Báo cáo Y học: The role of the second binding loop of the cysteine protease inhibitor, cystatin A (stefin A), in stabilizing complexes with target proteases is exerted predominantly by Leu73 pdf

The role of the second binding loop of the cysteine protease inhibitor,
cystatin A (stefin A), in stabilizing complexes with target proteases
is exerted predominantly by Leu73
Alona Pavlova, Sergio Estrada* and Ingemar Bjo¨rk
Department of Veterinary Medical Chemistry, Swedish University of Agricultural Sciences, Uppsala Biomedical Centre, Sweden
The aim of this work was to elucidate the roles of individual
residues within the flexible second binding loop of human
cystatin A in the inhibition of cysteine proteases. Four
recombinant variants of the inhibitor, each with a single
mutation, L73G, P74G, Q76G or N77G, in the most
exposed part of this loop were generated by PCR-based site-
directed mutagenesis. The binding of these variants to
papain, cathepsin L, and cathepsin B was characterized by
equilibrium and kinetic methods. Mutation of Leu73
decreased the affinity for papain, cathepsin L and cathep-
sin B by  300-fold, >10-fold and  4000-fold, respect-
ively. Mutation of Pro74 decreased the affinity for
cathepsin B by  10-fold but minimally affected the affinity
for the other two enzymes. Mutation of Gln76 and Asn77
did not alter the affinity of cystatin A for any of the proteases
studied. The decreased affinities were caused exclusively by
increased dissociation rate constants. These results show that
the second binding loop of cystatin A plays a major role in
stabilizing the complexes with proteases by retarding their
dissociation. In contrast with cystatin B, only one amino-
acid residue of the loop, Leu73, is of principal importance for
this effect, Pro74 assisting to a minor extent only in the case
of cathepsin B binding. The contribution of the second
binding loop of cystatin A to protease binding varies with
the protease, being largest,  45% of the total binding
energy, for inhibition of cathepsin B.

Keywords: cathepsins; cystatin; cysteine proteases; papain;
second binding loop.
Cystatins are effective protein inhibitors of cysteine pro-
teases of the papain superfamily (reviewed in [1–4]). Found
both intracellularly and extracellularly, they are believed to
control the activity of normal endogenous proteases, as well
as to protect organisms from the harmful activity of
exogenous cysteine proteases [1,4–11]. They are generally
classified into three families according to their size and the
presence of internal disulfide bonds. Cystatins of family 1,
also called stefins, are small nonglycosylated proteins  11–
12 kDa in size without disulfide bonds. Family 2 cystatins
are somewhat larger,  12–14 kDa, with a structure stabi-
lized by two disulfide bonds. Kininogens, representing the
third family, are glycosylated proteins of about 50–90 kDa.
The single polypeptide chain of a kininogen contains three
domains resembling family 2 cystatins.
Cystatins competitively inhibit the activity of papain-
like cysteine proteases by binding to the active site of the
latter and forming a tight, reversible protein–protein
complex. A model of the inhibition was initially proposed
from computer docking experiments based on the X-ray
structures of papain and chicken cystatin, a family 2
member [12]. This model was later substantiated by the
X-ray structure of a complex of the family 1 cystatin,
human cystatin B (stefin B), with papain [13], the only
structure of a cystatin–protease complex determined so
far. The N-terminal segment and two hairpin loops of the
cystatin together form a hydrophobic wedge-shaped edge
that fits well into the active-site cleft of papain. The high

degree of complementarity between the interacting surfa-
ces allows the complex to form without significant
conformational changes of either papain or the inhibitor
[12–18]. Both the similar three-dimensional structures of
cystatins of families 1 and 2 [12,13,19–21] and the
pronounced sequence homology and similar fold of
cysteine proteases of the papain family [4,11,22–24]
indicate that the general aspects of the interaction model
can be extended to complexes between cystatins and other
members of this protease family. However, certain distin-
guishing features of the structures of some cysteine
proteases, such as the occluding loop of cathepsin B
[25], cause the mode of inhibition to deviate somewhat for
these enzymes. Cystatins thus inhibit cathepsin B by a
two-step reaction involving displacement of the occluding
loop of the protease in the second step [26,27]. Moreover,
it is apparent that the role of an individual binding region
Correspondence to I. Bjo
¨
rk, Department of Veterinary Medical
Chemistry, Swedish University of Agricultural Sciences,
Uppsala Biomedical Centre, Box 575, SE-751 23 Uppsala, Sweden.
Fax: + 46 18 550762, Tel.: + 46 18 4714191,
E-mail:
Abbreviations: app, subscript denoting an apparent equilibrium or rate
constant determined in the presence of an enzyme substrate; E-64,
4-[(2S,3S)-3-carboxyoxiran-2-carbonyl-
L
-leucylamido]butylguani-
dine; His-tag, 10 successive histidine residues fused to an expressed

protein; k
ass
, bimolecular association rate constant; K
d
, dissociation
equilibrium constant; k
diss
, dissociation rate constant; K
i
,inhibition
constant; k
obs
, observed pseudo-first-order rate constant.
*Present address: PET-Centre, Uppsala University, University
Hospital, SE-751 85 Uppsala, Sweden.
(Received 12 July 2002, revised 16 September 2002,
accepted 20 September 2002)
Eur. J. Biochem. 269, 5649–5658 (2002) Ó FEBS 2002 doi:10.1046/j.1432-1033.2002.03273.x
of the inhibitor in protease binding can differ with the
target protease [28].
The contributions of the N-terminal region and the first
binding loop of family 1 and 2 cystatins, as well as of the
second binding loop of family 2 cystatins, to the inhibition
of cysteine proteases have been elucidated [29–36]. Recent
work has also demonstrated the importance of two amino-
acid residues, Leu73 and His75, in the second binding loop
of the family 1 inhibitor, cystatin B, for high-affinity
binding to a number of cysteine proteases [37]. The sequence
of the corresponding hairpin loop in cystatin A (stefin A),
another member of family 1, is appreciably different from

that in cystatin B; in particular, His75 of cystatin B is
substituted by Gly in cystatin A [1]. Moreover, the NMR
structure of cystatin A shows that the second loop of this
inhibitor is highly flexible, which might be expected to affect
the interactions with the protease [20]. It is thus unclear
whether the second binding loop of cystatin A fulfils the
same function as the second binding loops of cystatin B and
family 2 cystatins and also what residues of this loop in
cystatin A may participate in the interaction.
To elucidate the role of the second binding loop of human
cystatin A in the inhibition of cysteine proteases, we have
characterized the contribution of four individual amino-acid
residues within the most exposed region of this loop (from
Leu73 to Asn77) to protease binding (see Fig. 1A). Four
recombinant cystatin A variants with Gly replacing each of
these amino acids were prepared, and their interaction with
papain, cathepsin L, and cathepsin B was characterized by
equilibrium and kinetic methods. The results clearly show
that the second binding loop of cystatin A is important for
the stability of complexes with cysteine proteases. Its
quantitative role in protease binding varies with the target
enzyme, but is especially important for cathepsin B. Leu73,
which is highly conserved in family 1 cystatins, makes the
predominant contribution of all residues of the loop to the
free energy of formation of the enzyme–inhibitor complex.
Pro74 is of minimal importance for the interaction with
papain and cathepsin L but participates to some extent in
cathepsin B binding. However, the roles of Gln76 and
Asn77 in the protease inhibition are negligible.
MATERIALS AND METHODS

