Báo cáo khoa học: Distribution of the lipolysis stimulated receptor in adult and embryonic murine tissues and lethality of LSR–/– pdf

Distribution of the lipolysis stimulated receptor in adult and
embryonic murine tissues and lethality of LSR–/– embryos
at 12.5 to 14.5 days of gestation
Samir Mesli
1
, Sandrine Javorschi
1,
†, Annie M. Be
´
rard
1
, Marc Landry
2
, Helen Priddle
3
, David Kivlichan
3
,
Andrew J. H. Smith
3
, Frances T. Yen
4
, Bernard E. Bihain
4
and Michel Darmon
1
1
Laboratoire de Biochimie et de Biologie Mole
´
culaire, Universite
´

Victor Se
´
galen Bordeaux 2, France;
2
INSERM E358, Universite
´
Victor Se
´
galen Bordeaux 2, France;
3
Gene Targeting Laboratory; Center for Genome Research, University of Edinburgh, Scotland;
4
Laboratoire Me
´
decine et The
´
rapeutique Mole
´
culaire, Vandoeuvre-les-Nancy, France
The lipolysis stimulated receptor (LSR) recognizes apo-
lipoprotein B/E-containing lipoproteins in the presence of
free fatty acids, and is thought to be involved in the clearance
of triglyceride-rich lipoproteins (TRL). The distribution of
LSR in mice was studied by Northern blots, quantitative
PCR and immunofluorescence. In the adult, LSR mRNA
was detectable in all t issues teste d exce pt muscle and h eart,
and was abundant in liver, lung, intestine, kidney, ovaries
and testes. During embryogenesis, LSR mRNA was
detectable at 7.5 days post-coitum (E7) and increased up to
E17 in parallel to p rothrombin, a liver marker. In adult liver,

immunofluorescence experiments s howed a s taining at the
periphery of hepatocytes as well as in fetal liver at E12 and
E15. These results are i n agreement with the assumption that
LSR is a plasma membrane receptor involved in the clear-
ance of lipoproteins by liver, and suggest a possible r ole in
steroidogenic organs, lung, i ntestine and kidney). To explore
the role of LSR in vivo,theLSR gene was inactivated in 129/
Ola ES cells by removing a gene segment containing exons
2–5, and 129/Ola-C57BL/6 m ice b earing the deletion were
produced. Although heterozygotes appeared normal, LSR
homozygotes were not viable, with the exception of three
males, while the total progeny of genotyped wild-type and
heterozygote pups was 345. Mortality of the homozygote
embryos was observed between days 12.5 and 15.5 o f ges-
tation, a time at which their liver was much smaller than that
of their littermates, indicating that the expression of LSR is
critical for liver and embryonic development.
Keywords: lipoprotein receptors; Northern-blot; quantita-
tive PCR; immunofluorescence; gene-targetting.
Lipids, absorbed exogenously by the intestine and synthe-
sized endogenously by the liver, are secreted into the
circulation as lipoproteins for their transport to tissues,
where they are used mainly for membrane synthesis,
steroidogenesis and fat storage. Dietary cholesterol, phos-
pholipids, triglycerides (TG) and fat-soluble vitamins
absorbed by the intestine after a meal are transported by
chylomicrons into lymph, then into blood. Lipoprotein
lipase (LPL), anchored to the surface of capillary endothe-
lium, hydrolyzes TG of chylomicrons into free fatty acids
(FFA) that are taken u p by the underlyi ng muscle and

adipose tissues. Chylomicron remnants are then taken up by
the liver [1]. Transport of lipids to tissues is achieved by very
low density lipoproteins (VLDL) and low density lipo-
proteins (LDL). Excess cholesterol is removed from the
peripheral cells b y high density lipoproteins ( HDL) that are
able to return it to the liver for excretion via the LDL receptor
(LDLR) or the scavenger receptor class BI (SR-BI) path-
ways. In the same way, HDL are also involved in the delivery
of cholesterol to certain tissues, mainly steroidogenic organs.
Apolipoprotein (apo) B and E containing-VLDL and
chylomicron remnants bind with high affinity to the LDLR
and the LDL receptor related protein (LRP) that mediates
endocytosis of both particles. However, another p lasma
membrane lipoprotein receptor genetically distinct from the
LDLR an d L RP, c alled t he lipolysis-stimulated receptor
(LSR) may also be involved in the clearance of TRL [2,3].
The LSR was originally identified by its ability to bind
LDL in the presence of FFAs [4]. LSR polypeptides (85 and
115 k Da) were identified by ligand b lotting in the presence
of oleate in fibroblasts isolated from a patient with familial
hypercholesterolemia [2]. T hree bands of 90, 115, and
240 k Da were found when solubilized rat liver me mbrane
proteins were used as a substrate [ 5]. W hen a ntibodies
inhibiting LSR function were u sed for Western blotting, the
Correspondence to Y. M. Darmon, Universite
´
Victor Se
´
galen Bor-
deaux 2, Laboratoire de Biochimie et de Bi ologie Mole

´
culaire, Zone
Nord – Case 49–146, Rue Le
´
o Saignat, 33076 Bordeaux Cedex,
France. Fax: + 33 5 5 7 57 1397, Tel.: + 33 5 57 57 15 79.
E-mail:
Abbreviations: apo, apolipoprotein; FFA, free fatty acids; GAPDH,
glyceraldehyde-3-phosphate dehydrogenase; HDL, high density lipo-
proteins; LDL, low density lipoproteins; LDLR, low density lipo-
protein receptor; LRP, low density lipoprotein receptor related
protein; LSR, lipolysis stimulated receptor; SR-BI, scavenger receptor
BI; TG, triglycerides; TRL, triglyceride-rich lipoproteins; VLDL, very
low density lipoproteins.
Present address : Invitrogen C orp. 1610 Faraday Avenue, Carlsbad,
CA 92008, U SA.
(Received 1 April 2004, revised 6 May 2004, accepted 19 May 2004)
Eur. J. Biochem. 271, 3103–3114 (2004) Ó FEBS 2004 doi:10.1111/j.1432-1033.2004.04223.x
same three bands were detected. Molecular cloning of the
LSR allowed the authors to identify putative t ranslation
products of 58.3, 63.8, and 65.8 kDa. The combination of
various techniques suggested that the receptor was a
multimer of subunits associated through disulfide bridges
[5]. Several characteristics of LSR suggest that it might
represent a significant element for the clearance of TRL: (a)
LSR is able t o bind lipoproteins containing apoB and apoE;
(b) LSR displays high affinity for T RL; (c) LSR b inding is
inhibited by lactoferrin, receptor associated prote in ( RAP),
and apoCIII, all reported to have a hyperlipemic effect in
animals [2,3] [6,7]; (d) the apparent number of LSR binding

sites expressed a t the surface of hepatocytes correlates
negatively with plasma triglyceride levels measured in the
postprandial stage [3].
The present work was u ndertaken to determine the
distribution of LSR mRNA and protein in murine organs,
and whether this distribution was c ompatible with the
alleged role of this new receptor as a lipoprotein receptor. It
was found that LSR was not only expressed in liver (adult
and fetal), but also in steroidogenic organs (ovaries, testes,
and adrenal glands), lung, intestine, kidney and brain. To
explore further the role of LSR, the gene was inactivated in
ES c ells and a strain of transgenic LSR knockout mice was
established. However, from a total progeny of 345 mice
derived from intercrossing LSR heterozygote (LSR+/–)
animals, only three viable homozygote (LSR–/–)animals
were obtained, so that a comprehensive description of their
phenotypic defects was impossible to produce. Most
LSR–/– mutants di e in utero between embryonic days 12.5
(E12.5) and E15.5. At E14.5, LSR–/– mutant mice livers
were found to be much smaller than that of their littermates.
Therefore, inactivation of LSR appears to be lethal at the
embryonic stage, probably secondary to liver involution.
Materials and methods
Animals used for expression studies
Normal C57Bl/6, 129/Sv, and M F1 mice were obtained
from CERJ (Le G enest Saint-Isle, France). They w ere
housed in a specific pathogen-free animal facility on a 12-h
light : 12-h dark cycle, with free access to food and water.
The research protocol was in accordance with French
Ministry of Agriculture , section o f Health a nd Animal

