Báo cáo khoa học: Sequences and structural organization of phospholipase A2 genes from Vipera aspis aspis, V. aspis zinnikeri and Vipera berus berus venom Identification of the origin of a new viper population based on ammodytin I1 heterogeneity docx

Sequences and structural organization of phospholipase A
2
genes from
Vipera aspis aspis
,
V. aspis zinnikeri
and
Vipera berus berus
venom
Identification of the origin of a new viper population based on ammodytin I1
heterogeneity
Isabelle Guillemin*, Christiane Bouchier†, Thomas Garrigues‡, Anne Wisner§ and Vale
´
rie Choumet*
Unite
´
des Venins, Institut Pasteur, Paris, France
We used a PCR-based method to determine the genomic
DNA sequences encoding phospholipases A
2
(PLA2s) from
the venoms of Vipera aspis aspis (V. a. aspis), Vipera aspis
zinnikeri (V. a. zinnikeri), Vipera berus berus (V. b. berus)
and a neurotoxic V. a. aspis snake (neurotoxic V. a. aspis)
from a population responsible for unusual neurotoxic
envenomations in south-east France. We sequenced five
groups of genes, each corresponding to a different PLA2.
The genes encoding the A and B chains of vaspin from the
neurotoxic V. a. aspis,PLA2-IfromV. a. zinnikeri,andthe
anticoagulant PLA2 from V. b. berus are described here.
Single nucleotide differences leading to amino-acid substi-

tutions were observed both between genes encoding the same
PLA2 and between genes encoding different PLA2s. These
differences were clustered in exons 3 and 5, potentially
altering the biological activities of PLA2. The distribution
and characteristics of the PLA2 genes differed according
to the species or subspecies. We characterized for the first
time genes encoding neurotoxins from the V. a. aspis and
V. b. berus snakes of central France. Genes encoding
ammodytins I1 and I2, described previously in Vipera
ammodytes ammodytes (V. am. ammodytes), were also pre-
sent in V. a. aspis and V. b. berus. Three different ammo-
dytin I1 gene sequences were characterized: one from
V. b. berus, the second from V. a. aspis, V. a. zinnikeri and
the neurotoxic V. a. aspis, and the third from the neurotoxic
V. a. aspis. This third sequence was identical with the
reported sequence of the V. am. ammodytes ammodytin I1
gene. Genes encoding monomeric neurotoxins of
V. am. ammodytes venom, ammodytoxins A, B and C, and
the Bov-B LINE retroposon, a phylogenetic marker found
in V. am. ammodytes genome, were identified in the genome
of the neurotoxic V. a. aspis. These results suggest that the
population of neurotoxic V. a. aspis snakes from south-east
France may have resulted from interbreeding between
V. a. aspis and V. am. ammodytes.
Keywords: ammodytin; neurotoxic; phospholipase A
2
;
vaspin; viper.
Phospholipases A
2

(PLA2s) are major components of snake
venoms. They catalyze the Ca
2+
-dependent hydrolysis of
the 2-acyl ester bond of 1,2-diacyl-3-sn-phosphoglycerides
releasing fatty acids and lysophospholipids. These enzymes
can be separated into 11 groups. Those belonging to group
II have six to eight disulfide bonds and a C-terminal
extension not present in group I venom PLA2s [1]. They
are found in the venoms of Crotalinae and Viperinae
snakes and in human platelets, liver and spleen [2,3]. Snake
venoms contain a large number of PLA2 isoenzymes
which differ in neurotoxicity, myotoxicity, cardiotoxicity,
anticoagulation and edema-inducing properties [2].
To date, the structures of only six Viperinae PLA2 genes
have been studied: ammodytin I1 (DDBJ/EMBL/GenBank
accession no. AF253048), ammodytin I2 (DDBJ/EMBL/
GenBank accession no. X84018), ammodytoxin C (DDBJ/
EMBL/GenBank accession no. X76731) and ammodytin L
(DDBJ/EMBL/GenBank accession no. X84017) from
Vipera ammodytes ammodytes (V. am. ammodytes)andtwo
genes encoding an acidic inhibitor (VP7) (DDBJ/EMBL/
GenBank AC AF373342) and a basic PLA2 protein (VP8)
(DDBJ/EMBL/GenBank AC AF373342) from Vipera
palaestinae venom [4–6]. All these genes are composed of
five exons and four introns, like genes encoding human
Correspondence to V. Choumet, Unite
´
de Biochimie et de Biologie
Mole

´
culaire des Insectes, 25, Rue du Docteur Roux,
75724 Paris Cedex 15, France.
Fax: + 33 1 40 61 34 71, Tel.: + 33 1 45 68 86 30,
E-mail:
Abbreviation: PLA2, phospholipase A
2
.
*Present address:Unite
´
de Biochimie et Biologie Mole
´
culaire des
Insectes, Institut Pasteur, 25, Rue du Dr Roux,
75724 Paris Cedex 15, France.
Present address: Genopole, Institut Pasteur, 28, Rue du Docteur
Roux, 75724 Paris Cedex 15, France.
àPresent address:Unite
´
d’Ecologie des Syste
`
mes Vectoriels,
Institut Pasteur, 25, Rue du Docteur Roux,
75724 Paris Cedex 15, France.
§Present address: Laboratoire de Recherche et de De
´
veloppement:
Pharmacologie des Re
´
gulations Neuroendocriniennes, Paris, France.

Note: The nucleotide sequences reported in this paper have been
deposited in the DDBJ/EMBL/GenBank nucleotide sequence data-
bases under accession numbers AY158634, AY158635, AY158636,
AY158637, AY158638, AY158639, AF548351, AY152843,
AY159807, AY159808, AY159809, AY159810, AY159811,
AY243574, AY243575, AY243576, AY243577.
(Received 2 December 2002, revised 4 April 2003,
accepted 22 April 2003)
Eur. J. Biochem. 270, 2697–2706 (2003) Ó FEBS 2003 doi:10.1046/j.1432-1033.2003.03629.x
group II PLA2s. In contrast, PLA2 genes from Crotalinae
snakes such as Trimeresurus flavoviridis, Trimeresurus
gramineus, Trimeresurus (Ovophis) okinavensis and Crotalus
scutulatus scutulatus are organized into four exons and three
introns, like group I PLA2s [7–10]. Despite this difference,
nucleotide sequence analyses have shown that, unusually,
introns are more conserved than exons in both Viperinae
and Crotalinae. Moreover, mutations leading to amino-acid
changes are common in the protein-coding regions (but not
in the signal peptide exon), but are limited to the third exon
in V. palaestinae [6,11]. Thus, the genes encoding the group
II PLA2 of snake venoms evolved by gene duplication,
followed by divergence from a common ancestral gene by
accelerated Darwinian selection, probably as a means of
acquiring new functions [9,11].
In this paper, we extend the study of PLA2 genes to the
French vipers Vipera aspis aspis (V. a. aspis), Vipera aspis
zinnikeri (V. a. zinnikeri), and Vipera berus berus (V. b.
berus). We were prompted to carry out this study by the
recent identification of a distinct, unusually neurotoxic
population of V. a. aspis in the south-east of France [12].