Construction of expression vectors for cystatin A
second-loop mutants
A previously developed expression vector containing the
human cystatin A coding sequence preceded by successive
sequences for the leader peptide for the outer membrane
protein A of Escherichia coli, a His-tag, and the recognition
site for enterokinase was used in this work [38]. This vector
has a kcl857 temperature-sensitive repressor gene, allowing
induction of expression by increasing the temperature, and
an ampicillin-resistance gene [18]. Residues Leu73, Pro74,
Gln76, and Asn77 within the second binding loop of
cystatin A were substituted with Gly by PCR-based site-
directed mutagenesis [39]. Briefly, two mutagenic primers
and two standard PCR primers, the latter being comple-
mentary to regions of the vector flanking the cysta-
tin A-coding sequence, were used for creation of each
mutant (Table 1). The desired mutation was introduced in
two steps. First, two overlapping DNA fragments, bearing
Fig. 1. Model of the three-dimensional structure of the complex between
cystatin A and active papain. (A) Overall structure of the complex in
ribbon representation, with cystatin A in green and papain in blue.
Residues in the second binding loop of cystatin A mutated in this work
areinred.PapainresiduesinvolvedininteractionswiththecystatinA
second-binding-loop residues are in black. (B) Close-up view of the
interactions between residues in the second binding loop of cystatin A
and papain residues. The colors of the residues are as in (A). Inter-
molecular hydrophobic contacts within a distance of 4 A
˚
are repre-
sented as dashed lines. The model is derived from the X-ray structure

of the human C3S-cystatin B–S-(carboxymethyl)papain complex
(PDB entry 1STF) [13].
5650 A. Pavlova et al.(Eur. J. Biochem. 269) Ó FEBS 2002
the same mutation, were synthesized in two separate PCRs,
in each of which a mutagenic and a standard primer were
used and the cystatin A expression vector was the template.
In the next step, a larger DNA fragment containing the
entire mutant cystatin A-coding sequence was obtained by a
third PCR with the standard PCR primers and with a
mixture of the products of the previous two PCRs as
template. The resulting DNA fragment was cleaved with
NcoIandBamHI, and the purified cleavage product
containing the mutant cystatin A cDNA was cloned into
the original vector between the NcoIandBamHI restriction
sites, replacing the corresponding region coding for wild-
type cystatin A [38]. The vector was then transformed into
E. coli strain MC 1061, made competent with CaCl
2
[40],
and transformants were selected by growing the bacteria on
agar plates containing ampicillin. Plasmids from a number
of colonies of each mutant were purified, and those with
the correct mutant cystatin A cDNA were identified by
sequencing in an ABI PRISMÒ 310 Genetic Analyzer
(Applied Biosystems, Foster City, CA, USA).
Expression and purification of cystatin A mutants
Recombinant L73G, P74G, Q76G, and N77G cystatin A
variants were expressed in E. coli essentially as described
previously [18]. The recombinant proteins were purified
from periplasmic extracts by immobilized metal affinity

chromatography on HisBindÒ Resin (Novagen, Madison,
WI, USA), charged with Ni
2+
, or Ni/nitrilotriacetate
agarose (Qiagen, Hilden, Germany), as in previous work
[38]. The His-tag was cleaved off with enterokinase (EC
3.4.21.9; Biozyme Laboratories, Blaenavon, UK), and the
liberated cystatin A mutant was isolated by rechromato-
graphy on the same affinity column [38]. Intact His-tagged
fusion proteins still contaminating some preparations were
removed by absorption on a TALON
TM
Metal Affinity
Resin (Clontech, Palo Alto, CA, USA) by a hybrid batch/
gravity flow column procedure according to a protocol from
the manufacturer.
Chicken cystatin
Forms1and2ofchickencystatinwereisolatedfrom
chicken egg white [41]. The two forms have the same
sequence and are functionally identical [41], although form 2
is phosphorylated at Ser80 [42] and therefore has a lower
isoelectric point.
Proteases
Papain (EC 3.4.22.2) was purified, stored as inactive
S-(methylthio)papain and activated before use as in previ-
ous work [41]. The thiol group content of the activated
papain, determined by reaction with 5,5¢-dithiobis(2-nitro-
benzoic acid) [43], was 0.95–1.00 mol per mol of enzyme.
Titrations with chicken cystatin (form 1) [41] gave a cystatin
to papain stoichiometry of 0.98 ± 0.02, indicating that

the enzyme was fully active in binding cystatins.
Cathepsin L (EC 3.4.22.15) from sheep liver was a gift from
R. W. Mason, Alfred I. du Pont Institute, Wilmington, DE,
USA. Human liver cathepsin B (EC 3.4.22.1) was obtained
from Calbiochem (San Diego, CA, USA).
Determination of protein concentration
Most protein concentrations were calculated from
A
280
measurements. Molar absorption coefficients of
55 900
M
)1
Æcm
)1
for papain and S-(methylthio)papain
[41], 8800
M
)1
Æcm
)1
for all forms of cystatin A [18], and
11 400
M
)1
Æcm
)1
for chicken cystatin [41] were used. The
concentration of active cathepsin L was determined by
titration with 4-[(2S,3S)-3-carboxyoxiran-2-carbonyl-

L
-leu-
cylamido]butylguanidine (E-64) [44]. The concentration of
cathepsin B was provided by the manufacturer.
Binding stoichiometries
The stoichiometries of binding of the cystatin A variants to
papain were determined at least in duplicate by titrations of
1 l
M
active papain or S-(methylthio)papain with the
variants. The binding to active papain was monitored
by following the decrease in activity of the enzyme with
a chromogenic substrate [38], whereas the binding to
S-(methylthio)papain was monitored by following the
change in tryptophan fluorescence accompanying the
interaction [41]. The binding stoichiometries were deter-
mined by nonlinear least-squares regression analysis of the
titration curves [41].
Inhibition constants
Apparent inhibition constants, K
i
,
app
, for the inhibition of
cathepsins L and B by the cystatin A mutants were obtained
from the equilibrium rates of hydrolysis of a fluorogenic
substrate by the enzyme at different inhibitor concentrations
Table 1. Primers for construction of expression vectors for cystatin A second-loop mutants. All sequences are given in the 5¢fi3¢ direction. Codons
for Gly, replacing residues to be mutated, are underlined, and base changes introducing the mutations are in bold.
Primer Mutation Direction Sequence