Protection (approval 04476).
Northern blots
Mouse embryo and adult multiple tissue Northern blots were
performed with nylon membranes blotted to gels loaded with
2 lg mRNA per lane (Clontech, Saint-Quentin en Yvelines,
France). They were prehybridized for 30 min at 68 °Cin
Express Hyb TM hybridization solution ( Clontech) and then
hybridized for 2 h at 68 °C with t he same solution supple-
mented with the appropriate radiolabeled cDNA probes.
The glyceraldehyde-3-phosphate dehydrogenase (GAPDH)
probe (500 bp fragment) was prepared by No tIandEcoRI
digestion o f the murin e cDNA inserted in PT7T3d plasmid
(IMAGE clone 113843, UK HGMP Resource Centre,
Cambridge, UK). The LSR probe (full length 2 kb insert)
was prepared by EcoRI digestion o f the murine cDNA
inserted in pGEMT-easy 5Zf(–) (a gift from Genset, La Jolla,
CA, USA). Probes were labeled by decanucleo tide-mediated
incorporation of [
32
P]dCTP[aP] (Ambion, Montrouge,
France). Blots were rinsed three times with 2· NaCl/Cit,
0.05% SDS at room temperature for 30 min and washed
twice with 0.1· NaCl/Cit, 0.1% SDS at 50 °Cfor40min
with agitation. Autoradiography was performed by expo-
sure for 2 h in a PhosphorImager (Molecular Dynamics,
Amersham–Pharmacia–Biotech, Orsay, France).
Real-time RT-PCR
Mouse tissues were pooled from 4 to 5 mice on a standard
diet. Samples were immediately put into Trizol (Gibco
BRL, Cergy-Pontoise, France)andstoredat)80 °C

pending RNA isolation. Total RNAs were isolated accord-
ing to the manufacturer’s instructions. The amount of RNA
was determined by measuring absorption at 260 nm. The
quality o f the isolated RNA was controlled by the 260/
280 n m ratio (1.8–2.0).
cDNAs were obtained by reverse-transcription of 1 lg
total RNAs prepared from C 57BL/6 mouse tissues. RNAs
were first treated by RQ1 RNase-Free DNase (Promega,
Charbonnie
`
res, France). First strand cDNA synthesis was
performedina20lL mixture using the GeneAmp RNA
PCR kit (Applied Biosystems, Courtaboeuf, France). For
some tissues, total cDNAs were also obtained from Clontech.
Specific primers and TaqMan probes were designed u sing
the
PRIMER EXPRESS
1.0 software (Applied Biosystems) and
synthesized by Genset (Paris, France). Each probe was
double-labeled with the fluorescent reporter dye, 6-carb-
oxyfluorescein ( FAM), c ovalently linked to the 5 ¢-end of the
probe and t he quencher dye, 6-carboxytetramethylrhodam-
ine(TAMRA),attachedtothe3¢-end. Quantitative PCR
was performed in 96-well reaction plates with optical caps.
Fluorescence was followed continuously for each r eaction.
Real-time quantitative RT-PCR analyses w ere performed in
an ABI P RISM 5700 sequence detection system i nstrument
(Applied Biosystems). The reaction mixture contained an
amount of cDNA corresponding to 100 ng of reverse-
transcribed total RNA, 300 n

M
sense and antisense p rimers
(except for GAPDH, 120 n
M
of each) and 200 n
M
probe in a
final volume of 25 lL using the TaqMan PCR mix (Applied
Biosystems). Relative quantitation of a given gene w as
calculated after normalization to 18S ribosomal RNA
amount for tissues from which RNAs were i solated ( liver,
ovaries, adrenal g lands, testes, intestine, brain, muscle), or
GAPDH amount for tissues for which total cDNA were
purchased (liver, lung, kidney, heart). Individual C
T
values
are means of duplicate measurements. Delta C
T
were
converted to arbitrary values with the f ormula: arbitrary
units ¼ 2
)dC
T
· 10
6
assuming an efficiency of amplification
of 100%. Results are expressed as the mean of two
experiments. The complete list of gene-specific primers
and probes can be found in Table 1 . It must be noted that
the quantitative P CR was d esigned to d etect the sum of all

transcripts of LSR.
Antibodies and immunocytochemistry
The a nti-LSR Ig used for this study was a gift from Genset
(La Jolla, CA, USA) [5]. The antiserum raised in New
3104 S. Mesli et al.(Eur. J. Biochem. 271) Ó FEBS 2004
Zealand rabbits was a ble to inhibit the in vitro binding of
LDL to LSR preparations. In Western blots or immuno-
precipitations it recognized the same bands that were
identified by ligand blotting ( 90, 115 and 240 kDa) and
by Western blotting. Negative controls were prepared by
substituting the anti-LSR serum by nonimmunized or
irrelevant rabbit sera. In some experiments, tissues from
surviving male homozygous LSR knockout mice were
included as negative controls.
Adult mouse tissues and post implantation embryos
(E12.5 and E15.5) were fixed in 4% paraformaldehyde
overnight, freezed in Tissue-Tek (Labonord, Templemars,
France) and se ctioned with a cryotome (10 lm sections)
onto Superfrost coated slides (Labonord).
Tissues were i ncubated for 30 min in phosphate-buffered
saline (NaCl/P
i
) containing 0 .5% bovine s erum albumin
(BSA), washed 3 · with NaCl/P
i
and incubated in anti-LSR
serum (1 : 10 in NaCl/P
i
/BSA) for 2 h at 37 °C. The sections
were washe d in NaCl/P

i
and i ncubated w ith fluorescein-
conjugated goat anti-rabbit IgG (Molecular Probes/Inter-
chim, Montluc¸ on, France) 1 : 200 in NaCl/P
i
-BSA for 1 h at
37 °C. The sections were the n washed 3· in NaCl/P
i
before
mounting in Prolong
TM
Antifade (Molecular Probes/Inter-
chim). Slides were examined with a Leica photomicroscope
using appropriate filter systems. P hotographs were taken on
Kodak films (Amersham–Pharmacia–Biotech).
Gene targeting of the
LSR
gene and generation
of LSR deficient mice
The murine (C57BL/6) LSR gene contains 10 coding exons
with an open reading frame of 1782 nuclotide long encoding
a peptide of 594 amino acids (F. T. Yen & B. E. Bihain,
unpublished results). A129/Ola mouse genomic lambd a
2001 library was screened with a full length LSR cDNA
probe to isolate cloned DNA for the targeting v ector
construction. Several o verlapping phage clo nes, which
together covered the most part of the gene, were isolated
and inserts sequenced. This sequence (GenBank AY376636)
contained the first eight exons and ends 19 bp before the
end of exon 9 of the LSR gene; it lacks all of intron 9 and

