
L. casei HPrK/P proteins [17–19,31]. However, such a
comparison did not reveal any obvious structural differ-
ences that may be responsible for the observed difference in

regulation and nucleotide affinity [19,20]. Therefore, we
extended a previous mutational analysis by quantitatively
analysing the mutants.
In the P-loop, we studied the roles of the conserved
amino acids G154, G159, K160, and S161 [4,21,32].
Residue G154 has been proposed to stabilize the P-loop
of adenylate kinase by forming a hydrogen bond with
K160 [33]. In the structure of M. pneumoniae HPrK/P, a
water molecule forms a bridge between these two amino
Fig. 5. ATP binding of point mutated HPrK/P. Increasing concentra-
tions of ATP/MgCl
2
from 0 to 200 l
M
wereaddedto2mL170n
M
HPrK/P in buffer containing 200 m
M
NaCl, 10 m
M
Tris/HCl pH 7.5
and 5 m
M
dithiothreitol. The fluorescence intensity was measured after
each titration step, and the decrease in fluorescence plotted against the
concentration of the ligand.
Table 1. K
d
values for binding of ATP and Fru1,6P
2

to the HPrK/P mutants. All values were determined in duplicate. Mean values ± SD are
shown. n.d., No change in fluorescence was detectable during titration.
Wild-type G154A G159A K160A S161A S161T R204K G207A
ATP (l
M
) 5.4 ± 1.3 39 ± 4.1 n.d. n.d. 11 ± 0.9 6.8 ± 0.5 6.9 ± 0.4 6.7 ± 0.3
ATP (l
M
)
a
31 ± 4.0 80 ± 9.8 n.d. n.d. 61 ± 1.5 38 ± 1.8 34 ± 2.8 37 ± 2.6
Fru1,6P
2
(m
M
) 4.5 ± 1.0 3.6 ± 0.8 4.4 ± 0.9 4.6 ± 1.3 2.7 ± 0.9 2.4 ± 0.7 3.8 ± 1.3 4.8 ± 1.7
a
The HPrK/P solution contained 1 m
M
Fru1,6P
2
. Values given are apparent dissociation constants.
372 M. Merzbacher et al.(Eur. J. Biochem. 271) Ó FEBS 2003
acids [19]. The mutational analysis supports the idea that
G154 plays a structural rather than an enzymatic role: the
mutant G154A is still active as a kinase, suggesting that it
can bind ATP. Indeed, the K
d
of this mutant protein for
ATP was increased about eightfold, which may explain

the reduced kinase activity. Mutational studies of the
corresponding residue with the B. subtilis HPrK/P revea-
led conflicting results: Hanson et al. [26] found decreased
kinase and phosphorylase activity whereas Pompeo et al.
[29] reported the complete loss of both enzymatic activities
and did not detect any nucleotide binding. The reason for
this discrepancy is so far unknown. The three amino acids
G159, K160, and S161 are involved in binding of the
triphosphate moiety of ATP or GTP [19,32]. The muta-
tions G159A and K160A completely abolish the binding
of ATP (Table 1, Fig. 5). Accordingly, neither mutant
enzyme exhibited any kinase or phosphorylase activities
[4]. S161 is not only involved in nucleotide binding but
also in the co-ordination of a magnesium cation necessary
for catalytic activity [19,32,34]. Two different mutations
of S161 were studied: replacement with the structur-
ally similar amino acid threonine and replacement with
alanine. In many P-loop proteins, a threonine is present
and can functionally replace the serine residue at this
position [32]. Indeed, the S161T mutant protein binds
ATP with high affinity and has both enzymatic activities.
Similar results were reported for the B. subtilis HPrK/P
[26,29]. Functional interchangeability of serine and threo-
nine residues of the P-loop was also detected for the
corresponding position of the liver 6-phosphofructo-2-
kinase [35]. In contrast, the mutation S161A resulted in
greatly impaired kinase activity and loss of phosphorylase
activity [4]. However, the affinity of this protein for ATP
is only slightly affected. This is in good agreement with
the proposal that S161 is involved in the catalytic activity,