Standard All Forward
GCTCAGGCGACCATGGGCCATCATCATC
Reverse CTTGCATGCCCTGCAGGTCG
Mutagenic L73G Forward GTATTCAAAAGTGGTCCCGGACAAAATGAG GACTTG
Reverse TCCGGGACCACTTTTGAATACTTTCAAGTGCATATATTTATT
P74G Forward CAAAAGTCTTGGCGGACAAAATGAGGACTTGGTAC
Reverse CATTTTGTCCGCCAAGACTTTTGAATACTT TCAAGTGC
Q76G Forward CTTCCCGGAGGAAATGAGGACTTGGTACTTACTG
Reverse CCTCATTTCCTCCGGGAAGACTTTTGAATA C
N77G Forward CGGACAAGGTGAGGACTTGGTACTTACTGGATAC
Reverse CAAGTCCTCACCTTGTCCGGGAAGACTTTTG
Ó FEBS 2002 Second protease-binding loop of cystatin A (Eur. J. Biochem. 269) 5651
[28,32]. Product formation was continuously monitored in a
conventional fluorimeter (F-4000; Hitachi, Tokyo, Japan)
as in previous work [28]. The substrates were carbobenz-
oxy-
L
-phenylalanyl-
L
-arginine 4-methylcoumaryl-7-amide
(Peptide Institute, Osaka, Japan) for cathepsin L and
carbobenzoxy-
L
-arginyl-
L
-arginine 4-methylcoumaryl-
7-amide (Peptide Institute) for cathepsin B at concentra-
tions of 5 and 10 l
M
, respectively. The fluorescence never

exceeded that corresponding to 5% substrate hydrolysis.
Inhibitor concentrations were at least 10-fold higher than
enzyme concentrations. The inhibition of the enzymes by
L73G-cystatin A was analysed at cystatin concentrations
ranging from (0.1–0.5) · K
i,app
to (6–10) · K
i,app
. Corres-
ponding measurements with P74G-cystatin A were per-
formed at inhibitor concentrations varying from
(0.5–2) · K
i,app
to (10–14) · K
i,app
, whereas the range was
from (3–4) · K
i,app
to (10–30) · K
i,app
for Q76G-cystatin A
and N77G-cystatin A. Values of K
i,app
were derived by
nonlinear regression analyses of plots of the ratio between
the inhibited and uninhibited rates of substrate hydrolysis
against inhibitor concentration [32]. True inhibition con-
stants, K
i
, were obtained after correction for substrate

competition [32,45,46].
Association kinetics
Association rate constants, k
ass,
for the inhibition of papain
and cathepsins L and B by the cystatin A mutants were
determined by continuously monitoring the loss of enzyme
activity in the presence of a fluorogenic substrate in either a
conventional fluorimeter (see above) or a stopped-flow
fluorimeter (SX-17
MV
; Applied Biophysics, Leatherhead,
UK) [28,38]. The substrate for papain was 10 l
M
carbo-
benzoxy-
L
-phenylalanyl-
L
-arginine 4-methylcoumaryl-7-
amide (Peptide Institute), and the substrates for cathepsins
L and B and their concentrations were the same as those
used to determine K
i
(see above). The fluorescence was
always lower than that given by 5% substrate hydrolysis.
The concentrations of the inhibitors were at least 10-fold
higher than those of the enzymes and were varied in a 10–
20-fold range. The highest inhibitor concentrations in
reactions with papain and cathepsin L were 10–20 n

M
,
whereas reactions with cathepsin B were analyzed at
inhibitor concentrations up to 30 l
M
for L73G-cystatin A
andupto0.3–0.5l
M
for the other mutants. Apparent
pseudo-first-order rate constants, k
obs,app
, were obtained by
nonlinear least-squares regression analysis of the progress
curves [28]. Apparent association rate constants, k
ass,app
,
were calculated from the slopes of plots of k
obs,app
vs.
inhibitor concentration and were corrected for substrate
competition to give the true association rate constants, k
ass
[28,45–47].
Dissociation kinetics
Dissociation rate constants, k
diss
, for the complexes of the
cystatin A mutants with papain were determined by dis-
placement experiments, essentially as detailed previously
[14,16]. Papain dissociating from the complexes was trapped

by a high excess of chicken cystatin (form 2), which binds
faster and more tightly to papain than cystatin A or the
cystatin A mutants do [14,18] (see also Results) and thereby
prevents reassociation of the cystatin A variants with the
enzyme. The concentration of the cystatin A mutant–
papain complexes was 2.5–5.0 l
M
, and the molar ratio of
the displacing chicken cystatin to the complexes varied
between 10-fold and 50-fold. The progress of the reaction
was monitored for 100–150 h by following the appearance
of the newly formed complex between papain and chicken
cystatin, analyzed by ion-exchange chromatography on
a MonoQ
TM
column (Amersham Biosciences, Uppsala,
Sweden). Form 2 of chicken cystatin was used because its
lower isoelectric point allows the complex with papain to be
well separated and thus easily quantified in this analysis.
k
diss
was calculated as described previously [14].
k
diss
for the complex between L73G-cystatin A and
cathepsin L was determined by trapping the enzyme
dissociated from the complex by a high concentration of
the substrate, carbobenzoxy-
L
-phenylalanyl-