exon 10. Altogether this sequence lacks the portion coding
for the last 17 amino a cids of LSR. A r eplacement targeting
vector (map, Fig. 1). was designed subsequently to create
a null allele by deletion of an internal region of the gene
between the 5¢-end of exon 2 and the 3¢-end of exon 5 and its
substitution with a reporter (b-galactosidase) and selection
marker (neomycin resistance). This vector was comprised
of left and right homology arms, which consisted of 2.65 kb
of cloned genomic DNA sequence containing the 5¢-
part of exon 2, intron 1, exon 1 and its 5¢-flanking
noncoding sequence, and 2.7 kb of sequence containing
the 3 ¢-part of exon 5 and 3¢-flanking intron 5 s equence,
respectively. These were i nserted into a pBluescript plasmid,
with the e xon 2 and 5 sequences joined via a BamHI
linker. The reporter/selection cassette TAG3/IRES lacz/
SV40pA/MC1neo/pA [8] was inserted into the BamHI
linker site. A MC1-tk dimer cassette [ 9] was appended to the
end of the 5¢-homology arm at a SalI site for negative
selection [10]. The vector was linearized with NotI, and
E14TG2a embryonic stem c ells cultured according to
standard conditions [11] were electroporated and selected
in G418 and gancic lovir. R esistant ES cell clones were
picked in to 96-well plates, and replica plated subsequently
for freezing and DNA preparation. ES cell clone DNAs
were screened by Southern blot analysis using HindIII
digestion and hybridization with probes fl anking and
external to the vector homology arms (Fig. 1). Clones
targeted correctly at both 5¢-and3¢-sides were detected at a
frequency of 12%. Targeted ES cells we re injected into
C57BL/6 b lastocysts and t he resulting male chimeras

subsequently test-crossed with C 57BL/6 females. Germline
transmission from chimeras derived with t wo independ ent
targeted clones was confirmed in agouti coat colored
Table 1. Sequences of primers and probes used for real-time PCR with the TaqMan system. NC, sequences no t communicated by Perkin Elmer.
mRNA Upstream primer (5¢fi3¢) Probe (5¢fi3¢) Downstream primer (5¢fi3¢) Amplicon size (bp)
LSR atgcgtcctccctatgggtac tggagactttgacaggaccagctcagttg acctgggagctgtggcc 71
(exons 6–7)
LDLR
X64414
ctgtccccccaagacgtg caagtgcatctccccgcagtttgtgt ccatctaggcaatctcggtctc 102
(430–531of 4467)
LRP
AF074265
gtcccattggctttgagctc tcgaggagagcggatatcagacgcatatc gccacattgttgttgtttgtttc 124
(1926–2049 of 5521)
SRB1
U37799
tgatgatgaccttggcgct caccatgggccagcgtgcttt gggaagcatgtctgggagg 131
(520–650 of 1785)
ApoB
M35186
cgtgggctccagcattcta ccaatggtcgggcactgctcaa tcatttctgcctttgcgtcc 65
(771–835 of 2354)
ApoE
D00466
attacctgcgctgggtgc tgaccaggtccaggaagagctgca gtcagttcttgtgtgacttgggag 79
(134–212 of 936 CDS)
Apo A1
X64262
gacactctgggttcaaccgttagt ctgcaggaacggctgggccc ttcctctaggtccttgttcatctcc 126

(268–393 of 924)
Prothrombin
X52308
tacatagacgggcgcatcg agggctgggacgctgagaagggtat aaaaagcatcacctgccagg 72
(1084–1155 of 2031)
Ubiquitin
X51703
ggtggctattaattattcggctg attcccagtgggcagtgatggcattac gggcaagtggctagagtgca 75
(1010–1084 of 1172)
GAPDH NC NC NC  190
18S rRNA NC NC NC  200
Ó FEBS 2004 LSR gene and protein expression (Eur. J. Biochem. 271) 3105
test-cross offspring by Southern blot analysis of DNA
obtained from tail biopsy. Male and female test-cross
offspring heterozygous for the null allele were intercrossed
to o btain formal proof of the creation of the null allele and
for preliminary phenotypic asse ssment. The LSR deficient
strain was maintained by back-crossing heterozygous males
with C57BL/6, 129/Sv and MF1 females a t e ach generation.
Mice at back-cross generati on 1–6 were intercrossed to
provide t he homozygous null, heterozygous null and wild-
type mice used in the analyses d escribed herein.
Animal breeding and experiments were c arried out in
accordance with the European Communities Council
Directive of 24 November 1986.
Genotyping of
LSR
and
neo
genes by PCR

For PCR, genomic DNA from embryos and adult m ouse
tails was extracted by proteinase K digestion, isolated using
the Genomic DNA Purification Kit (Promega, Charbonnie
`
-
res, France) and p recipitated with ethanol. PCR primers
were selected to generate a product specific for either the
wild-type or the mutant LSR allele. The wild-type LSR
allele was diagnosed by a 773-bp PCR product g enerated by
a f orward primer located in e xon 4 (5¢-CAGGACC
TCAGAAGCCCCTGA-3) and a reverse primer located
in exon 5 (5¢-AACAGCACTTGTCTGGGCAGC-3¢). This
region of the LSR gene is deleted in the mutant allele. The
Fig. 1. Generation of the LSR null allele. (A) Structure of the mouse LSR gene (top), the linearized LSR targeting vector (middle) and the targeted
allele (bottom) resulting from replacement recombination. The null allele was created by deletion of a 9.8 kb in ternal region of the gene from the
beginning of exon 2 to the end of exon 5 and its substitu tion with a b-galactosidase/neomycin phosphotransferase reporter/selection cassette.
Dashed crosse s indicate the recombination cross-over positio ns between homologous vector and c hromosomal sequence. Chrom osomal and cloned
genomic DNA sequence is shown by a thick black line (for intron and flanking nonc oding sequence) and by black rectangle s (for exon sequence),
the reporter/positive selection cassette by IRES laczpA and grey (loxP/MC1neopA loxP
)1
) rectangles, the HSV thymidinekinasenegativeselection
cassette (MC1tk dimer) by a rectangle and p Bluescript plasmid sequence by a thin black line. Sites fo r HindIII restriction enzyme (H)areindicated
by small arrows and t he sizes of relevant restriction fragments in th e wild-type and targeted allele are shown by dotted lines. The targeted allele was
identified by HindIII digestion and hybridization with the 5¢-and3¢-flanking probe fragments (striped rectangles) to detect the indic ated size
fragments. (B) Southern blot analysis of Hin dIII-digested genomic DNA prepared from 96-well p lates of G418+ G ancyclovir resistant ES cell
clones derived from transfection w ith the LSR targeting vector. The digested DNA and a kHindIII marker was resolved o n a 0.6% agarose gel,
blotted to positively charged nylon membrane and hybridized with 25 ng of 3¢-probe and 25 ng of kHindIII marker. The hyb ridized blots were
exposed to Ko dak XOMAT film overnight at )80 °C. The 3¢-probe detects a 10.5 kb HindIII fragment for the w ild-type allele and a 13 kb
fragment in a targeted a llele.
3106 S. Mesli et al.(Eur. J. Biochem. 271) Ó FEBS 2004

targeted mutant allele was detected by the presence of the
neo gene. Two couples of neo primers have been used during
the course of this work: (forward: 5¢-GGCGCCCGG
TTCTTTTTGTCA-3¢ and r everse: 5 ¢-TTGGTGGTCG
AATGGGCAGGT-3¢ giving a p roduct o f 281 bp) and
(forward: 5¢-GAGGATCTCGTCGTGACCCATG-3¢ and
reverse: 5¢-GAGGAAGCGGTCAGCCCATT-3¢ giving a
product of 179 bp). For the wild-type LSR gene, c onditions
were (94 °C for 30 s, 63 °Cfor1min,72°Cfor30s;35
cycles. For the neo gene, PCR conditions were: 95 °Cfor
30 s, 68 °C for 1 min, and 72 °C for 30 s; 33 cycles. In both
cases, PCR cycles were preceded by 10 min at 95 °Cand
endedby7minat72°C.
Results
To obtain insight on the possible function(s) of LSR, we
first determined the tissue d istribution of i ts mRNA in
organs of adult mice in comparison with that of mRNA o f
other lipoprotein r eceptors o r apolipoproteins. W e a lso
determined the amount of LSR mRNA at different time
points of embryonic development.
Northern blots
Figure 2A shows a Northern blot of selected adult murine
tissues hybridized with an LSR probe. As expected from
results obtained in the rat [5], a 2.1 kb band was observed
in liver. A faint but clean band was also observed in testis
and kidney. Hybridization with a GAPDH probe showed
unequal loading of the c ommercial membrane and partic-
ularly that the liver lane was overloaded. Quantitation of the
amount of LSR mRNA was thus performed after normal-
ization of the radioactivity of the LSR bands to that of the