Several cases of envenomation resulting in symptoms of
neurotoxicity have been reported in recent years in two
French de
´
partements (Alpes-Maritimes and Alpes-de-
Haute-Provence). Such symptoms have never been observed
after envenomation by V. a. aspis snakes in other regions of
France. The venom of these snakes was detected by ELISA
in the plasma of the patients; it contained PLA2s that cross-
reacted with antibodies to ammodytoxin [12]. We investi-
gated gene expression in the venom gland of one of the
snakes captured after one case of human envenomation. We
showed, by RT-PCR, that the venom of this snake
contained two neurotoxins. One was monomeric and
identical with ammodytoxin B, and the other (vaspin) was
heterodimeric and similar to vipoxin, the toxic complex of
Vipera ammodytes meridionalis snake venom [13]. These two
toxins were responsible for the symptoms of neurotoxicity
observed after envenomation [13]. We then investigated the
genes encoding the PLA2s present in the venoms of all
the venomous snake species of France. On the basis of its
venom PLA2 characteristics and, particularly, sequence
analysis of the ammodytin I1 gene, we suggest a possible
origin for the neurotoxic snake population. We also report
high levels of polymorphism, both for individual PLA2
genes and between genes encoding different PLA2s. These
polymorphisms may have implications for the structure
and/or function of the enzyme.
Experimental Procedures
Snakes were captured in various regions of France:

V. a. aspis and V. b. berus in the Puy-de-Doˆ me, V. a.
zinnikeri in the Gironde, and neurotoxic V. a. aspis in the
Alpes-Maritimes. The V. a. aspis snake captured in the
Alpes-Maritimes was responsible for one case of neurotoxic
envenomation [12]. We studied one individual per snake
species. Genomic DNA was extracted from snake livers as
previously described [14].
DNA was amplified with a set of primers (Genset Oligos,
Paris, France) targeting conserved regions of the PLA2
genes for which sequences were available in databases. The
primer-binding sites were located upstream from the
5¢-UTR (PLA5G) and downstream from the 3¢-UTR
(PLA3G). Amplification reactions were carried out in a
final volume of 50 lL containing 2.5 lLPLA5Gand
2.5 lLPLA3G(10l
M
each), 1 lLdNTPs(dATP,dCTP,
dTTP and dGTP, 10 m
M
each), 5 lL Taq buffer supplied
with the enzyme, 0.25–0.5 lg genomic DNA and 1.5 U
rTaq polymerase (Amersham Biosciences, Orsay, France).
The DNA was denatured by heating at 95 °Cfor7min.It
was then subjected to 30 amplification cycles as follows:
denaturation at 95 °C for 1 min and annealing coupled with
extension at 69 °C for 6 min. A final extension step was
carried out, at 72 °C for 10 min. The reaction product was
analyzed by agarose gel electrophoresis in 1 · Tris/borate
buffer.
DNA fragments of the expected size (2.1 kb) were

purified from the gel with the QIAquick Gel Extraction
Kit (Qiagen S.A., Courtabœuf, France), and inserted into
the pCRÒ2.1-TOPOÒ vector of the TOPO TA CloningÒ
Kit (Invitrogen SARL, Cergy Pontoise, France). Plasmid
DNA was purified with the Montage Plasmid Miniprep
96
Kit (Millipore, Saint-Quentin-en-Yvelines, France). Sequen-
cing reactions were performed from both ends of the
DNA plasmid, using the ABI PRISM BigDye Terminator
Cycle Sequencing Ready-Reaction Kit, and a 3700
Genetic Analyzer (Applied Biosystems). The trace files
were base-called with Phred [15]. Sequences not meeting
our production quality criteria (at least 100 bases with a
quality over 20) and insert-less vector sequences (detected
by cross-matching; [15]) were discarded. Complete nuc-
leotide sequences were determined on both strands, with a
set of nine primers, designed from database sequences
(Table 1).
Results and Discussion
Identification of PLA2 genes
We obtained 96 clones of PLA2 genes per snake species.
Complete nucleotide sequences were further analyzed for
81 clones of V. a. aspis, 80 clones of V. b. berus,65of
V. a. zinnikeri, and 59 of the neurotoxic V. a. aspis.Nuc-
leotide and amino-acid sequences were compared with
sequences in gene and protein databases, using
BLASTN
and
BLASTP
, respectively. We subsequently amplified the corres-

ponding genomic DNA fragments from each snake with
primers (Table 1) specific for the PLA2s previously charac-
terized in Vipera venoms. We also designed primers specific
for the Bov-B LINE retroposon, a phylogenetic marker
previously identified in some PLA2 genes of Viperidae
snakes including V. am. ammodytes [4,5].
Five groups of snake venom PLA2 genes were sequenced.
Nucleotide polymorphism was identified in each group.
Two groups of genes were most similar, in terms of
nucleotide sequences, to cDNAs encoding chains A and B
of vaspin (DDBJ/EMBL/GenBank accession no.s
AJ459806 and AJ459807, respectively) [13], chains A and
B of vipoxin (Gi numbers: 16974941 and 16974940) from
V. am. meridionalis [16] and the two subunits of PLA2-I (Gi
numbers: 1709547 and 1709548) from V. a. zinnikeri [17].
They also showed a high level of nucleotide identity with
cDNAs encoding the presynaptic neurotoxic complex RV4/
RV7 from Daboia russelli formosensis (DDBJ/EMBL/
2698 I. Guillemin et al.(Eur. J. Biochem. 270) Ó FEBS 2003
GenBank accession no.s X68385 and X68386, respectively
[18]). Two other groups were most similar, in terms of
nucleotide sequence, to the ammodytin I1 (DDBJ/EMBL/
GenBank accession no. AF253048) and ammodytin I2
(DDBJ/EMBL/GenBank accession no. X84017) genes
from V. am. ammodytes, respectively [19]. The last group
of genes was most similar to the V. b. berus PLA2 protein
(Gi number: 423975) [20]. A list of all the venom PLA2
genes identified in each captured snake is presented in
Table 2. Unexpectedly, genes encoding the A and B chains
of vaspin, a heterodimeric neurotoxin, were identified in