L
-arginine
4-methylcoumaryl-7-amide, which binds tightly to cathep-
sin L with a K
m
of 1.8 l
M
[45]. In most experiments, the
complex was formed by incubating 0.04 n
M
cathepsin L
with 0.4 n
M
L73G-cystatin A for 90 min, which resulted in
an essentially complete reaction, with  80% of the enzyme
being saturated with the inhibitor. The substrate was then
added to a final concentration of 100 l
M
with minimal
dilution of the complex. Alternatively, the complex was
formed by incubation of 1 n
M
cathepsin L with 10 n
M
L73G-cystatin A for 15 min, resulting in  99% of the
enzyme being bound in the complex, and this mixture was
then diluted 1000-fold into 100 l
M
substrate. In both cases,
the dissociation of the complex was monitored in a

conventional fluorimeter by continuously recording the
fluorescence increase due to cleavage of the substrate by the
liberated cathepsin L. The fluorescence never exceeded that
corresponding to 5% substrate hydrolysis. k
diss
was deter-
mined by nonlinear least-squares regression analysis of the
progress curves [15].
Fluorescence emission spectroscopy
Fluorescence emission spectra of free papain and wild-type
or L73G-cystatin A, as well as of complexes of papain with
either of the two cystatin A variants, were recorded in an
SLM 4800S spectrofluorimeter (SLM-Aminco, Urbana, IL,
USA) with an excitation wavelength of 280 nm, as
described previously [16,41]. Papain and cystatin concen-
trations were 1.0 and 1.2 l
M
, respectively, giving > 99%
saturation of enzyme with inhibitor in analyses of the
complexes. All spectra were corrected for inner-filter effects
and for the wavelength dependence of the instrumental
response [41] and were normalized to a fluorescence
intensity of 1.0 for free papain at the wavelength of the
emission maximum. Difference spectra between the com-
plexes and the free proteins were calculated as in [41].
Protein modeling
The structure of human cystatin A in complex with active
papain was modeled on to the X-ray structure of the
complex between human C3S-cystatin B and S-(carboxy-
methyl)papain (PDB entry 1STF) [13] with the program

SWISS
-
PDB
Viewer ( The most
favorable rotamers of the side chains of the 46 residues
of cystatin A which differ from those of cystatin B [1]
were initially selected by the program [48], and the
5652 A. Pavlova et al.(Eur. J. Biochem. 269) Ó FEBS 2002
S-carboxymethyl group of the papain moiety of the
complex was removed in the same manner. The model
was then corrected by the program facility ÔQuick and Dirty
FixingÕ of all side chains in the complex, followed by
ÔExhaustive Search FixingÕ of the side chains within the
Leu73–Asn77 segment in the second binding loop of
cystatin A. After each of these steps, the conformation of
the second binding loop in the complex was refined by
energy minimization of the Leu73–Asn77 segment and all
neighboring residues within 6 A
˚
. The possibility of other
residues replacing Gly75 in the final model was evaluated by
ÔQuick and Dirty FixingÕ of all side chains in the complex
after each replacement.
Miscellaneous procedures
For N-terminal sequencing and determination of molecular
masses, the mutants were first desalted into 0.1% (v/v)
trifluoroacetic acidby gel chromatographyon Fast-Desalting
PC 3.2/10 columns (Amersham Biosciences). N-Terminal
sequences were analyzed by Edman degradation in an
Applied Biosystems 477A Protein Sequencer. Molecular

masses were measured by MALDI MS in a Kratos Kompact
MALDI 4 instrument (Kratos, Manchester, UK) as in
[18]. SDS/PAGE under reducing and nonreducing condi-
tions was performed with the Tricine buffer system [49].
Experimental conditions
All equilibrium and kinetic experiments were performed at
25.0 ± 0.2 °C. The proteases were first activated by 1 m
M
dithiothreitol in the reaction buffer for 10 min at 25 °C. The
inhibition of papain was studied in 50 m
M
Tris/HCl,
pH 7.4, containing 100 m
M
NaCl, 0.1 m
M
EDTA and,
except in the displacement experiments, 1 m
M
dithiothreitol
and 0.01% (w/v) BrijÒ 35. The interaction with cathepsin L
wasanalyzedin100 m
M
sodium acetate, pH 5.5, containing
100 m
M
NaCl, 1 m
M
EDTA, 1 m
M

dithiothreitol, and
0.01% (w/v) BrijÒ 35, whereas the buffer for cathepsin B
was 50 m
M
Mes/NaOH, pH 6.0, containing 100 m
M
NaCl,
0.1 m
M
EDTA, 1 m
M
dithiothreitol, and 0.1% (w/v)
poly(ethylene glycol) 6000.
RESULTS
Preparation, homogeneity and activity of cystatin A
mutants
Four variants of cystatin A, each with a single amino-acid
residue, Leu73, Pro74, Gln76 or Asn77, substituted by Gly
were produced by recombinant DNA techniques. All these
mutations are in the most exposed part of the second
protease-binding loop of the inhibitor (Fig. 1A). Residue 75
was not substituted, as it is Gly in the wild-type sequence.
The expression vectors were constructed by PCR-based site-
directed mutagenesis and contained the expected mutant
sequences in the case of the L73G, P74G and N77G
mutants. However, all vectors for the Q76G mutant purified
from 18 individual clones had, in addition to the desired
mutation, a T fi C substitution in the codon for Thr83.
This substitution was in the region specified by the forward
mutagenic primer for this mutant and was probably due to

an erroneously synthesized primer. As this additional
mutation is silent, one of the isolated vectors was neverthe-
less used for expression of Q76G-cystatin A. The mutants
were expressed with a removable His-tag and with a signal
peptide directing the proteins to the periplasmic space of
E. coli, facilitating purification.
All purified mutants were > 99.5% homogeneous on
SDS/PAGE. N-Terminal sequencing of the first five
residues confirmed that the His-tag was cleaved off properly
by enterokinase for all mutants. The molecular masses,
determined by MS, corresponded within 4.5 Da to those
calculated from the expected amino-acid sequences, con-
firming the correct length of the mutants, as well as the
presence of the desired mutations. All mutants bound active
papain and S-(methylthio)papain with stoichiometries
between 0.95 and 1.0, i.e. they were essentially fully active
in inhibition of cysteine proteases.
Binding affinity
All four cystatin A mutants bound so tightly to papain that
the affinity of the binding could not be determined by
equilibrium methods, because of the instability of the
enzyme at the low concentrations and the long reaction
times that would have been necessary. Therefore, K
d
for the
interaction with papain was calculated as k
diss
/k
ass
from

independently measured rate constants (see below and
Table 2), as was K
d
for wild-type cystatin A binding to this
enzyme in previous work [18]. Only the L73G mutation
caused a pronounced,  300-fold, decrease in the affinity for
papain, compared with that of the wild-type inhibitor
(Table 2). In contrast, the P74G, Q76G, and N77G muta-
tions resulted in minimal, less than twofold, changes in
affinity.
The high affinity of most mutants for cathepsin L also
precluded an accurate determination of K
i
from equilibrium
measurements. Such experiments gave only upper limits of
K
i
for the interaction of P74G, Q76G, and N77G cystatin A
with this protease (Table 2), similar to previous analyses of
K
i
for the wild-type inhibitor [35]. Moreover, as k
diss
for
these tight interactions could not be determined (see below),
K
d
could not be calculated from the rate constants. No
meaningful comparisons of the affinities of the three
mutants for cathepsin L with that of wild-type cystatin A

were therefore possible. However, a reliable K
i
for the
inhibition of cathepsin L by L73G-cystatin A was obtained
by equilibrium measurements and was > 10-fold higher
than that for wild-type cystatin A. The measured K
i
for this
mutant agreed well with K
d
calculated from k
ass
and k
diss
(see below and Table 2).
K
i
for the inhibition of cathepsin B by all cystatin A
forms was sufficiently high to be well determined by
equilibrium analyses. The L73G mutation caused a sub-
stantial,  4000-fold, increase in K
i
which was confirmed by
calculations of K
d
from k
ass
and k
diss
(Table 2). A smaller,