1.35 kb GAPDH band. Data showed that testes and kidney
contained, respectively, 63% and 48% of the signal present
in liver. Figure 2 B shows a Northern blot containing
mRNA from whole embryos at stages E7, E11, E15, and
E17 hybridized with an LSR probe and reprobed with a
GAPDH cDNA. The 2.1 kb LSR band was detected at all
stages. Again, loading of the lanes w as unequal making
direct quantification difficult. As in the case of adult tissues,
we normalized LSR bands to the corresponding 1.35kb
GAPDH bands. Ratios were approximately equal at all
stages, indicating that the LSR expression level was of the
same order of magnitude between E7 and E 17.
Real-time quantitative RT-PCR
In a first selection of tissues (liver, o varies, adrenal glands,
testes, intestine, brain and muscle), LSR mRNA was
extracted as described in Materials and methods. Results
obtained by real-time quantitative RT-PCR were normal-
ized to the amount of 18S ribosomal RNA (Fig. 3A and
Table 2). Quantitative PCR was also performed on lung,
kidney and heart s amples, but in that case the starting
material was commercially available total cDNA. For those
tissues, data were normalized to the amount of GAPDH
mRNA (Fig. 3B and Table 3).
Liver c DNAs were obtained from both the mRNA
extracted in our laboratory and from the commercial source
in order to allow us to compare the two sets of experiments.
Figure 3A and Table 2 show that LSR mRNA is very
abundant in liver, as expected from t he Northern blot
analysis. We also found a significant expression in ovaries
and testes (respectively 62.8%, and 21.7% of liver), but the

Fig. 2. Northern blots of adult murine t issues
(A) and whole embryos (B) mRNAs. E7, E11,
E15, E17: em bryo stages (days post-coitum).
The LSR probe reveals a 2.1 kb band, and the
GAPDH probe a 1.35 kb band and (in some
tissues) a 1.2 kb band.
Ó FEBS 2004 LSR gene and protein expression (Eur. J. Biochem. 271) 3107
amount in adrenal glands was only 4 % of that o f liver.
A substantial expression was found in intestine and brain
(respectively 41.9% and 15.9% of liver). The expression in
muscle was very low (0.5% of liver). Figure 3B and Table 3
show that LSR mRNA is rather abundant in lung and
kidney (55.8% and 11.8% of liver) but barely detectable in
heart.
The distribution of several gene mRNA involved in
lipoprotein metabolism w as stu died co mparatively as an
attempt to get some insight into the possible functions of
LSR. The tissue distribution of LDLR mRNA (Tables 2 and
3) is not very different from that of LSR mRNA, w ith t wo
notable exceptions: ( a) it was more a bundant in ad renal
glands and o varies than in liver (respectively 200%, and
180% of liver); (b) it was abundant in muscle (41.2% of liver).
The pattern of expression of SR-BI mRNA (Tables 2 and
3) was rather different from that of LSR mRNA: ( a) it was
extremely abundant in adrenal glands and ovaries (respect-
ively 46.5-fold and 18-fold the amount present in liver);
(b) expression in testes, brain and muscle was rather
abundant (respectively 1 15%, 122.2% and 55.8% of the
amount present in liver).
The tissue distribution of LR P mRNA in adult mice

(Tables 2 and 3 ) was also very different from that of LSR:
its amount in ovaries, adrenal glands, brain and muscle was
higher than that of liver (respectively 410%, 1 90%, 180%,
and 250% of the amount present in liver).
Although RT-PCR arbitrary units do not reflect
precisely tr ue message amounts , d ue to the different
amplification efficiencies for different gene targets, t aken
altoget her, the results suggest that the amount of LSR
messengers in liver is higher than that of the o ther
receptors here described. It must be noted that Fig. 3A
and B have different scales because one was normalized
to 18S ribosomal RNA and the other to GAPDH
mRNA.
Several mRNA species were used as con trols for tissue-
specific expression. As expected, prothrombin mRNA was
almost exclusively expressed in liver; apoA1 and apoB
mRNA were expressed mainly in liver but also in intestine;
apoE mRNA was predominant in liver but abundant in all
tissues; u biquitin and GAPDH mRNA were ubiquitous,
and showed important variations of expression from one
tissue to another.
The expression of LSR was also studied by quantitative
PCR during mouse embryonic d evelopment. cDNAs from
whole embryos at E7, E11, E15, E17 stages were used as
starting material and results were normalized to GAPDH
mRNAs. Figure 3C shows that LS R was d etectable at E7,
became more abundant at E11 (fourfold increase) and
maintaining these increased levels until E17. This pattern of
expression seems t o parallel liver growth as a similar t ime-
course was observed for prothrombin. Table 4 shows that in

contrast, LDLR and SR -BI mRNA had d ifferent time-
courses with a higher amount at E7, followed by a decrease
at E11 and an increase at E15. LRP showed a t ime-course
similar to t hat of LSR excep t for a decrease at E17; apoA1,
apoB and ubiquitin showed a time-course similar to that of
LRP.
Immunofluorescence
To localize the LSR receptor itself, different murine tissues
were studied by indirect immunofluorescence with an anti-
LSR antiserum. To avoid misinterpretations due to back-
ground, two normal rabbit sera were systematically included
in the labeling experiments. Moreover, tissues from LSR
knockout mice were also tested with the anti-LSR anti-
serum. Figure 4A,B shows the presence in adult liver of a
strong specifi c signal at the periphery of hepatocytes. This
staining pattern is compatible with the previously described
localization of LSR at the plasma membrane l evel [5]. The
presence of LSR could also be detected in fetal liver cells in
E12 and E15 embryos (data not shown). A faint but specific
staining was detected in k idney Fig. 4E. The s ignal w as
observed in the kidney cortex, mainly at the level of
glomerules.
Fig. 3. Quantitation of LSR mRNA by real-time PCR i n adult murine
tissues ( A,B) and w hole post-implantation embryos (C). Data were
normalized to 18S ribosomal RNA (A) and to GAPDH mR NA (B, C).
dC
T
were converted to arbitrary values by the following formula:
2
)dC

T
· 10
6
. Liver (L), o varies (o), adrenal glands (a), testes (t), intes-
tine (i), brain (b) and muscle (m), l ung (lu), kidn ey (k) and heart (h).
E7, E11, E 15, E17: Embryo stages (days post-coitum).
3108 S. Mesli et al.(Eur. J. Biochem. 271) Ó FEBS 2004
Knock-out of the
LSR
gene
Mice with one LSR allele inactivated did not show any
detectable defect. Their size, weight, adiposity, plasma
glucose, cholesterol, triglycerides, phospholipids, nonesteri-
fied fatty acids, free glycerol, as w ell as their lipoprotein
profile were similar to those of their wild-type littermates.
Animals bearing two i nactivated LSR alleles (LSR–/–)
show an embryonic lethality between E12.5 and E15.5. As
an attempt to define the reason for the embryonic lethality
of LSR–/– embryos, timed matings were set up and
resulting embryos examined and genotyped (Table 5 and
Fig. 5). Up to E12.5, LSR–/– mice were obtained in
numbers compatible with Mendelian ratios, and macro-
scopic e xamination of t he whole litters showed that all
embryos were alive and had no observable anomalies. But
at E15.5, genotyping did not show the presence of viable
homozygote embryos. Resorbed embryos were numerous at
E14.5/15.5 and the majority were most probably LSR–/–,
but we were not able to genotype them because of DNA
degradation. At E14.5, some litters contained LSR–/–
embryos. Their only c onstant defect was a reduction in liver