V. a. aspis and V. b. berus snakes collected in central
France (Table 2). These genes are probably either expressed
at a very low level or not expressed at all in the venom of
these snakes because no neurotoxic envenomation has ever
been reported in the Clermont-Ferrand region (Gabriel
Montpied Hospital, personal communication). The expres-
sion of these neurotoxin subunits in the venom of the
neurotoxic V. a. aspis may be related to the diet of the
snake, but this hypothesis remains to be proven [21].
More surprisingly, genes encoding ammodytoxins A, B
and C were identified only in the neurotoxic V. a. aspis
snake (Table 2). However, only the ammodytoxin B
mRNA was detected in the venom gland of this snake
[13]. Thus, not all the ammodytoxin genes were expressed.
Finally, partial sequencing of the PCR product revealed
the presence of the Bov-B LINE retrotransposon in intron
D of the ammodytoxin C gene of the neurotoxic V. a. aspis
(Table 2). This feature was also specific to this population of
neurotoxic snakes.
Table 1. Sequences of primers used for PCR amplification and
sequencing of PLA2 genes. F, Forward; R, reverse. Y ¼ CorT;
W ¼ AorT.
Primer name Sequences 5¢)3¢
M13Reverse (F)
CCCTATAGTGAGTCGTATTA
T7 Promoter (R) CAGGAAACAGCTATGAC
PLA5G (F) CGGAATTCTGAAGGTGGCCCGCC
AGGTGACAG
PLA3G (R) CGCGGATCCAATCTTGATGGGGC
AGCCGGAGAGG

PLA5G1 (F) AGGAYTCTCTGGATAGTGG
PLA3G1 (R) CTCACCACAGACGATWTCC
PLA5G2 (F) CGGTAAGCCCATAACGCCCA
PLA3G2 (R) CAGGCCAGGATTTGCAGCC
PLA3G4 (R) CATAAACAYGAGCCAGTTGCC
ARTF
a
(F) GAGTGGATGCACAGTCGTTG
ARTR
a
(R) GAAACGGAGGTAGTGACACAT
AtxBF
b
(F) GCCTGCTCGAATTCGGGATG
AtxBrc
b
(R) CTCCTTCTTGCACAAAAAGTG
AtxACF
c
(F) CTGCTCGAATTCGGGATG
AtxACrc
c
(R) GTCYGGGTAATTCCTATATA
AmlF
d
(F) GTGATCGAATTTGGGAAGATGATCCA
Amlrc
d
(R) CCCTTGCATTTAAACCTCAGGTACAC
a

Specific primers used for amplification of the Bov-B LINE
retroposon;
b
specific primers used for amplification of the ammo-
dytoxin B gene;
c
specific primers used for amplification of the
ammodytoxin A and C genes;
d
specific primers used for amplifica-
tion of the ammodytin L gene.
Table 2. Characteristics of the venom PLA2 genes of V. a. as pi s, V. a. zinnikeri,neurotoxicV. a. aspis and V. b. berus. The PLA2 content of
V. am. ammodytes venom is as previously reported [2,4].
Snake species
PLA2 genes
a
Length of intron D
in ammodytin I1 (bp)
AmI1(form) AmI2 Vb VaspA VaspB
V. a. aspis + (Ia) +–+
c
+
c
133
V. a. zinnikeri + (Ia) – – + + 133
Neurotoxic V. a. aspis + + – + + 133/259
1st group of clones + (Ia) 133
2nd group of clones + (In) 259
V. b. berus + (Ib) + + +
c

+
c
259
V. am. ammodytes + (In) + – – – 259
Snake species Ammodytin I1 protein sequence
b
AtxA AtxB AtxC AmL Retroposon
V. a. aspis L70, S71, E78, L12 – – – – –
V. a. zinnikeri L70, S71, E78, L12 – – – – –
Neurotoxic V. a. aspis +
c
+
c
+
c
–+
c
(AtxC)
1st group of clones L70, S71, E78, L123
2nd group of clones M70, G71, Q78, F123
V. b. berus T3 (peptide signal) – – – +
c
+
c
(AmL)
N1 K56
V. am. ammodytes M70, G71, Q78, F123 + + + + + (AtxC, AmL)
a
AmI, ammodytin I1; AmI2, ammodytin I2; VaspA, vaspin chain A; VaspB, vaspin chain B; AtxA, ammodytoxin A; AtxB, ammodytoxin
B; AtxC, ammodytoxin C; AmL: ammodytin L;

b
Only amino acids differing between ammodytin I1 molecules are represented. The isoform
of ammodytoxin I is indicated in parentheses, as shown in Fig. 3.
c
The genes were identified by PCR and partially sequenced.
Ó FEBS 2003 Genomic analysis of phospholipases A
2
from French viper venoms (Eur. J. Biochem. 270) 2699
Structural organization of PLA2 genes
We report here the first genomic sequences for the genes
encoding vaspin, a heterodimeric neurotoxin from Vipera
snakes, and PLA2 from V. b. berus. The nucleotide
sequences of the genes encoding chains A and B of vaspin
and V. b. berus PLA2 span about 1.9 kb, as do the
ammodytin I1 and I2 genes. They show a similar organiza-
tion to Viperinae PLA2s, with five exons separated by four
introns (Table 3). Exons 3, 4 and the 5¢ part of exon 5
encode the mature protein; exon 1 encodes the 5¢-UTR, and
exon 2 and part of exon 3 encode the signal peptide. The 110
nucleotides at the 3¢ end of exon 5 encode the 3¢-UTR. The
5¢ donor and 3¢ acceptor splice sites conformed with the
GT/AG rule (Table 3). These features are common to
Viperinae PLA2 genes [1,4].
Regardless of the snake from which the PLA2 gene was
obtained, the lengths of the exons and the 5¢-UTR were
identical, except for exon 5 in the ammodytin I2 gene, which
was three nucleotides shorter than the equivalent exon in the
other PLA2 genes (Table 3). The ammodytoxin C, ammo-
dytins I1 and I2 and ammodytin L genes of V. am. ammo-
dytes, the VP7 and VP8 genes of V. palaestinae,andthe