 10-fold, increase in K
i
for cathepsin B was also observed
for the P74G mutant, whereas the affinities of both Q76G
and N77G cystatin A for the enzyme differed minimally,
about twofold, from that of wild-type cystatin A (Table 2).
Association rate constants
The kinetics of association of the cystatin A mutants
with papain, cathepsin L and cathepsin B were analyzed
Ó FEBS 2002 Second protease-binding loop of cystatin A (Eur. J. Biochem. 269) 5653
by continuously monitoring the decrease in enzyme acti-
vity against a fluorogenic substrate. Most reactions were
studied by conventional fluorimetry, whereas the rapid
association of L73G-cystatin A with cathepsin B required
the use of stopped-flow measurements. All progress
curves were well fitted to a single-exponential function.
Plots of the dependence of k
obs,app
, derived from these
fits, on inhibitor concentration were linear in the concen-
tration range covered for all mutants. Values of k
ass
were determined from the slopes of these plots. All four
amino-acid substitutions in the second binding loop of
cystatin A had a marginal effect on k
ass
for the binding
to papain, cathepsin L or cathepsin B (Table 2).
Dissociation rate constants
The low dissociation rate constants of the complexes

between the cystatin A mutants and papain were measured
by displacement of the mutants from the complexes with an
excess of a tighter-binding inhibitor, chicken cystatin, in
experiments monitored by ion-exchange chromatography.
Only the L73G mutation altered k
diss
to any appreciable
extent, increasing it by  170-fold over that for wild-type
cystatin A. k
diss
for all other mutants was essentially
unaffected, with at most a twofold increase being observed
for P74G-cystatin A.
k
diss
of the complex between L73G-cystatin A and
cathepsin L was measured by displacement experiments, in
which the enzyme dissociating from the complex was cap-
tured by an excess of a tight-binding fluorogenic substrate.
The values of k
diss
obtained by two modifications of this
procedure agreed well with each other and with that
calculated from K
i
and k
ass
(Table 2). The L73G mutation
resulted in a greater than sevenfold increase in k
diss

,
compared with the value for wild-type cystatin A. This
method could not be used to determine k
diss
for the
complexes of the P74G, Q76G, and N77G mutants with
cathepsin L, because of the high stabilities of these complexes
and, consequently, very long dissociation times. Moreover,
the limited amounts of cathepsin L available precluded
Table 2. Equilibrium and rate constants at 25 °C for the binding of cystatin A variants with substitutions in the second binding loop to papain,
cathepsin L and cathepsin B. Methods and experimental conditions are described in Materials and Methods. Values determined in this work are
given as means ± SEM with the number of experiments in parentheses. Values for wild-type cystatin A, reported previously and shown for
comparison, as well as calculated values are given without errors. Numbers in square brackets indicate the ratio of the corresponding constant to
that for wild-type cystatin A.
Enzyme
Cystatin A
form
K
d
(
M
)
k
ass
(
M
)1
Æs
)1
)

k
diss
(s
)1
)
Papain Wild-type 1.8 · 10
)13 a
3.1 · 10
6a
5.5 · 10
)7a
[1] [1] [1]
L73G 5.8 · 10
)11 b
(1.58 ± 0.02) · 10
6
(9) (9.1 ± 0.9) · 10
)5
(3)
[320] [0.5] [170]
P74G 2.8 · 10
)13 b
(3.64 ± 0.06) · 10
6
(9) (10.2 ± 0.7) · 10
)7
(3)
[1.6] [1.2] [1.9]
Q76G 1.8 · 10
)13 b

(3.07 ± 0.02) · 10
6
(8) (5.6 ± 0.5) · 10
)7
(3)
[1] [1] [1]
N77G 0.95 · 10
)13 b
(3.58 ± 0.07) · 10
6
(9) (3.4 ± 0.3) · 10
)7
(3)
[0.5] [1.2] [0.6]
Cathepsin L Wild-type £ 1 · 10
)11 a
5.2 · 10
6a
£ 5 · 10
)5a
[1] [1] [1]
L73G (1.09 ± 0.08) · 10
)10
(10) (2.98 ± 0.04) · 10
6
(10) (3.4 ± 0.4) · 10
)4
(3)
[‡ 11] [0.6] [‡ 7]
1.1 · 10

)10 b
3.2 · 10
)4c
P74G £ 2.4 · 10
)11
(7) (4.6 ± 0.2) · 10
6
(10)
[0.9]
£ 1.1 · 10
)4c
Q76G £ 1.1 · 10
)11
(8) (6.3 ± 0.2) · 10
6
(9)
[1.2]
£ 6.9 · 10
)5c
N77G £ 1.1 · 10
)11
(8) (6.3 ± 0.2) · 10
6
(14)
[1.2]
£ 6.9 · 10
)5c
Cathepsin B Wild-type 9.1 · 10
)10 a
3.9 · 10

4a
3.5 · 10
)5a
[1] [1] [1]
L73G (3.6 ± 0.2) · 10
)6
(11) (8.5 ± 0.3) · 10
4
(8) 0.28 ± 0.05 (8)
[4000] [2.2] [8000]
3.3 · 10
)6b
0.31
c
P74G (9.7 ± 0.6) · 10
)9
(10) (5.5 ± 0.2) · 10
4
(11) 5.3 · 10
)4c
[11] [1.4] [15]
Q76G (1.4 ± 0.1) · 10
)9
(8) (3.95 ± 0.07) · 10
4
(8) 5.5 · 10
)5c
[1.5] [1] [1.6]
N77G (2.4 ± 0.2) · 10
)9