size (Fig. 6A); in some embryos, the liver was reduced to a
punctiform red spot (not shown). Histological sections of
E14.5 LSR–/– embryos showed that the cell density was
lower than in the wild-type littermates. Spaces devoid of
cells were observed, but no specific cellular abnormalities or
absence of certain cell types were ob served in the liver of the
mutants. For example, megacaryocytes, although rare
(Fig. 6 E), c ould be found in LSR–/– embryos (not shown).
LSR–/– embryos had other anomalies but they were not
constant: a general white coloration, while the LSR+/+
and LSR+/– littermate e mbryos had a pinkish hue;
superficial hemmorrhages (Fig. 6A), superficial detachment
of the skin (Fig. 6A); a smaller size than their littermates
and finally some of them were obviously dead. Interestingly
homozygote embryos did not show an overall d evelopmen-
tal delay, as s hown by limb bud, eye and facial development
(Fig. 6 A).
During the last three years, no viable adult LSR–/– was
obtained by intercrossing LSR+/– mice. However in the
very first litters obtained b y intercrossing male LSR+/–
derived from t he chimeras with female LSR+/– derived
Table 2. Quantitation of LSR, LDLR, SR-BI, LRP, apoA1, apoB, apoE, ubiquitin, prothrombin,andGAPDH mRNAs by real-time PCR in a first set
of adult murine tissues. For e ach gene, results were normalized t o 18S ribosomal RNA. dC
T
wereconvertedtoarbitrary values by the following
formula: 2
)dC
T
· 10
6

.
mRNA
Tissue
Liver Ovaries Adrenal glands Testis Intestine Brain Muscle
LSR 710 446 28.5 154 298 113 3.61
LDLR 83.4 150 167 10.7 68.8 63.8 34.4
SRBI 77.8 1390 3620 89.7 16.5 95.1 43.4
LRP 22.2 91 41.7 5.5 9.8 40.6 55.8
ApoAI 244 0.79 0.04 0.06 57.1 0.04 0.06
ApoB 16900 0.3 5.5 1.5 1630 0.4 0.1
ApoE 83000 4830 7490 899 854 13900 1190
Ubiquitin 478 1840 2780 6050 343 3830 1490
Prothrombin 9490 0.5 1.8 0.4 9.8 0.1 0.8
GAPDH 1780 5910 3700 321 321 19800 51100
Table 3. Quantitation of LSR, LDLR, SR-BI, LRP, apoA1, apoB,
apoE, ubiquitin, and prothrombin by real-time PCR in a second set
of adult murine tissues. For each gene, results were normalized to
GAPDH mRNA. DC
T
were converted to arbitrary values by the
following formula: 2
)dC
T
· 10
6
.
mRNA
Tissue
Liver Lung Kidney Heart
LSR 67500 37700 7980 303

LDLR 15400 13300 2630 141
SRBI 3740 20200 144 95.6
LRP 538 1150 911 125
ApoAI 3380 46.6 4.86 3.58
ApoB 86600 593 380 4.76
ApoE 15 700 000 717 000 93400 63400
Ubiquitin 2060 000 6770 000 966 000 63700
Prothrombin 901 000 6300 128 4.63
Table 4. Quantitation of LSR, LDLR, SR-BI, LRP, apoA1, apoB,
apoE, ubiquitin an d prothrombin by real-time PCR in whole post-
implantation embryos. For each g ene, results w ere n ormalized to
GAPDH mRNA. DC
T
were converted to arbitrary values by the fol-
lowing formula: 2
)dC
T
· 10
6
. E mbryo stages (days post-coitum.): E7,
E11, E15, E17.
mRNA
Age
E7 E11 E15 E17
Adult
Liver
LSR 1310 5680 7190 7810 67 500
LDLR 21 900 2880 4780 2560 15 400
SRBI 14 100 4160 6430 9620 37 400
LRP 9230 16 900 25 600 7440 538

ApoA1 5.82 20.6 93.8 76.7 3380
ApoB 32 3190 25 600 5340 86 600
ApoE 12 600 30 800 277 000 578 000 1 5700 000
Ubiquitin 979 000 1 580 000 3 030 000 1 060 000 2 060 000
Prothrombin 13.6 2670 40 900 114000 901 000
Ó FEBS 2004 LSR gene and protein expression (Eur. J. Biochem. 271) 3109
from the fi rst generation, or intercrossing male and female
LSR+/– mice derived from the first generation, three viable
LSR–/– mice (all males, two from one litter, and one from
another) were obtained. They had no morphological defects
except that one of them seemed to have no testes. They were
smaller than their littermates: the 9-month weight of LSR–/–
was 30.7 ± 0.2 vs. 39.3 ± 2.1 g for their wild-type litter-
mates (P<0.02). Continual matings for 3 months demon-
strated that these mice were sterile. As one of the LSR–/–
mice died spontaneously and the others became s ick
(lethargic), we killed these two animals for necropsy and
collection of organ samples; they both showed a limited
amount of fat and one of them actually had n o testes, but no
other anatomical defect was detected. To explore whether the
genetic bac kground cou ld infl uence t he viability of LSR–/–
mice, we backcrossed the mutations in two inbred strains
(C57BL/6 and 129/Sv) and an outbred strain (MF1); we also
intercrossed heterozygotes o f C57BL/6 and 129/ Sv back-
grounds, but no viable LSR–/– mice were obtained.
Discussion
In this study, we used No rthern b lotting, real-time PCR and
immunofluorescence microscopy to examine the expression
of LSR in the adult mouse and during development. In the
adult, the highest levels of LSR expression were found in

liver as expected from results obtained in the rat [5]. Several
reports published by Bihain and colleagues [2–5] have
provided circumstantial evidence for a role of LSR in the
Fig. 4. Immunolocalization of LSR in liver and
kidney. (A,B,C,E) anti-LSR serum, (D,F)
normal rabbit serum. Specific staining i s
observed at the periphery of hepatocytes o f
adult liver (A,B). No signal was observed i n
liver from one LSR–/– mouse (C). Specific
staining is also found in kidney cortex ( E)
principally at the level of glomeruli (arrows).
No staining was detected in liver (D) and
kidney (F) t reated with normal rabbit serum.
Bar in (F) relates to 20 lm (A,C,D,E,F) an d
6 lm(B).
Table 5. Embryos obtained by intercrossing LSR+/– mice. Em bryos
were genotyped as shown in Fig. 6. Living LSR–/– embryos were
found a t E10.5 and E12.5 and were apparently normal. LSR–/–
embryos could not be found at E15.5. At E14.5, living LSR–/–
embryos were found but had all a small liver (Fig. 6A). Moreover, one
litter contained two d ead LSR–/– embryos with a punctiform liver.
Genetic
background Age
No. of
embryos
No. of
litters
LSR mutants
+/+ +/– –/–
C57BL/6 E10.5 10 1 3 6 1

C57BL/6 E12.5 7 1 1 4 2
C57BL6/)129/Ola E12.5 25 3 4 14 7
C57BL/6 E14.5 10 1 3 7 0
C57BL/6 E14.5 8 1 3 3 2
a
C57BL/6–129/Ola E14.5 10 1 4 6 0
MF1 E14.5 22 2 5 11 6
C57BL/6–129/Ola E15.5 13 1 7 6 0
a
Dead embryos.
3110 S. Mesli et al.(Eur. J. Biochem. 271) Ó FEBS 2004
clearance of TRL by the liver. The LDLR and the LRP
have both been shown t o be involved in t he removal of
chylomicron remnants by the liver [12,13]. The facts that
mice with an isolated inactivation of the LDLR show no
increase in circulating TG [14], and that the lack of L DLR
in humans does not lead to a pathological change in the
metabolismofdietaryfat[15]suggestthat(an)other
receptor(s) play(s) the major part in TRL clearance by the
liver. Mo reover, Rohlmann et al. [16] demonstrated that the
absence of LRP expression in the livers of LDLR-deficient
mice resulted in a large elevation in the plasma concentra-
tion of cholesterol and TG that were carried in apo B48-
containing lipoproteins resembling remnants. Nevertheless,
in LDLR-deficient mice the increase in TG levels was much
smaller than that obtained in RAP overexpression experi-
ments [17]. The authors concluded that the most probable
explanation is t hat RAP-sensitive receptors suc h as LSR [7]
could be involved in TRL clearance. Actually, our real-time
PCR data indicate that in liver, LSR mRNA is expressed