PLA2 genes of Crotalinae snakes (Trimeresurus flavoviridis)
were also of similar length [4–6,8]. Interestingly, a 476 bp
insertion was observed in the 3¢-UTR of the ammodytin I2
gene from V. b. berus. This fragment was similar to a region
located upstream from the TATA-box-binding protein gene
of T. gramineus and T. flavoviridis [22], suggesting a
probable common ancestry of V. b. berus and Trimeresurus
species.
ThelengthofintronDintheammodytinI1gene
depended on the species. It was 133 bp long in V. a.
zinnikeri and V. a. aspis whereas it was 259 bp long
in V. b. berus and V. am. ammodytes (DDBJ/EMBL/
GenBank accession no. AF253048). Interestingly, introns
of both lengths were found in the genome of the neurotoxic
V. a. aspis, with six of the 10 sequenced clones having the
126 bp deletion as in V. a. aspis, V. a. zinnikeri,andthe
remaining four clones having an intron D similar to that of
the V. am. ammodytes ammodytin I1 gene.
All PLA2 genes contained a TAA stop codon, an
AATAAA polyadenylation site 80 bp downstream from
the stop codon, and a TATA-like box (CATAAAA) 270 bp
upstream from the ATG translation initiation codon, as
found in other Viperinae and Crotalinae genes [2,22].
Table 3. Structural organization of V. a. aspis, V. a. zinnikeri, V. b. berus and neurotoxic V. a. aspis PLA2 genes.
PLA2 gene
(no. of clones)
a
Exon
Exon length
(bp) Intron

Intron length
(bp)
Splice sites
5¢donor/3¢acceptor
Ammodytin I1 1 66 A 163
CAGCTgtaag/tccagGTCTG
(88) 2 56 B 241–244 AGGCGgtgag/caaagCTGAA
3 133 C 671–680 GACCGgtaag/tccagCTGCT
4 101 D 133–259 CTGTGgtgag/tgcagGAGGC
5(3¢-UTR) 140 (110)
Ammodytin I2 1 66 A 163
CAGCTgtaag/tccagGTCTG
(59) 2 56 B 243 AGGCGgtgag/tccagTTGAA
3 133 C 662–670 GACCGgtaag/tccagCTGCT
4 101 D 133 CTGTGgtgag/tgcagGAGGC
5(3¢-UTR) 137 (110)
Vaspin A 1 66 A 163
CAGCTgtaag/tccagGTCTG
(29) 2 56 B 201 AGGCGgtgag/tccagTTGAA
3 133 C 678 GACCGgtaag/tccagCTGCT
4 101 D 259 GTGCGgtgag/tgtagGAGAC
5(3¢-UTR) 140 (110)
Vaspin B 1 66 A 163
CAGCTgtaag/tccagGTCTG
(54) 2 56 B 241–243 AGGCGgtgag/tttagTTGAG
3 133 C 667–674 GACCGgtaag/tccagCTGCT
4 101 D 239 CTGCGgtgag/tgcagGAAAA
5(3¢-UTR) 140 (110)
V. berus PLA2 1 66 A 163
CAGCTgtaag/tccagGTCTG

(52) 2 56 B 243 GGGCGgtgag/tccagTTGAA
3 133 C 671 GACCGgtaag/tccagCTGCT
4 101 D 261 CTGTGgtgag/tgcagGAAAC
5(3¢-UTR) 140 (110)
a
Clones harboring complete sequences of PLA2s are presented.
Fig. 1. Alignment of some of the variant genes encoding chain B of
vaspin from V. a. aspis (neurotoxic) and V. a. zinnikeri. Two vaspin
chain B gene variants are shown for V. a. zinnikeri (vp0016B10VAZ
and vp0016C06VAZ, DDBJ/EMBL/GenBank accession no.s
AY243574 and AY243577, respectively) and V. a. aspis
(vp0015F11VAN and vp0015C10VAN, DDBJ/EMBL/GenBank
accesion no.s AY243575 and AY243576, respectively). The nucleotides
forming the introns are shown in italics, and those constituting the
exons are underlined. Stars below the sequence indicate nucleotides
conserved in all sequences. Dashes correspond to deleted nucleotides.
Putative transcription factors are boxed.
2700 I. Guillemin et al.(Eur. J. Biochem. 270) Ó FEBS 2003
Several putative regulatory sequences were identified
with the TRANSFAC 4.0 databases: binding sites for the
transcription factors Sp1 (CCCGCCA), NF-IL6 (TGGG
GAA), NF-jB (GGGGAAGTCCC) and AP-2 (CCCTG
CC) were identified in PLA2 genes (Figs 1 and 2) [22].
These trans-acting factors may act as stress-response
Ó FEBS 2003 Genomic analysis of phospholipases A
2
from French viper venoms (Eur. J. Biochem. 270) 2701
elements or may be responsible for tissue-specific regula-
tion [23].
Conservation of the nucleotide sequence

We identified variant genes for the same PLA2 in the
genomes of all of the snakes. Such variants were identified
for all the sequenced PLA2s. Thorough analysis of the
nucleotide sequences showed that, although the organiza-
tion of introns and exons and the sequences of these PLA2
variants were well conserved (with ‡ 84% identity over
1900 bp), single-nucleotide polymorphisms were present
throughout the gene sequence. An example is given for
some of the vaspin chain B gene variants identified in
V. a. zinnikeri and the neurotoxic V. a. aspis (Fig. 1).
Some of the nucleotide mutations were found in both
subspecies whereas others were subspecies-specific. These
genes probably resulted from complete duplication events.
However, some of the nucleotide polymorphisms observed
may be also accounted for by the error rate of the Taq
polymerase used for DNA amplification, which is estima-
ted by the manufacturers to be  10
)4
. There were slightly
more nucleotide polymorphisms in introns than in exons.
This was particularly true for intron C, which contained
several short deletions and insertions (Fig. 1). Two micro-
satellite regions of tandem CA and TCCC repeats were
particularly prone to insertion and deletion (Fig. 1), as
reported in previous studies on T. flavoviridis and
O. okinavensis PLA2 genes [8,10]. These features revealed
intragenomic hypervariability within snake PLA2 genes.
Exon nucleotide polymorphisms leading to amino-acid
substitutions might result in the creation of PLA2s with
different functions. Indeed, PLA2 isoforms, differing by a