in addition to its role in triphosphate binding. In the
HPrK/P of B. subtilis, the corresponding S160A mutation
resulted in loss of ATP binding and enzymatic activities
[29].
The function of the HPrK/P family signature sequence
[8] has so far not been elucidated. The two mutant
proteins studied in this work had different properties: the
R204K enzyme had wild-type kinase and a reduced
phosphorylase activity. In contrast, the G207A mutant
protein had lost all activities [4]. However, both mutant
proteins bound ATP as effectively as the wild-type
protein. Thus, the signature sequence motif seems to be
involved in the catalytic mechanism rather than the inter-
action with nucleotides. It was proposed that the guanid-
inium group of arginine may be involved in the stabilization
of the transition state complex of HPr(Ser-P) during its
dephosphorylation by HPrK/P [19]. An arginine residue
corresponding to R204 is also present in the E.coliPEP
carboxykinase (R333). In this enzyme, R333 makes
contact with an oxygen atom of the c-phosphate of
ATP [36], and it has been proposed that the lysine present
in the HPrK/P-R204K mutant could also provide a salt
bridge with the ATP [19]. Replacement of the R204
residue of B. subtilis HPrK/P with an alanine resulted in a
large reduction in kinase activity, although the affinity for
ATP was not significantly affected [29]. G207 is located in
asmallb-sheet, and it was proposed that this amino acid
cannot be replaced at this position of the M. pneumoniae
HPrK/P for structural reasons. Indeed, the G207A
mutation abolished both enzymatic activities without

affecting ATP binding. In B. subtilis, the corresponding
mutation results in reduced kinase activity and loss of
phosphorylase activity [26]. Taken together, the results of
this and previous studies on the signature sequence motif
of the M. pneumoniae and B. subtilis HPrK/P indicate
that this motif is important for the catalytic mechanism of
both phosphorylation and dephosphorylation. The close
proximity of the signature sequence motif to the P-loop
seen in all HPrK/P crystal structures [17–19] supports this
idea.
Future work on M. pneumoniae HPrK/P will address
two major questions: (a) the structural reasons for the high
affinity for ATP and thus the altered regulation; (b) the
regulatory role of HPrK/P in the physiology of M. pneu-
moniae.
Acknowledgements
Serkan Halici is acknowledged for help with some experiments. We are
grateful to Marco Diel for helpful discussions. This work was supported
by grants from the Deutsche Forschungsgemeinschaft and the Fonds der
Chemischen Industrie to J.S. and W.H.
References
1. Greenberg, E.P. (2000) Bacterial genomics: pump up the versa-
tility. Nature (London) 406, 947–948.
2. Razin, S., Yogev, D. & Naot, Y. (1998) Molecular biology and
pathogenicity of mycoplasmas. Microbiol. Mol. Biol. Rev. 62,
1094–1156.
3. Himmelreich,R.,Hilbert,H.,Plagens,H.,Pirkl,E.,Li,B C.&
Herrmann, R. (1996) Complete sequence analysis of the genome
of the bacterium Mycoplasma pneumoniae. Nucleic Acids Res. 24,
4420–4449.

4. Steinhauer, K., Jepp, K., Hillen, W. & Stu
¨
lke, J. (2002) A novel
mode of control of Mycoplasma pneumoniae HPr kinase/phos-
phatase activity reflects its parasitic life style. Microbiology 148,
3277–3284.
5. Hoischen, C., Dijkstra, A., Rottem, S., Reizer, J. & Saier, M.H.
(1993) Presence of protein constituents of the gram-positive
bacterial phosphotransferase regulatory system in Acholeplasma
laidlawii. J. Bacteriol. 175, 6599–6604.
6. Zhu, P P., Nosworthy, N., Ginsburg, A., Miyata, M., Seok, Y J.
& Peterkofsky, A. (1997) Expression, purification, and char-
acterization of Enzyme IIA
glc
of the phosphoenolpyruvate:sugar
phosphotransferase system of Mycoplasma capricolum. Biochem-
istry 36, 6947–6953.
7. Galinier, A., Kravanja, M., Engelmann, R., Hengstenberg, W.,
Kilhoffer, M C., Deutscher, J. & Haiech, J. (1998) New protein
kinase and protein phosphatase families mediate signal transduc-
tion in bacterial catabolite repression. Proc. Natl Acad. Sci. USA
95, 1823–1828.
8. Reizer, J., Hoischen, C., Titgemeyer, F., Rivolta, C., Rabus, R.,
Stu
¨
lke, J., Karamata, D., Saier, M.H. & Hillen, W. (1998) A novel
protein kinase that controls carbon catabolite repression in bac-
teria. Mol. Microbiol. 27, 1157–1169.
9. Kravanja, M., Engelmann, R., Dossonnet, V., Blu
¨