(9) (2.26 ± 0.08) · 10
4
(11) 5.4 · 10
)5c
[2.6] [0.6] [1.5]
a
From previous work [18,35].
b
Calculated from k
ass
and k
diss
.
c
Calculated from K
i
and k
ass
.
5654 A. Pavlova et al.(Eur. J. Biochem. 269) Ó FEBS 2002
determination of k
diss
by the method used for papain, in
which the displacement was monitored by chromatography.
Therefore, only upper limits of k
diss
for the binding of these
mutants to cathepsin L could be estimated, as for wild-type
cystatin A in previous work [35] (Table 2).
Values of k

diss
for the complexes of the four cystatin A
mutants with cathepsin B were calculated from K
i
and k
ass
determined in separate experiments (Table 2). In addition,
k
diss
for the L73G-cystatin A–cathepsin B complex was
obtained from the analyses of the association kinetics (see
above) as the intercept on the ordinate of the plot of k
obs,app
vs. inhibitor concentration and was in a good agreement
with the calculated k
diss
(Table 2). The L73G mutation
markedly affected the rate of dissociation of the complex
with cathepsin B, increasing k
diss
by  8000-fold. The P74G
mutation resulted in a smaller,  15-fold, increase in k
diss
,
whereas the other mutations altered k
diss
minimally.
Fluorescence emission difference spectra
The fluorescence difference spectra between complexes of
wild-type or L73G-cystatin A with papain and the free

proteins had minima at different wavelengths,  360 and
 368 nm, respectively (Fig. 2). Moreover, the spectrum for
the L73G mutant had an appreciably lower amplitude than
that for wild-type cystatin A, reflecting a smaller fluores-
cence change on interaction of the mutant than of the wild-
type inhibitor with papain. These fluorescence changes must
reflect different changes in the environment of one or more
Trp side chains in papain on formation of the two enzyme–
inhibitor complexes, as cystatin A does not contain Trp [1].
DISCUSSION
The X-ray structure of the complex between human C3S-
cystatin B and S-(carboxymethyl)papain reveals a number
of predominantly hydrophobic but also solvent-mediated
interactions between the second binding loop of the
inhibitor and papain [13]. In particular, Leu73 and His75
in this loop are seen to make four and seven intermolecular
contacts with the enzyme, respectively, that are < 4 A
˚
in
length. In agreement with this structural evidence, site-
directed mutagenesis has shown that the two residues
contribute substantial free energy to the interaction of
cystatin B with cysteine proteases [37]. The sequence of the
second binding loop of the related family 1 cystatin,
cystatin A, differs appreciably from that of cystatin B.
Most notably, cystatin A lacks the essential His75 and
instead has a Gly in this position [1]. This substitution would
be expected to lead to loss of a number of interactions with
the enzyme and therefore to considerably decrease the
contribution of the second binding loop of cystatin A to the

inhibition of target proteases. However, the flexibility of
the second binding loop of cystatin A demonstrated by
NMR [20] may allow other amino acids of the loop to make
additional favorable contacts with the protease, thereby
compensating for the absence of this residue. Alternatively,
this flexibility may instead destabilize the interactions of the
loop with the target protease, resulting in a lower binding
energy. To clarify the functional role of the second binding
loop of cystatin A, we have studied the contribution by the
residues within the most exposed segment of this loop to the
inhibition of cysteine proteases. The L73G, P74G, Q76G,
and N77G mutants of cystatin A were constructed by site-
directed mutagenesis, and their inhibition of papain,
cathepsin L and cathepsin B was characterized.
Our results show that the second binding loop of
cystatin A is essential for the formation of tight complexes
between the inhibitor and the cysteine proteases studied.
However, in contrast with cystatin B, this role is exerted
predominantly by only one residue, Leu73, which is highly
conserved in family I cystatins. The major role of Leu73 in
the interactions is in stabilizing the complexes once they are
formed. This conclusion is indicated by the L73G mutation
appreciably decreasing the affinity of cystatin A for the
proteases by increasing the rate constants for dissociation
of the complexes but negligibly affecting the association
rate constants. This contribution of Leu73 to the inhibitory
ability of cystatin A varies for different target proteases,
being most pronounced for the inhibition of cathepsin B.
The Leu73 side chain thus contributes about )15 and
)21 kJÆmol

)1
to the unitary free energy change [50,51]
accompanying the formation of the complex of cystatin A
with papain and cathepsin B, respectively. These changes
correspond to  18 and  34%, respectively, of the total
unitary free energy of binding of cystatin A to the two
enzymes [18]. The contribution of Leu73 of cystatin A to
binding of papain, which has an open active-site cleft, is
comparable to that of Leu73 in the second binding loop of
cystatin B and to that of the essential Trp106 residue in this
loop of the family 2 cystatin, cystatin C [37,52]. However,
the contribution of Leu73 of cystatin A to binding of
cathepsin B, in which the occluding loop partially blocks the
active site, is substantially higher than that of the corres-
ponding residue of cystatin C [52].
The results further show that one additional residue in
the second binding loop of cystatin A, Pro74, aids in
stabilizing the complex of the inhibitor with cathepsin B by
decreasing the dissociation rate constant. However, this
Fig. 2. Fluorescence emission difference spectra between complexes of
human wild-type cystatin A or the L73G cystatin A variant with papain
andthefreeproteins.Solid line, Wild-type cystatin A; dotted line,
L73G-cystatin A. Fluorescence emission spectra were measured as
describedinMaterialsandmethodswithpapainandcystatincon-
centrations of 1.0 and 1.2 l
M
, respectively. The difference spectra were
calculated from separately measured and corrected emission spectra
that were normalized to a fluorescence intensity of 1.0 for 1 l
M

papain
at the wavelength of the emission maximum [41].
Ó FEBS 2002 Second protease-binding loop of cystatin A (Eur. J. Biochem. 269) 5655
residue negligibly participates in the inhibition of papain
and most likely also of cathepsin L. The side chains of
Leu73 and Pro74 jointly contribute  45% of the total
unitary free energy of binding of cystatin A to cathepsin B,
demonstrating a major role of the second binding loop of
cystatin A in the inhibition of this enzyme. Pro74 may be
directly involved in the interaction with cathepsin B by
providing hydrophobic interactions with the protease.
Alternatively, the role of Pro74 might be to maintain an
appropriate orientation of Leu73 for its specific interaction
with cathepsin B. In contrast with Leu73 and Pro74, the
two other residues of the second binding loop of cystatin A
studied, Gln76 and Asn77, are of minimal importance for
the affinity of the inhibitor for the cysteine proteases and
therefore presumably do not interact directly with the
enzymes. The remaining residue of the loop, Gly75, may
conceivably provide backbone interactions with a target
protease, but such a contribution cannot be investigated by
the approach taken in this work.
The conclusions drawn above from the results of this
work are in general agreement with modeling of the
cystatin A–papain complex. Although no X-ray structure of
cystatin A is available, the NMR structure of the inhibitor is
similar to the X-ray structure of human C3S-cystatin B in
complex with S-(carboxymethyl)papain [13,20,53]. More-
over, human cystatins A and B are homologous, having
identical amino acids in 52 out of 98 positions [1].