few amino acids and in lethal potency or enzymatic
activities, have been isolated from the venoms of individual
Crotalinae snakes [24].
We then identified a consensus nucleotide sequence for
each of the five PLA2 genes (Fig. 2). For the genes encoding
chains A and B of vaspin and PLA2 from V. b. berus,a
single consensus sequence was obtained, regardless of the
snake species. For the ammodytin I1 and I2 genes, however,
two to three consensus sequences were obtained, according
to the snake species or subspecies. Only one of the consensus
sequences for the ammodytin I1 and I2 genes is presented in
Fig. 2. In contrast with that observed in comparisons of
gene variants encoding the same PLA2 (Fig. 1), the
alignment of these consensus sequences showed that nuc-
leotide variations were more common in exons than in
introns (Fig. 2). Exons 3 and 5 were the most divergent,
whereas the signal peptide, the 5¢-UTR and 3¢-UTR and the
promoter region were the most highly conserved (Fig. 2).
The nucleotide substitutions mostly involved transitions
rather than transversions, in contrast with that observed in
conopeptide genes, thus excluding the involvement of DNA
polymerase V in genomic hypervariability [25]. These
observations are not consistent with the neutral evolution
theory, which states that the strong conservation of exons
serves to maintain the function of the mature protein [26].
The protein-coding regions of the PLA2 genes of French
vipers most probably evolved in an accelerated Darwinian
manner, as reported for the PLA2 genes expressed in
Crotalinae and V. am. ammodytes venom [2,3,5,7,8].
Deduced amino-acid sequence analysis

We aligned the amino-acid sequences deduced from the
consensus nucleotide sequence of each PLA2 (Fig. 3). The
peptides encoded by exons 3 and 5 were the least well
conserved for all the PLA2 genes sequenced, with only 45%
and 49% identity, respectively. In contrast, the peptide
encoded by exon 2 was the most highly conserved, with
76% identity between all PLA2 sequences. Similar obser-
vations have been reported for the V. palaestinae and
Trimeresurus PLA2s [6,9]. The mature PLA2 proteins
displayed a mean of 51% identity in terms of their amino-
acid sequences. The ammodytin I1 and ammodytin I2
proteins were the most similar, displaying 78% amino-acid
sequence identity. The B chain of vaspin was the most
divergent, displaying 67% identity with the vaspin A chain,
and 70% identity with the V. b. berus PLA2.
The signal peptides of all the proteins were 16 amino
acids long. The mature proteins consisted of 122 amino
acids for ammodytin I1, the A and B chains of vaspin
and V. b. berus PLA2, and 121 amino acids for ammo-
dytin I2. The amino-acid sequence of the vaspin A chain
was identical in all snake species and was 100% identical
with that of the acidic subunit of PLA2-I from
V. a. zinnikeri [17]. The deduced amino-acid sequence
of the V. b. berus anticoagulant PLA2 protein was
identical with that of the PLA2 purified from V. b. berus
venom [20]. No difference was observed between the
ammodytin I2 sequences from the neurotoxic V. a. aspis
snake, V. b. berus,andV. am. ammodytes [19]. However,
for V. a. aspis, one group of genes (23 of 42) contained a
sequence identical with that found in V. am. ammodytes,

whereas another group (19 of 42) had one amino-acid
difference (Asn111Ser), corresponding to a mutation in
the fifth exon (Fig. 3). The sequence of the vaspin B
chain was identical in V. a. zinnikeri and the neurotoxic
V. a. aspis. However, it differed by one residue from the
sequence of the B chain of vipoxin from V. am. merid-
ionalis [19], and by three residues from the published
Fig. 2. Alignment of the consensus sequences of ammodytin I1 (AmtI1),
ammodytin I2 (AmtI2), vaspin chains A and B and V. berus PLA2 genes
isolated from French vipers. The ammodytin I1 consensus sequence was
defined from the sequences of V. a. aspis, V. a. zinnikeri,neurotoxic
V. a. aspis isoforms 1 and 2 and V. b. berus PLA2 (DDBJ/EMBL/
GenBank accession no.s AY159807, AY159810, AY159808,
AY159809 and AY159811, respectively). The ammodytin I2 consensus
sequence was defined from the sequences of V. a. aspis,neurotoxic
V. a. aspis and V. b. berus (DDBJ/EMBL/GenBank accession no.s
AY158637, AY158638 and AY158639, respectively). The vaspin chain
A consensus sequence was defined from the sequences of V. a. zin-
nikeri and neurotoxic V. a. aspis (DDBJ/EMBL/GenBank accession
no.s AY152843 and AF548351) and that of vaspin chain B, from the
sequences of V. a. zinnikeri and neurotoxic V. a. aspis (DDBJ/EMBL/
GenBank accession no.s AY158635 and AY158634). Dots indicate
identity with the ammodytin I1 sequence. Asterisks indicate nucleo-
tides conserved within PLA2s. Dashes correspond to deleted nucleo-
tides if the ammodytin I1 sequence is taken as the reference sequence.
Italics indicate DNA tandem repeats. Putative transcription factor-
binding sites are boxed.
2702 I. Guillemin et al.(Eur. J. Biochem. 270) Ó FEBS 2003
Ó FEBS 2003 Genomic analysis of phospholipases A
2

from French viper venoms (Eur. J. Biochem. 270) 2703
sequence of the basic subunit of PLA2-I from V. a. zin-
nikeri [17]. Finally, we obtained three different ammody-
tin I1 sequences (In, Ia and Ib) as shown in Table 2 and
Fig. 3. The amino-acid sequence of ammodytin In
was identical with that reported for the protein
from V. am. ammodytes (DDBJ/EMBL/GenBank AC
AF253048). This sequence was identified in four ammo-
dytin I1 clones from the neurotoxic V. a. aspis. Ammo-
dytin Ia accounted for the remaining six clones, and all
the genes of V. a. aspis and V. a. zinnikeri. Its sequence
was 97% identical (four amino-acid differences:
Met70Leu, Gly71Ser, Gln78Glu and Phe123Leu) with that
of the ammodytin I1 of V. am. ammodytes (Fig. 3). The six
clones of the neurotoxic V. a. aspis harboring the ammody-
tin Ia sequence were those for which a 126-bp deletion in the
ammodytin I1 gene had been identified (Table 3). Ammo-
dytin Ib was found only in V. b. berus, and differed from
ammodytin Ia by three amino-acid residues (98% identity:
Ile/Thr, in the signal peptide, and His1Asn, Asn56Lys). In
fact, ammodytin In is a hybrid molecule derived from the
N-terminus of ammodytin Ia and the C-terminus of ammo-
dytin Ib. Hybrid PLA2s have been reported in several
venomous species of pit vipers [27]. However, this hybrid
could not have been produced by recombination between
ammodytin Ia and Ib genes in the neurotoxic V. a. aspis
snakes, because there was no gene for ammodytin Ib in the
genome of this snake.
These findings provide clues to the evolutionary position
of the neurotoxic V. a. aspis population with respect to the