as well as LDLR and LRP mRNA, suggesting that the
newcomer receptor could indeed play an important role in
TRL clearance by the liver. Moreover, the abundance of
LSR i n liver contrasts with its almost complete absence in
skeletal muscle and heart. In that respect LSR differs
strikingly from the VLDL r eceptor which is very abundant
in these l atter tissues and is involved together with LPL in
fatty acid uptake by striated muscle [18]. Thus, our data
indicate that LSR could be specialized in the uptake of TRL
by liver as suggested by its d iscoverers [5]. The demonstra-
tion of this hypothesis would require an analysis of the
lipoprotein phenotype of a sufficient number o f adult
LSR–/– mice (for instance after d esigning a liver-specific
inducible inactivation of the LSR gene).
Recent s tudies have suggested that cholesterol plays a
crucial role in specific processes during embryonic develop-
ment. Cholesterol deficiency during embryogenesis can be
caused by defects in apolipoproteins, enzymes or cell-
surface r eceptors that are potentially involved in cellular
lipoprotein uptake, either by cells of the yolk sack or the
placenta or by the embryo itself [19]. We have studied LSR
expression during late embryogenesis in comparison with
other lipoprotein receptors which are known to play a n
important role in embryonic development, and with
prothrombin, a liver-specific marker. Due to unequal loading
of the lanes, Northern blots were not sensitive enough to
show significant changes in LSR expression between E7 and
E17. However real-time PCR showed that LSR mRNA is
detectable at E7, becomes abundant at E11 (fourfold
increase) and remains practically constant until E17. This

can be attributed to liver organogenesis which follows a
similar time-course [20]. Moreover, LSR protein was
detected by immunofluorescence in dissected fetal livers of
E12 and E15 mice. Although our real-time PCR data show
that all lipoprotein receptors tested follow r oughly similar
time-courses between E11 and E17, LSR and LDLR are
probably the on ly receptors, among those tested to b e
present in fetal liver in substantial amounts. Actually
previous reports show that (a) the LDLR is present in rat
liver from E19 fetuses at 19% of the adult level; (b) hepatic
LRP is still low at 1 9 days of gestation (only 6% of the adult
level) [21] and (c) SR-BI is not detectable in embryonic liver
until stage E17 [22]. The increased SR-BI mRNA synthesis
that we observed between E11 and E15 is probably due to
adrenal gland organogenesis [22]. Fetal liver has been shown
to synthesize and export into t he fetal circulation about one-
half of the cholesterol required f or heart, lung and kidney
development [21, 23]. The early e xpression of LSR in fetal
liver sugge sts that this receptor could play a role in the
uptake of lipoproteins during embryogenesis, a process that
cannot be effected by SR-BI at this stage [22]. The scarcity
of LSR messages at E7 contrasts with t he high expression at
that stage o f t he other lipoprotein receptors which are
involved in exchanges between the embryo and extraem-
bryonic an d maternal tissues. For example, SR-BI present
on the apical surfaces of visceral endodermal is thought to
provide cholesterol to extraembryonic cells for s torage until
it can be subsequently transferred to the embryo [22].
Whatever the importance of LSR for post-implantation
embryo viability, it must be noted that the abundance of its

mRNA increases dramatically during adulthood (Fig. 3). It
would be interesting to determine whether it is suckling, like
in the case of LRP [21], or weaning, as in the case of LDLR
[24], which triggers the increase of LSR seen in liver, as such
an induction would be consistent with a role o f LSR in
chylomicron remnant metabolism.
The lethality of LSR–/– embryos that we observed
occurs around E12.5–14.5, a period which is concomittant
Fig. 5. Genotyping of embryos obtained by intercrossing LSR+/– mice.
PCR of diagnostic LSR (773 bp) and neo (180 bp) ge ne regions is
described in Materials and me thods. LSR –/– embryos (upper 5, 6) are
present at E12.5 but missing at E15.5.
Ó FEBS 2004 LSR gene and protein expression (Eur. J. Biochem. 271) 3111
with the appearance of specific hepatocyte function in the
fetus [25–27]. The fact that LSR–/– embryos’ livers were
smaller (and sometimes punctiform) at E14.5 but normal
size at E12.5 i ndicates that an atrophy of the liver
occurred after a first period of apparently normal growth.
Histological sections o f E14.5 LSR–/– embryo s actually
showed that the cell density was lower than in the wild-
type littermates; moreover spaces devoid of cells were
observed in the mutants. Future studies using time-specific
markers of liver development will be conducted to
compare t heir time-course in the mutant and the wild-
type mice. If the primary effect of the m utation indeed
affects liver de velopment, otherdefectssuchasthesmaller
size and even lethality of the embryo can be explained by
ischemia, as liver is the major hematopoietic organ at that
stage. Inactivations of some lipoprotein receptor genes, for
instance LRP and gp330/megalin, have also been found to

result in embryonic lethality by various mechanisms
[28,29].
We found transcripts for all the lipoprotein r eceptors
tested, including LSR, in steroidogenic organs such as
adrenal glands, testes and ovaries. This is in agreement with
results showing SR-BI to be highly expressed in steroido-
genic tissues [30,31] which are the sites of the h ighest s pecific
activity for selective HDL cholesterol uptake in rodents [32].
Nevertheless, LSR and SR-BI were expressed differently,
more in reproductive organs than in a drenal glands fo r
LSR, and inversely for SR-BI. The specific abundance of
LSR mRNA in testes suggests that this receptor c ould play
an important role in this organ. However its implication in
steroidogenesis is questionable a s SR-BI, which has also
been detected in testes, seems to mediate phagocytosis of
apoptotic spermatogenic cells by Sertoli cells after recogni-
tion of surface phosphatidylserine [33,34]. In ovaries and
Fig. 6. Gross morphology and liver histology of
atypicalLSR–/– mutant embryo compared to
a wild-type littermate. Lateral views of
E14.5 embryos (A,B). The LSR–/– embryo
(A) shows a reduction of liver size (white
arrow) and displays hemorrhages (black
arrow) contrasting w ith an anemic color. I t
also shows a detachment of dorsal skin ( small
arrows). The wild-type littermate (B) sh ows a
liver of normal size (white arrows); its skin has
a pinkish hue, distinct subcutaneous vessels
and does not show detach ment. Note that the
overall development of the mutant is not dif-

ferent from that of the wild-type as shown by
embryo size, and limb bud and eye stages.
Histological sections of livers of E14.5 em-
bryos stained with hematoxylin and eosin
(C,D,E,F). Note the presence of large inter-
cellular spaces (arrow) in the liver of the
mutant (C,E) contrasting with the normal
architecture of the wild-t ype liver (D,F). In
addition, megacaryocytes were very rare in the
mutant liver while they were easily found in
the wild-type liver [see arrow on view (F)]. Bar
in F relates to 160 lm(C,D)and40lm ( E,F).
3112 S. Mesli et al.(Eur. J. Biochem. 271) Ó FEBS 2004
adrenal glands, LSR mRNA is found to be abundant.
Previous studies have demonstrated that steroidogenesis in
the ovary d epends mainly on the selective uptake of HDL-
cholesteryl esters by SR-BI [35,36]. However, it has been
shown that rat and human luteal cells can utilize LDL and
VLDL, respectively, for steroidogenesis [37,38]. As LSR
recognizes both apoB and a poE [2], we can i magine that an
interaction between apoE-containing lipoproteins and cell
surface apoE would provide cholesterol t o ovarian and
adrenocortical cells for steroidogenesis.
Our real-time PCR data show that LSR, LDLR, SR-BI
and LRP messages are all very abundant in lung, i.e. in the
range of liver or more. Lung surfactant is a surface tension
lowering mixture of lipids and hydrophobic proteins that
lines the alveolar surface and maintains alveolar patency. Its
synthesis is critically dependent on the availability of fatty
acids. A variety of receptors, including SR-BI [39], L DLR