Cystatin B in the complex with papain can therefore be
used as an appropriate template for modeling of the
corresponding complex between cystatin A and this prote-
ase with reasonable accuracy [48,54]. The model generated
for the complex indicates that only two residues within the
second binding loop of cystatin A, Leu73 and Pro74, are
involved in interactions with papain (Fig. 1B). Leu73 makes
six hydrophobic interactions of 3.4–4.0 A
˚
with Trp177 of
papain in the model, in agreement with the demonstration
that Leu73 is essential for strong inhibition of cysteine
proteases by cystatin A. The involvement of Trp177 of
papain in the interaction with Leu73 is supported by the
changes caused by the L73G mutation of the fluorescence
difference spectrum characterizing the cystatin A–papain
interaction. These changes indicate that one or more
tryptophans of papain, probably primarily Trp177 on the
surface of the active-site cleft, are exposed to a less
hydrophobic environment in the complex with L73G-
cystatin A [55]. In the model, the side chain of Pro74 of
cystatin A also makes two hydrophobic contacts of  4A
˚
with Gln142 and Leu143 of papain (Fig. 1B). This obser-
vation is in apparent contrast with the demonstration that
Pro74 is unimportant for papain binding and participates
only in the inhibition of cathepsin B. This discrepancy with
the experimental data thus indicates that the model is
somewhat uncertain with regard to the putative interactions
involving Pro74. However, in agreement with the experi-

mental results, the model accurately predicts that neither
Gln76 nor Asn77 of the second binding loop of cystatin A
interact with papain in the complex. Moreover, although
the role of Gly75 was not investigated experimentally, the
model suggests that Gly is not the only residue in this
position compatible with high-affinity interaction with
papain. The phi and psi angles of Gly75 deduced from the
model are thus within the Ramachandran plot region
sterically allowed for other types of residues. Most residues
other than Gly could also be modeled into this position
without observably interfering sterically with the interac-
tion.
In conclusion, this study shows the importance of the
second binding loop of cystatin A for the binding of
cysteine proteases, in particular cathepsin B. The role of this
loop is comparable to that of the corresponding loops of
cystatin B and family 2 cystatins, to stabilize the cystatin–
protease complex by decreasing the dissociation rate. How-
ever, in contrast with the latter inhibitors, this role is exerted
almost exclusively by one residue of the loop, Leu73,
although Pro74 is also of some importance for cathepsin B
binding.
ACKNOWLEDGEMENTS
We are grateful to Dr A
˚
ke Engstro
¨
m (Department of Medical
Biochemistry and Microbiology, Uppsala University) for molecular
mass determinations and amino-acid sequencing. This project was

supported by the Swedish Medical Research Council (Project No. 4212).
REFERENCES
1. Barrett, A.J., Rawlings, N.D., Davies, M.E., Machleidt, W.,
Salvesen, G. & Turk, V. (1986) Cysteine proteinase inhibitors of
the cystatin superfamily. In Proteinase Inhibitors (Barrett, A.J. &
Salvesen, G., eds), pp. 515–569. Elsevier, Amsterdam.
2. Turk, V. & Bode, W. (1991) The cystatins: protein inhibitors of
cysteine proteinases. FEBS Lett. 285, 213–219.
3. Abrahamson, M. (1994) Cystatins. Methods Enzymol. 244,685–
700.
4. Turk,B.,Turk,V.&Turk,D.(1997)Structuralandfunctional
aspects of papain-like cysteine proteinases and their protein
inhibitors. Biol. Chem. 378, 141–150.
5. Henskens, Y.M.C., Veerman, E.C.I. & Nieuw Amerongen, A.V.
(1996) Cystatins in health and disease. Biol. Chem. Hoppe-Seyler
377, 71–86.
6. Blankenvoorde, M.F., Van’t Hof, W., Walgreen-Weterings, E.,
van Steenbergen, T.J., Brand, H.S., Veerman, E.C. & Nieuw
Amerongen, A.V. (1998) Cystatin and cystatin-derived peptides
have antibacterial activity against the pathogen Porphyromonas
gingivalis. Biol. Chem. 379, 1371–1375.
7. Collins, A.R. & Grubb, A. (1998) Cystatin D, a natural salivary
cysteine protease inhibitor, inhibits coronavirus replication at its
physiologic concentration. Oral Microbiol. Immunol. 13, 59–61.
8. Kos, J. & Lah, T.T. (1998) Cysteine proteinases and their
endogenous inhibitors: target proteins for prognosis, diagnosis
and therapy in cancer. Oncol. Rep. 5, 1349–1361.
9. Das, L., Datta, N., Bandyopadhyay, S. & Das, P.K. (2001) Suc-
cessful therapy of lethal murine visceral leishmaniasis with cystatin
involves up-regulation of nitric oxide and a favorable T cell

response. J. Immunol. 166, 4020–4028.
10. Ruzindana-Umunyana, A. & Weber, J.M. (2001) Interactions of
human lacrimal and salivary cystatins with adenovirus endo-
peptidase. Antiviral Res. 51, 203–214.
11. Turk,V.,Turk,B.&Turk,D.(2001)Lysosomalcysteinepro-
teases: facts and opportunities. EMBO J. 20, 4629–4633.
12. Bode, W., Engh, R., Musil, D., Thiele, U., Huber, R., Karshikov,
A.,Brzin,J.,Kos,J.&Turk,V.(1988)The2.0A
˚
X-ray crystal
structure of chicken egg white cystatin and its possible mode of
interaction with cysteine proteinases. EMBO J. 7, 2593–2599.
13.Stubbs,M.T.,Laber,B.,Bode,W.,Huber,R.,Jerala,R.,
Lenarcic, B. & Turk, V. (1990) The refined 2.4 A
˚
X-ray crystal
structure of recombinant human stefin B in complex with the
cysteine proteinase papain: a novel type of proteinase inhibitor
interaction. EMBO J. 9, 1939–1947.
5656 A. Pavlova et al.(Eur. J. Biochem. 269) Ó FEBS 2002
14. Bjo
¨
rk, I., Alriksson, E. & Ylinenja
¨
rvi, K. (1989) Kinetics of
binding of chicken cystatin to papain. Biochemistry 28, 1568–1573.
15. Bjo
¨
rk, I. & Ylinenja
¨