other snakes studied. The genome of one of these neurotoxic
snakes displayed features characteristic of V. am. ammo-
dytes (monomeric ammodytins A, B and C, and ammodytin
I1n with a 259 bp intron D, the Bov-B LINE retroposon)
and of V. a. aspis (vaspin A and B chains and ammodytin
I1a with a 133 bp intron D; Table 2). This suggests possible
interbreeding between these two species, leading to a hybrid
V. a. aspis with a higher level of polymorphism in venom
PLA2 genes in this snake (Table 2). The identification of
natural hybrids between V. a. aspis and V. am. ammodytes
in Italy is consistent with the hypothesis of horizontal
transfer [28]. Moreover, immunological analysis of albumin
proteins also suggests that V. aspis and V. ammodytes are
closely related species [29]. The unusually strong conserva-
tion of introns in PLA2 genes may facilitate homologous
recombination events between PLA2 genes from different
species.
Amino-acid substitutions: implications for PLA2
structure and/or function
The amino-acid substitutions due to the variant PLA2 genes
are indicated below the protein sequence alignment in
Fig. 3. Frameshifts were observed in exons 4 and 5 of the
ammodytin I1 gene, and in exon 3 of the ammodytin I2 gene
Fig. 3. Alignment of V. a. aspis, V. a. zinnike ri, V. b. berus and neurotoxic V. a. aspis PLA2 protein sequences. Dots indicate amino acid residues
identical with those of the ammodytin I2 protein. Dashes indicate gaps introduced to optimize the alignment, using Renetseder’s numbering system
[39]. AmI2 (blue) corresponds to ammodytin I2, VaspB (red) corresponds to the vaspin chain B protein and VaspA (green) corresponds to vaspin
chain A. AmI1n corresponds to ammodytin from the neurotoxic V. a. aspis. AmI1a corresponds to the ammodytin I1 of V. a. aspis, V. a. zinnikeri
and the neurotoxic V. a. aspis. AmI1b corresponds to ammodytin I1 from V. b. berus. VB (black) corresponds to V. b. berus PLA2. The cysteine
residues involved in disulfide bridges are indicated in yellow. . indicates residue Asp49. Amino acid substitutions resulting from nucleotide
polymorphisms are indicated below the alignment, in the color used for the PLA2.

2704 I. Guillemin et al.(Eur. J. Biochem. 270) Ó FEBS 2003
(data not shown). There was also a single nonsense
mutation leading to insertion of the TAA stop codon in
exon 3 of one of the vaspin A chain genes of V. a. zinnikeri
(data not shown). These four clones are inactive. The
existence of pseudogenes has also been reported in the
genome of O. okinavensis [10]. As previously shown by Kini
& Chan [11], the highest mutation frequencies corresponded
to the exposed regions of the molecule, particularly those
involved in the pharmacological activities of PLA2. These
mutations may affect the enzymatic activity, stability and
toxicity of the PLA2s.
Enzymatic activity and stability of PLA2s
Key residues involved in or required for PLA2 structure and
catalysis were well conserved (Fig. 3). Most of the amino
acids forming the hydrophobic channel and its opening are
located in the N-terminal helix and helix a3 [14,30,31]. These
amino acids were conserved in the five PLA2s, with only
rare substitutions observed (Tyr22His; Ala102Val; Ala103-
Val; Fig. 3). The amino-acid residues that form part of the
calcium-binding loop, including Tyr28, Gly30, Gly32 and
Asp49, were very well conserved among PLA2s. Neverthe-
less, the Tyr28His, Gly30Asp, and Asp49Asn substitutions
were found in some genes (Fig. 3), and these substitutions
may affect Ca
2+
binding, which is necessary for the catalytic
activity of PLA2 enzymes. In group II PLA2s, 12–16
cysteine residues are involved in the formation of six to eight
disulfide bridges that stabilize the structure of the molecule.

Six of these residues were substituted (Fig. 3), probably
decreasing the stability of the molecule by preventing the
formation of disulfide bonds.
Toxicity and heterocomplex formation
Little is known about the toxicity of ammodytin I1. Komori
et al. [32] purified three PLA2s from V. aspis venom
(PLA2-I, PLA2-II and PLA2-III) and determined their
biological activities. The N-terminal sequence of PLA2-III
is identical with that deduced here from the nucleotide
sequence of ammodytin I1. Thus, if PLA2-III corresponds
to ammodytin I1, it is not lethal. Ammodytin I2 is a
nontoxic PLA2 [33]. Vaspin is a neurotoxin [13,17] and the
PLA2 of V. b. berus has potent anticoagulant activity [20].
Mutations leading to amino-acid substitutions were most
common in exon 4. They were clustered in an exposed
region defined as the b-wing and in a short segment defined
as the anticoagulant region [34]. Such mutations were also
found in exons 3 and 5, specifically in the first 16 residues of
exon 3 and at the 3¢ extremity of exon 5 (Fig. 3). It has been
suggested that the b-wing region and the region between
amino acids 106 and 128 in exon 5 are involved in PLA2
toxicity [30,35,36]. If this is indeed the case, then substitu-
tions occurring in these areas may affect the neurotoxicity or
anticoagulant effect of the PLA2.
The substitutions in the A and B chains of vaspin, in the
inhibitor and PLA2 subunits, respectively, should be
considered together, as these proteins associate in a het-
erodimeric complex to exert their neurotoxic effects. The
formation of this complex involves intermolecular inter-
actions [17,37,38]. The inhibitor subunit stabilizes the