[40], LRP and gp330/megalin [41,42], are present on alveolar
cells and a re able to bind lipoproteins and to participate to
surfactant synthesis. Moreover there is evidence that V LDL
in the presence of lipoprotein lipase (LPL), provide the free
fatty acid substrate required for surfactant synthesis [43].
LDL and HDL are also taken up by alveolar cells [40]. It is
possible t hat LSR, along with the above-mentioned recep-
tors, participates in surfactant synthesis.
LSR mRNA was found to be relatively abundant in
kidney (12% of liver levels). Immunohistochemistry indica-
ted that LSR protein was localized in glomeruli. Glomerular
cells exhibit both VLDL receptors and LDLR [44] and are
known t o be able to take up LDL via apoB/E receptors [45].
Moreover, several pathological disorders are accompanied
by lipid deposition into glomeruli [46]. The presence of LSR
in glomerular cells might provide an additional pathway for
explaining lipoprotein uptake in normal and pathological
glomerular cells.
The abundance of LSR in fetal and adult liver as well as
in steroidogenic organs and organs such as l ung or kidney
adds further evidence to its hypothesized function in lipid
transport in these organs. Unfortunately, the scarcity of
viable LSR–/– adult mice did not allow us to obtain
definitive information on the role of LSR in lipid and
lipoprotein metabolism. The p roduction of a c onditional
knock-out will be necessary t o explore this question.
Further studies are also required to u nderstand the mech-
anisms of liver involution and l ethality in LSR–/– embryos
and its relationship ( if any) with the r ole of LSR as a
lipoprotein receptor.

Acknowledgements
We thank Professor Marc Vasseur for stimulating discussions. Pierre
Costet is acknowledged for his excellent management of the murine
animal facility and Vale
´
rie Le Morvan for performing Northern-blots.
This research was supported by a grant from Genset SA.
References
1. Cooper, A.D. (1997) Hepatic uptake of chylomicron remnants.
J. Lipid Res. 38, 2173–2192.
2. Yen, F.T., Mann, C.J., Guermani, L.M., Hannouche, N.F.,
Hubert, N., Hornick, C.A., Bordeau, V.N., Agnani, G . & Bihain,
B.E. (1994) Identification of a lipolysis-stimulated receptor that is
distinct from the LDL receptor and the LDL receptor-related
protein. Biochemistry 33, 1172–1180.
3. Mann, C.J., Khallou, J., Chevreuil, O., Troussard, A.A.,
Guermani, L.M., Launay, K., Delplanque, B., Yen, F.T. &
Bihain, B.E. (1995) Mec hanism of activation and functional
significance of the lipolysis-stimulated receptor. Evidence for a role
as chylomicron remnant receptor. Biochemistry 34, 10421–10431.
4. Bihain, B.E. & Yen, F.T. (1992) Free fatty acids activate a high-
affinity saturable pathway for degradation of low-density lipo-
proteins in fibroblasts from a subject homozygous for familial
hypercholesterolemia. Biochemistry 31, 4628–4636.
5. Yen, F.T., Masson, M., C lossais-Besnard, N., Andre, P., Grosset,
J.M., Bougueleret, L., Dumas, J.B., Guerassimenko, O. & Bihain,
B.E. (1999) Molecular cloning of a lipolysis-stimulated remnant
receptor expressed in the liver. J. Biol. Chem. 274, 13390–13398.
6. Mann, C.J., Troussard, A.A., Ye n, F.T., H annouche , N., Najib,
J., Fruchart, J.C., Lotteau, V., Andre, P. & B ihain, B.E. (1997)

Inhibitory effects of specific apolipoprotein C-III isoforms o n the
binding of triglyceride-rich lipoproteins to the lipolysis-stimulated
receptor. J. Biol. C hem. 272, 31348–31354.
7. Troussard, A.A., Kh allou, J., M ann, C.J., Andre, P., Stricklan d,
D.K., Bihain, B.E. & Yen, F.T. (1995) Inhibitory effect on the
lipolysis-stimulated receptor of the 3 9-kD a receptor-associate d
protein. J. Biol. Chem. 270, 17068–17071.
8. Nehls, M., Kyewski, B., Messerle, M., Waldschutz, R., S chud-
dekopf, K., Smith, A.J. & Boehm, T. (1996) Two genetically
separable steps in the differentiation of thymic epithelium. Science
272, 886–889.
9. Smith, A.J., De Sousa, M.A., K wabi-Addo, B., Heppell-Parton,
A.,Impey,H.&Rabbitts,P.(1995)Asite-directedchromosomal
translocation induced in embryonic stem cells by C re-loxP
recombination. Nat. Genet. 9, 376–385.
10. Mansour, S.L., Thomas, K. R. & Capecchi, M.R. (1988) Disrup-
tion of the proto-oncogene int-2 in mouse embryo-derived stem
cells: a general strategy for targeting mu tations to non-se lectab le
genes. Nature 336, 348–352.
11. Smith, A.G. (1991) Culture and differentiation of embryonic stem
cells. J. Tiss. Cult. Meth. 13, 89–94.
12. Willnow, T.E., G oldstein, J .L., Orth, K., Brown, M.S. & H erz, J.
(1992) Low density lipoprotein receptor-related protein and gp330
bind similar ligands, including plasminogen activator-inhibitor
complexes and lactoferrin, an inhib itor of chylomicron remn ant
clearance. J. Biol. C hem. 267, 26172–26180.
13. Choi, S.Y. & Cooper, A.D. (1993) A comparison of the roles of
the low density lipoprotein (LDL) receptor and the LD L receptor-
related protein/alpha 2-macroglobulin receptor in chylomicron
remnant removal in the mouse in vivo. J. Biol. C hem. 268, 15804–

15811.
14. Ishibashi, S., Brown, M.S., Goldstein, J.L., Gerard, R.D.,
Hammer, R.E. & Herz, J. (1993) Hypercholesterolemia in low
density lipoprotein receptor knockout mice and its reversal by
adenovirus-mediated gene delivery. J. Clin. Invest. 92, 883–893.
15. Rubin sztein, D.C., Cohen, J.C., Berger, G.M., van der
Westhuyzen, D.R ., Coe tzee, G.A. & Gevers, W. (1990) Chylo-
micron re mnant clearance from the plasma i s normal in f amilial
hypercholesterolemic homozygotes with define d receptor defe cts.
J. Clin. I nvest. 86, 1306–1312.
16. Rohlmann, A ., Gotthardt, M., Hammer, R.E. & Herz, J. (1998)
Inducible inactivation o f hepatic LRP gene by c re-mediated
recombination confirms role of LRP in clearance of chylomicron
remnants. J. Clin. Invest. 101, 689–695.
17. Herz, J., Qiu, S.Q., Oesterle, A., D eSilva, H.V., Shafi, S. & Havel,
R.J. (1995) Initial hepatic removal of chylomicron remnants is
unaffected but endocytosis is delayed in mice lacking the low
density lipoprotein receptor. Proc. Natl Acad. Sci. USA. 92 ,
4611–4615.
Ó FEBS 2004 LSR gene and protein expression (Eur. J. Biochem. 271) 3113
18. Takahashi, S., K awarabayasi, Y., Nakai, T ., Sakai, J. & Yama-
moto, T. (1992) Rabbit very l ow density lipoprotein receptor: a
low density lipoprotein receptor-like protein with distinct ligand
specificity. Proc. Natl Acad. Sci. USA. 89, 9252–9256.
19. Farese, R.V. Jr & Herz, J. (1998) Cholesterol metabolism and
embryogenesis. Trends Genet. 14, 115–120.
20. Zaret, K. (1998) Early liver differentiation: g enetic potentiation
and multilevel growth control. Curr. Opin. Genet. Dev. 8, 526–531.
21. Smith, J.L., Le ar, S.R. & Erickson, S.K. (1995) Developmental
expression of elements of hepatic cholesterol metabolism in the rat.