ggel, M.,
Meyer, H.E., Frank, R., Galinier, A., Deutscher, J., Schnell, N. &
Hengstenberg, W. (1999) The hprK gene of Enterococcus faecalis
encodes a novel bifunctional enzyme: the HPr kinase/phosphatase.
Mol. Microbiol. 31, 59–66.
Ó FEBS 2003 M. pneumoniae HPr kinase/phosphatase (Eur. J. Biochem. 271) 373
10. Deutscher, J., Kessler, U., Alpert, C.A. & Hengstenberg, W.
(1984) Bacterial phosphoenolpyruvate-dependent phosphotrans-
ferase system: P-ser-HPr and its possible regulatory function.
Biochemistry 23, 4455–4460.
11. Ludwig, H., Rebhan, N., Blencke, H M., Merzbacher, M. &
Stu
¨
lke, J. (2002) Control of the glycolytic gapA operon by the
catabolite control protein A in Bacillus subtilis: a novel mechanism
of CcpA-mediated regulation. Mol. Microbiol. 45, 543–553.
12. Moreno, M.S., Schneider, B.L., Maile, R.R., Weyler, W. & Saier,
M.H. (2001) Catabolite repression mediated by CcpA protein in
Bacillus subtilis: novel modes of regulation revealed by whole-
genome analyses. Mol. Microbiol. 39, 1366–1381.
13. Blencke, H M., Homuth, G., Ludwig, H., Ma
¨
der, U., Hecker, M.
&Stu
¨
lke, J. (2003) Transcriptional profiling of gene expression in
response to glucose in Bacillus subtilis: regulation of the central
metabolic pathways. Metab. Engn. 5, 133–149.
14. Gunnewijk, M.G.W., van den Bogaard, P.T.C., Venhoff, L.M.,
Heuberger, E.H., de Vos, W.M., Kleerebezem, M., Kuipers, O.P.

& Poolman, B. (2001) Hierarchical control versus autoregulation
of carbohydrate utilization in bacteria. J. Mol. Microbiol. Bio-
technol. 3, 401–413.
15. Boe
¨
l, G., Mijakovic, I., Maze
´
, A., Poncet, S., Taha, M.K., Laribe,
M., Darbon, E., Khemiri, A., Galinier, A. & Deutscher, J. (2003)
Transcription regulators potentially controlled by HPr kinase/
phosphorylase in Gram-negative bacteria. J. Mol. Microbiol.
Biotechnol. 5, 206–215.
16. Jault, J.M., Fieulaine, S., Nessler, S., Gonzalo, P., Di Pietro, A.,
Deutscher, J. & Galinier, A. (2000) The HPr kinase from Bacillus
subtilis is a homo-oligomeric enzyme which exhibits strong posi-
tive cooperativity for nucleotide and fructose 1,6-bisphosphate
binding. J. Biol. Chem. 275, 1773–1780.
17. Fieulaine, S., Morera, S., Poncet, S., Monedero, V., Gueguen-
Chaignon, V., Galinier, A., Janin, J., Deutscher, J. & Nessler, S.
(2001) X-ray structure of HPr kinase: a bacterial protein with a
P-loop nucleotide-binding domain. EMBO J. 20, 3917–3927.
18. Ma
´
rquez, J.A., Hasenbein, S., Koch, B., Fieulaine, S., Nessler, S.,
Russell, R.B., Hengstenberg, W. & Scheffzek, K. (2002) Structure
of the full-length HPr kinase/phosphatase from Staphylococcus
xylosus at 1.95 A
˚
resolution: mimicking the product/substrate of
the phosphotransfer reactions. Proc.NatlAcad.Sci.USA99,