unstable PLA2 subunit through hydrophobic, ionic and
electrostatic interactions, and hydrogen bonds [17,37,38].
Substitution of the residues involved in these interactions
would therefore be expected to impair the formation or
stabilization of the complex, or both, thereby affecting the
toxicity of the protein. This is probably the case for changes
in the residues involved in the interaction between the two
subunits: Asn1Ser, Phe3Leu in the PLA2 subunit and
Gln34His in the inhibitor subunit (Fig. 3) [17,37].
Conclusion
Several groups of genes encoding Vipera venom PLA2s
(chains A and B of vaspin, ammodytin I1, ammodytin I2
and an anticoagulant PLA2 from V. b. berus venom) were
sequenced in this study. Nonsynonymous mutations were
observed in these genes, demonstrating a high level of
genetic variability in Viperinae PLA2s. Some of these
mutations led to amino-acid changes, most commonly in
the sequences encoded by the third and fifth exons, which
are involved in the biological functions of PLA2. Some
genes were pseudogenes, inactivated by frameshifts or by
mutations leading to the presence of a stop codon in the
sequence. The level of expression of the functional genes
is probably controlled by stress-responsive promoters.
Analysis of venom gland PLA2 cDNAs is currently
underway to determine which of these genes are expressed.
The presence in the neurotoxic snake of two ammodytin
I1 isoforms (In and Ia) and of several neurotoxin-encoding
genes, some specific to V. am. ammodytes venom, and of
the Bov-B LINE retroposon, which was isolated from the
V. am. ammodytes genome but not from the V. a. aspis

genome, leads us to conclude that the new population of
neurotoxic V. a. aspis is of ÔhybridÕ origin. Phylogenetic
and evolutionary analyses are underway to confirm this
hypothesis.
Acknowledgements
I. G. holds a postdoctoral fellowship from the Direction des
Programmes Transversaux de Recherche (PTR) of the Pasteur Institute.
This work was funded by the Direction des PTR of the Pasteur Institute.
We also thank Stephane Ferris and Eliana Ochoa from the genomics
platform Genopole-IP for technical assistance. We are grateful to
Y. Doljanski, O. Grosselet and A. Teynie
´
for capturing the snakes and
for carrying out the herpetological survey.
References
1. Danse, J.M., Gasparini, S. & Me
´
nez, A. (1997) Molecular biology
of snake venom phospholipases A2. In Venom Phospholipase A2
Enzymes: Structure, Function and Mechanism (Kini, R.M., ed.),
pp. 29–71. Wiley & Sons Ltd, Chichester, UK.
2. Kini, R.M. (1997) Phospholipase A2: a complex multifunctional
protein puzzle. In Venom Phospholipase A2 Enzymes: Structure,
Function and Mechanism (Kini, R.M., ed.), pp. 1–28. Wiley &
Sons, Chichester, UK.
3. Yoshikawa, T., Naruse, S., Kitagawa, M., Ishiguro, H., Naga-
hama, M., Yasuda, E., Semba, R., Tanaka, M., Nomura, K. &
Hayakawa, T. (2001) Cellular localization of group IIA phos-
pholipase A2 in rats. J. Histochem. Cytochem. 49, 777–782.
4. Kordis, D. & Gubensek, F. (1996) Ammodytoxin C gene helps to

elucidate the irregular structure of Crotalinae group II phospho-
lipase A2 genes. Eur. J. Biochem. 240, 83–90.
Ó FEBS 2003 Genomic analysis of phospholipases A
2
from French viper venoms (Eur. J. Biochem. 270) 2705
5. Kordis, D. & Gubensek, F. (1997) Bov-B long interspersed
repeated DNA (LINE) sequences are present in Vipera ammodytes
phospholipase A2 genes and in genomes of Viperidae snakes.
Eur. J. Biochem. 246, 772–779.
6. Kordis, D., Bdolah, A. & Gubensek, F. (1998) Positive Darwinian
selection in Vipera palaestinae phospholipase A2 genes is
unexpectedly limited to the third exon. Biochem. Biophys. Res.
Commun. 251, 613–619.
7. John, T.R., Smith, L.A. & Kaiser, I.I. (1994) Genomic
sequences encoding the acidic and basic subunits of Mojave toxin:
unusually high sequence identity of non-coding regions. Gene 139,
229–234.
8. Nakashima, K., Nobuhisa, I., Deshimaru, M., Nakai, M., Ogawa,
T.,Shimohigashi,Y.,Fukumaki,Y.,Hattori,M.,Sakaki,Y.&
Hattori, S. (1995) Accelerated evolution in the protein-coding
regions is universal in Crotalinae snake venom gland phospho-
lipase A2 isozyme genes. Proc. Natl. Acad. Sci. USA 92, 5605–5609.
9. Nakashima, K., Ogawa, T., Oda, N., Hattori, M., Sakaki, Y.,
Kihara,H.&Ohno,M.(1993)AcceleratedevolutionofTrimer-
esurus flavoviridis venom gland phospholipase A2 isozymes. Proc.
Natl. Acad. Sci. USA 90, 5964–5968.
10. Nobuhisa, I., Nakashima, K., Deshimaru, M., Ogawa, T., Shi-
mohigashi, Y., Fukumaki, Y., Sakaki, Y., Hattori, S., Kihara, H.
& Ohno, M. (1996) Accelerated evolution of Trimeresurus okina-
vensis venom gland phospholipase A2 isozyme-encoding genes.

Gene 172, 267–272.
11. Kini, R.M. & Chan, Y.M. (1999) Accelerated evolution and
molecular surface of venom phospholipase A2 enzymes. J. Mol.
Evol. 48, 125–132.
12. De Haro, L., Robbe-Vincent, A., Saliou, B., Valli, M., Bon, C. &
Choumet, V. (2002) Unusual neurotoxic envenomations by Vipera
aspis aspis snakes in France. Hum. Exp. Toxicol. 21, 137–145.
13. Jan, V., Maroun, R.C., Robbe-Vincent, A., De Haro, L. &
Choumet, V. (2002) Toxicity evolution of Vipera aspis aspis
venom: identification and molecular modeling of a novel phos-
pholipase A2 heterodimer neurotoxin. FEBS Lett. 527, 263–268.
14. Winnepenninckx, B., Backeljau, T. & De Wachter, R. (1993)
Extraction of high molecular weight DNA from molluscs. Trends
Genet. 9, 407.
15. Ewing, B., Hillier, L., Wendl, M.C. & Green, P. (1998) Base-
calling of automated sequencer traces using phred. I. Accuracy
assessment. Genome Res. 8, 175–185.
16. Perbandt, M., Wilson, J.C., Eschenburg, S., Mancheva, I., Alek-
siev, B., Genov, N., Willingmann, P., Weber, W., Singh, T.P. &
Betzel, C. (1997) Crystal structure of vipoxin at 2.0 A
˚
: an example
of regulation of a toxic function generated by molecular evolution.
FEBS Lett. 412, 573–577.
17. Komori, Y., Masuda, K., Nikai, T. & Sugihara, H. (1996) Com-
plete primary structure of the subunits of heterodimeric phos-
pholipase A2 from Vipera a. zinnikeri venom. Arch. Biochem.
Biophys. 327, 303–307.
18. Wang,Y M.,Lu,P.J.,Ho,C.L.&Tsai,I.H.(1992)Character-
ization and molecular cloning of neurotoxic phospholipase A2