J. Lipid Res. 36, 641–652.
22. Hatzopoulos, A.K., Rigotti, A., Rosenberg, R.D. & K rieger, M.
(1998) Tempo ral and spatial pattern of expression of the HDL
receptor SR-BI during m urine embryogenesis. J. Lipid Res. 39 ,
495–508.
23. Jurevics, H.A., Kidwai, F.Z. & Morel l, P. ( 1997) Sources o f
cholesterol during development of the rat fetus and fetal organs.
J. Lipid Res. 38, 723–733.
24. Staels, B., Jansen, H., van Tol, A., Stahnke, G., W ill, H., Verho-
even, G. & Auwerx, J. (1990) Development, food intake, and
ethinylestradiol influence hepatic t riglyceride lipase and LD L-
receptor mRNA levels in rats. J. Lipid Res. 31, 1211–1218.
25. Spijkers, J.A., van den Hoff, M.J., Hakvoort, T.B., Vermeulen,
J.L., Tesink-Taekema, S. & Lamers, W.H. (2001) Fetal rise in
hepatic enzymes follows decline i n c-met and hepatocyte growth
factor expression. J. Hepatol. 34, 699–710.
26. Ji,M.Y.,Lee,Y.C.,Kim,K.S.,Cho,J.W.,Jung,K.Y.,Kim,C.H.
& Choo, Y.K. (1999) Developmental patterns of GalBeta1,3 (4)
GlcNAc alpha2,3-sialyltransferase (ST3Gal III) expression in the
mouse: in situ hybridization u sing DIG-labeled RNA probes.
Arch.Pharm.Res.22, 243–248.
27. Morris, S.M. Jr, Kepka, D.M., Sweeney, W.E. Jr & Avner, ed.
(1989) Abundance of mRNAs encoding urea cycle enzymes in
fetal and neonatal mouse liver. Arch. Bioch em. Biophys. 269 , 175–
180.
28. Willnow, T.E., Hilpert, J., Armstrong, S.A., Rohlmann, A.,
Hammer, R.E., Burns, D.K. & Herz, J. ( 1996) Defective fore brain
development in mice lacking gp330/megalin. Proc. Natl Acad. Sci.
USA. 93, 8460–8464.
29. Herz, J., Clouthier, D.E. & Hammer, R.E. (1992) LDL receptor-

related protein int ernalizes and degrades uPA-PAI-1 co mplexes
and is essential for embryo imp lan tation. Cell 71, 411–421.
30. Acton, S., Rigotti, A., Landschulz, K .T., Xu, S., Hobbs, H.H. &
Krieger, M. (1996) Identification of scavenger receptor SR-BI as a
high density lipoprotein receptor. Science 271, 518–520.
31. Landschulz, K.T., Pathak, R.K., Rigotti, A ., Kriegerj, M. &
Hobbs, H.H. (1996) Regulation of scavenger receptor, class B,
type I, a high density lipoprotein receptor, in liver and steroido-
genic tissues of the rat. J. Clin. Invest. 98, 984–995.
32. Glass, C., P ittman, R.C., Civen, M. & Steinberg, D. (1985)
Uptake of high-density lipoprotein-associated a poprotein A-I and
cholesterol esters by 16 tissues of the rat in vivo and by adrenal cells
and hepatocytes in vitro. J. Biol. Chem. 26 0, 744–750.
33. Shiratsuchi, A., Kawasaki, Y., Ikemoto, M., Arai, H. &
Nakanishi, Y. (1999) Role of class B scavenger receptor type I in
phagocytosis of apoptotic rat spermatogenic cells by Sertoli cells.
J. Biol. Chem. 274, 5901–5908.
34. Kawasaki, Y., Nakagawa, A., Nagaosa, K., Shiratsuchi, A. &
Nakanishi, Y. (2002) Phosphatidylserine binding of class B
scavenger receptor type I, a phagocytosis receptor of testicu lar
sertoli cells. J. Biol. Chem. 277, 27559–27566.
35. Reaven, E., Nomoto, A., Leers-Suche ta, S., Temel, R., Williams,
D.L. & Azhar, S. (1998) Expression and microvillar localization of
scavenger receptor, class B, type I (a high density lipoprotein
receptor) i n luteinized and hormone-desensitized rat ovarian
models. Endocrinology 139, 2847–2856.
36. Azhar, S., Tsai, L., Medicherla, S., Chandrasekher, Y., Giudice, L.
& Reaven, E. (1998) Human granulosa cells use high density
lipoprotein cholesterol for st eroidogenesis. J. Clin. Endocrinol.
Metab. 83, 983–991.

37. Hwang, J. & Menon, K.M. (1983) Characterization of low density
and high density lipoprotein receptors in the rat corpus luteum and
regulation by gonadotropin. J. Biol. Chem. 258, 8020–8027.
38. Murata, M., Tamura, A., Kodama, H., Hirano, H., Takahashi, O.
& Tanaka, T. (1998) Possible involvement of very low density
lipoproteins i n steroidogenesis in the human o vary. Mol. Hum.
Reprod. 4, 797–801.
39. Kolleck,I.,Witt,W.,Wissel,H.,Sinha,P.&Rustow,B.(2000)
HDL and vitamin E in plasma an d the expression of SR-BI o n
lung cells during rat per inatal development. Lung 178, 191–200.
40. Voyno-Yasenetsk aya, T.A., Dobbs, L.G., Erick son, S.K. &
Hamilton, R.L. (1993) Low density lipoprotein- and high density
lipoprotein-mediated s ignal transduction and exocytosis in
alveolar type II cells. Proc. Natl A cad. Sci. USA. 90, 4256–4260.
41. Kolleck, I., Wissel, H., Guthmann,F.,Schlame,M.,Sinha,P.&
Rustow, B. (2002) HDL-holoparticle uptake by alveolar type II
cells: effect of vitamin E status. Am.J.Respir.CellMol.Biol.27,
57–63.
42. Stefansson, S., Kounnas, M .Z., Henkin, J., Mallampalli, R.K.,
Chappell, D.A., Strickland, D.K. & Argraves, W.S. (1995) gp330
on type II pneumocytes m ed iates endocytosis leadin g to
degradation of pro-urokinase, plasminogen activator inhibitor-1
and urokinase-plasminogen activator inhibitor-1 complex. J. Cell
Sci. 108, 2361–2368.
43. Mallampalli, R.K., Salome, R.G., Bowen, S.L. & Chappell, D.A.
(1997) Very low density lipoproteins stimulate surfactant lipid
synthesis in vitro. J. Clin. Invest. 99, 2020–2029.
44. Quaschning, T., Koniger, M., Kramer-Guth, A., Greiber, S.,
Pavenstadt, H., Nauck, M., Schollmeyer, P. & Wanner, C. (1997)
Receptor-mediated lipoprotein uptake by human glomerular cells:

comparison with skin fibroblasts and HepG2 cells. Nephrol. Dial.
Transplant. 12, 2528–2536.
45. Grone, H.J., Walli, A.K., Grone, E., Kram er, A., Clemens, M.R.
& Seidel, D. (1990) Receptor mediated uptake of apo B and apo E
rich lipoproteins by human glomerular epithelial cells. Kidney Int.
37, 1449–1459.
46. Kramer, A., Nauck, M., Pavenstadt, H., Schwedler, S., Wieland,
H.,Schollmeyer,P.&Wanner,C.(1993)Receptor-mediated
uptake of IDL and LDL from nephrotic p atients by glomerular
epithelial cells. Kidney Int. 44, 1341–1351.
3114 S. Mesli et al.(Eur. J. Biochem. 271) Ó FEBS 2004