3458–3463.
19. Allen, G.S., Steinhauer, K., Hillen, W., Stu
¨
lke, J. & Brennan, R.G.
(2003) Crystal structure of HPr kinase/phosphatase from Myco-
plasma pneumoniae. J. Mol. Biol. 326, 1203–1217.
20. Nessler, S., Fieulaine, S., Poncet, S., Galinier, A., Deutscher, J. &
Janin, J. (2003) HPr kinase/phosphorylase, the sensor enzyme of
catabolite repression in Gram-positive bacteria: structural aspects
of the enzyme and the complex with its protein substrate.
J. Bacteriol. 185, 4003–4010.
21. Galinier, A., Lavergne, J P., Geourjon, C., Fieulaine, S., Nessler,
S. & Jault, J M. (2002) A new family of phosphotransferases with
aP-loopmotif.J. Biol. Chem. 277, 11362–11367.
22. Sambrook, J., Fritsch, E.F. & Maniatis, T. (1989) Molecular
Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, NY.
23. Schirmer, F., Ehrt, S. & Hillen, W. (1997) Expression, inducer
spectrum, domain structure, and function of MopR, the regulator
of phenol degradation in Acinetobacter calcoaceticus NCIB8250.
J. Bacteriol. 179, 1329–1336.
24. Scha
¨
gger, H. & von Jagow, G. (1987) Tricine-sodium dodecyl
sulfate-polyacrylamide gel electrophoresis for the separation of
proteins in the range from 1 to 100 kDa. Anal. Biochem. 166,
368–379.
25. Bradford, M.M. (1976) A rapid sensitive method for the quanti-
fication of microgram quantities of protein utilizing the principle
of protein dye binding. Anal. Biochem. 72, 248–254.

26. Hanson, K.G., Steinhauer, K., Reizer, J., Hillen, W. & Stu
¨
lke, J.
(2002) HPr kinase/phosphatase of Bacillus subtilis: expression of
the gene and effects of mutations on enzyme activity, growth and
carbon catabolite repression. Microbiology 148, 1805–1811.
27. Winzor, D.J. & Sawyer, W.H. (1995) Quantitative Characterisa-
tion of Ligand Binding, New York: John Wiley & Sons.
28. Lavergne, J P., Jault, J M. & Galinier, A. (2002) Insights into the
functioning of Bacillus subtilis HPr kinase/phosphatase: affinity
for its protein substrates and role of cations and phosphate. Bio-
chemistry 41, 6218–6225.
29. Pompeo, F., Granet, Y., Lavergne, J P., Grangeasse, C., Nessler,
S., Jault, J M. & Galinier, A. (2003) Regulation and mutational of
the HPr kinase/phosphorylase from Bacillus subtilis. Biochemistry
42, 6762–6771.
30. Frey, N., Nessler, S., Fieulaine, S., Vaillancourt, K., Frenette, M.
& Vadeboncoeur, C. (2003) The HPr (Ser) kinase of Streptococcus
salivarius: a hexameric bifunctional enzyme controlled by glyco-
lytic intermediates and inorganic phosphate. FEMS Microbiol.
Lett. 224, 67–72.
31. Steinhauer, K., Allen, G.S., Hillen, W., Stu
¨
lke, J. & Brennan, R.G.
(2002) Crystallization, preliminary X-ray analysis and biophysical
characterization of HPr kinase/phosphatase of Mycoplasma
pneumoniae. Acta Crystallogr. Sect. D 58, 515–518.
32. Saraste, M., Sibbald, P.R. & Wittinghofer, A. (1990) The P-loop: a
common motif in ATP- and GTP-binding proteins. Trends Bio-
chem. Sci. 15, 430–434.

33. Tian, G., Yan, H., Jiang, R T., Kishi, F., Nakazawa, A. & Tsai,
M D. (1990) Mechanism of adenylate kinase: are the essential
lysines essential? Biochemistry 29, 4296–4304.
34. Ramstro
¨
m, H., Sanglier, S., Leize-Wagner, E., Philippe, C., van
Dorsselaer, A. & Haiech, J. (2003) Properties and regulation of the
bifunctional enzyme HPr kinase/phosphatase in Bacillus subtilis.
J. Biol. Chem. 278, 1174–1185.
35. Vertommen, D., Bertrand, L., Sontag, B., Di Pietro, A., Louckx,
M.P., Vidal, H., Hue, L. & Rider, M.H. (1996) The
ATP-binding site in the 2-kinase domain of liver 6-phosphofructo-
2-kinase/fructose-2,6-bisphosphatase. J. Biol. Chem. 271, 17875–
17880.
36. Matte, A., Tari, L.W., Goldie, H. & Delbaere, L.T. (1997)
Structure and mechanism of phosphoenolpyruvate carboxykinase.
J. Biol. Chem. 272, 8105–8108.
374 M. Merzbacher et al.(Eur. J. Biochem. 271) Ó FEBS 2003