from Taiwan viper (Vipera russelli formosensis). Eur. J. Biochem.
209, 635–641.
19. Krizaj, I., Liang, N S., Pungercar, J., Strukelj, B., Ritonja, A. &
Gubensek, F. (1992) Amino acid and cDNA sequences of a neu-
tral phospholipase A2 from the long-nosed viper (Vipera ammo-
dytes ammodytes)venom.Eur. J. Biochem. 204, 1057–1062.
20. Krizaj, I., Siigur, J., Samel, M., Cotic, V. & Gubensek, F. (1993)
Isolation, partial characterization and complete amino acid
sequence of the toxic phospholipase A2 from the venom of the
common viper, Vipera berus berus. Biochim. Biophys. Acta 1157,
81–85.
21. Daltry, J.C., Wu
¨
ster,W.&Thorpe,R.S.(1996)Dietandsnake
venom evolution. Nature (London) 379, 537–540.
22. Nakashima, K., Nobuhisa, I., Deshimaru, M., Ogawa, T.,
Shimohigashi, Y., Fukumaki, Y., Hattori, M., Sakaki, Y.,
Hattori, S. & Ohno, M. (1995) Structures of genes encoding
TATA box-binding proteins from Trimeresurus gramineus and
T. flavoviridis snakes. Gene 152, 209–213.
23. Lavrovsky, Y., Schwartzman, M.L., Levere, R.D., Kappas, A. &
Abraham, N.G. (1994) Identification of binding sites for tran-
scription factors NF-kappa B and AP-2 in the promoter region of
the human heme oxygenase 1 gene. Proc. Natl Acad. Sci. USA 91,
5987–5991.
24. Faure, G. & Bon, C. (1988) Crotoxin, a phospholipase A2
neurotoxin from the South American rattlesnake Crotalus durissus
terrificus: purification of several isoforms and comparison of their
molecular structure and of their biological activities. Biochemistry
27, 730–738.

25. Conticello, S.G., Gilad, Y., Avidan, N., Ben-Asher, E., Levy, Z. &
Fainzilber, M. (2001) Mechanisms for evolving hypervariability:
the case of conopeptides. Mol. Biol. Evol. 18, 120–131.
26. Kimura, M. (1983) The Neutral Theory of Molecular Evolution.
Cambridge University Press, Cambridge, UK.
27. Pan,H.,Liu,X L.,Ou-Yang,L L.,Yang,G Z.,Zhou,Y C.,
Li, Z P. & Wu, X F. (1998) Diversity of cDNAs encoding
phospholipase A2 from Agkistrodon halys pallas venom, and its
expression in E. coli. Toxicon 36, 1155–1163.
28. Naulleau, G. (1997) La Vipe
`
re Aspis, pp. 42–43. Eveil Nature,
Angoule
`
me, France.
29. Herrmann, H.W. & Joger, U. (1997) Evolution of viperine snakes.
In Venomous Snakes: Ecology, Evolution and Snakebite (Thorpe,
R.S., Wu
¨
ster, W. & Malhotra, A., eds), pp. 43–61. The Zoological
Society of London and Clarendon Press, Oxford, UK.
30. Dupureur, C.M., Yu, B.Z., Jain, M.K., Noel, J.P., Deng, T., Li, Y.,
Byeon, I.J. & Tsai, M.D. (1992) Phospholipase A2 engineering.
Structural and functional roles of highly conserved active site re-
sidues tyrosine-52 and tyrosine-73. Biochemistry 31, 6402–6413.
31. White, S.P., Scott, D.L., Otwinowski, Z., Gelb, M.H. & Sigler,
P.B. (1990) Crystal structure of cobra-venom phospholipase A2
in a complex with a transition-state analogue. Science 250,
1560–1563.
32. Komori, Y., Nikai, T. & Sugihara, H. (1990) Comparative study

of three phospholipase A2s from the venom of Vipera aspis. Comp.
Biochem. Physiol. 97, 507–514.
33. Sribar, J., Copic, A., Paris, A., Sherman, N.E., Gubensek, F., Fox,
J. & Krizaj, I. (2001) A high affinity acceptor for phospholipase A2
with neurotoxic activity is a calmodulin. Eur. J. Biochem. 276,
13493–12496.
34. Kini, R.M. & Evans, H.J. (1989) A model to explain the phar-
macological effects of snake venom phospholipases A2. Toxicon
27, 613–635.
35. Curin-Serbec,V.,Novak,D.,Babnik,J.,Turk,D.&Gubensek,F.
(1991) Immunological studies of the toxic site in ammodytoxin A.
FEBS Lett. 280, 175–178.
36. Ivanovski, G., Copic, A., Krizaj, I., Gubensek, F. & Pungercar, J.
(2000) The amino acid region 115–119 of ammodytoxins plays an
important role in neurotoxicity. Biochem. Biophys. Res. Commun.
276, 1229–1234.
37. Banumathi, S., Rajashankar, K.R., Notzel, C., Aleksiev, B.,
Singh, T.P., Genov, N. & Betzel, C. (2001) Structure of the neu-
rotoxic complex vipoxin at 1.4 A
˚
resolution. Acta Crystallogr. D
57, 1552–1559.
38. Betzel, C., Genov, N., Rajashankar, K.R. & Singh, T.P. (1999)
Modulation of phospholipase A2 activity generated by molecular
evolution. Cell. Mol. Life Sci. 56, 384–397.
39. Renetseder, R., Dijkstra, B.W., Huizinga, K., Kalk, K.H., Drenth,
J., Krizaj, I. & Gubensek, F. (1988) Crystal structure of bovine
pancreatic phospholipase A2 covalently inhibited by p-bromo-
phenacyl-bromide. J. Mol. Biol. 200, 181–188.
2706 I. Guillemin et al.(Eur. J. Biochem. 270) Ó FEBS 2003