rvi, K. (1990) Interaction between chicken
cystatin and the cysteine proteinases actinidin, chymopapain A,
and ficin. Biochemistry 29, 1770–1776.
16. Lindahl, P., Abrahamson, M. & Bjo
¨
rk, I. (1992) Interaction of
recombinant human cystatin C with the cysteine proteinases
papain and actinidin. Biochem. J. 281, 49–55.
17. Turk, B., Colic, A., Stoka, V. & Turk, V. (1994) Kinetics of
inhibition of bovine cathepsin S by bovine stefin B. FEBS Lett.
339, 155–159.
18. Pol,E.,Olsson,S.L.,Estrada,S.,Prasthofer,T.W.&Bjo
¨
rk, I.
(1995) Characterization by spectroscopic, kinetic and equilibrium
methods of the interaction between recombinant human cystatin
A (stefin A) and cysteine proteinases. Biochem. J. 311, 275–282.
19. Dieckmann,T.,Mitschang,L.,Hofmann,M.,Kos,J.,Turk,V.,
Auerswald, E.A., Jaenicke, R. & Oschkinat, H. (1993) The
structures of native phosphorylated chicken cystatin and of a
recombinant unphosphorylated variant in solution. J. Mol. Biol.
234, 1048–1059.
20. Martin, J.R., Craven, C.J., Jerala, R., Kroon-Zitko, L., Zerovnik,
E., Turk, V. & Waltho, J.P. (1995) The three-dimensional solution
structure of human stefin A. J. Mol. Biol. 246, 331–343.
21. Ekiel, I., Abrahamson, M., Fulton, D.B., Lindahl, P., Storer,
A.C., Levadoux, W., Lafrance, M., Labelle, S., Pomerleau, Y.,
Groleau, D., LeSauteur, L. & Gehring, K. (1997) NMR structural
studies of human cystatin C dimers and monomers. J. Mol. Biol.
271, 266–277.

22. Rawlings, N.D. & Barrett, A.J. (1994) Families of cysteine pep-
tidases. Methods Enzymol. 244, 461–486.
23. Turk, D., Guncar, G., Podobnik, M. & Turk, B. (1998) Revised
definition of substrate binding sites of papain-like cysteine pro-
teases. Biol. Chem. 379, 137–147.
24. Turk, B., Turk, D. & Turk, V. (2000) Lysosomal cysteine proteases:
more than scavengers. Biochim. Biophys. Acta 1477, 98–111.
25. Musil, D., Zucic, D., Turk, D., Engh, R.A., Mayr, I., Huber, R.,
Popovic,T.,Turk,V.,Towatari,T.,Katunuma,N.&Bode,W.
(1991) The refined 2.15 A
˚
X-ray crystal structure of human liver
cathepsin B: the structural basis for its specificity. EMBO J. 10,
2321–2330.
26. Nycander,M.,Estrada,S.,Mort,J.S.,Abrahamson,M.&Bjo
¨
rk,
I. (1998) Two-step mechanism of inhibition of cathepsin B by
cystatin C due to displacement of the proteinase occluding loop.
FEBS Lett. 422, 61–64.
27. Pavlova,A.,Krupa,J.C.,Mort,J.S.,Abrahamson,M.&Bjo
¨
rk, I.
(2000) Cystatin inhibition of cathepsin B requires dislocation of
the proteinase occluding loop. Demonstration by release of loop
anchoring through mutation of His110. FEBS Lett. 487, 156–160.
28. Bjo
¨
rk,I.,Pol,E.,Raub-Segall,E.,Abrahamson,M.,Rowan,
A.D. & Mort, J.S. (1994) Differential changes in the association

and dissociation rate constants for binding of cystatins to target
proteinases occurring on N-terminal truncation of the inhibitors
indicate that the interaction mechanism varies with different
enzymes. Biochem. J. 299, 219–225.
29. Machleidt, W., Thiele, U., Laber, B., Assfalg-Machleidt, I., Esterl,
A., Wiegand, G., Kos, J., Turk, V. & Bode, W. (1989) Mechanism
of inhibition of papain by chicken egg white cystatin. Inhibition
constants of N-terminally truncated forms and cyanogen bromide
fragments of the inhibitor. FEBS Lett. 243, 234–238.
30. Machleidt, W., Thiele, U., Assfalg-Machleidt, I., Forger, D. &
Auerswald, E.A. (1991) Molecular mechanism of inhibition of
cysteine proteinases by their protein inhibitors: kinetic studies with
natural and recombinant variants of cystatins and stefins. Biomed.
Biochim. Acta 50, 613–620.
31. Abrahamson, M., Mason, R.W., Hansson, H., Buttle, D.J.,
Grubb, A. & Ohlsson, K. (1991) Human cystatin C. Role of
the N-terminal segment in the inhibition of human cysteine
proteinases and in its inactivation by leucocyte elastase. Biochem.
J. 273, 621–626.
32. Lindahl, P., Nycander, M., Ylinenja
¨
rvi,K.,Pol,E.&Bjo
¨
rk, I.
(1992) Characterization by rapid-kinetic and equilibrium methods
of the interaction between N-terminally truncated forms of
chicken cystatin and the cysteine proteinases papain and actinidin.
Biochem. J. 286, 165–171.
33. Hall, A., Ha
˚

kansson, K., Mason, R.W., Grubb, A. & Abra-
hamson, M. (1995) Structural basis for the biological specificity of
cystatin C. Identification of leucine 9 in the N-terminal binding
region as a selectivity-conferring residue in the inhibition of
mammalian cysteine peptidases. J. Biol. Chem. 270, 5115–5121.
34. Auerswald, E.A., Na
¨
gler, D.K., Assfalg-Machleidt, I., Stubbs,
M.T., Machleidt, W. & Fritz, H. (1995) Hairpin loop mutations of
chicken cystatin have different effects on the inhibition of cathe-
psin B, cathepsin L and papain. FEBS Lett. 361, 179–184.
35. Estrada, S., Pavlova, A. & Bjo
¨
rk, I. (1999) The contribution of
N-terminal region residues of cystatin A (stefin A) to the affinity
and kinetics of inhibition of papain, cathepsin B, and cathepsin
L. Biochemistry 38, 7339–7345.
36. Pol, E. & Bjo
¨
rk, I. (2001) Role of the single cysteine residue, Cys 3,
of human and bovine cystatin B (stefin B) in the inhibition of
cysteine proteinases. Protein Sci. 10, 1729–1738.
37. Pol, E. & Bjo
¨
rk, I. (1999) Importance of the second binding loop
and the C-terminal end of cystatin B (stefin B) for inhibition of
cysteine proteinases. Biochemistry 38, 10519–10526.
38. Estrada, S., Nycander, M., Hill, N.J., Craven, C.J., Waltho, J.P. &
Bjo
¨

rk, I. (1998) The role of Gly-4 of human cystatin A (stefin A) in
the binding of target proteinases. Characterization by kinetic and
equilibrium methods of the interactions of cystatin A Gly-4
mutants with papain, cathepsin B, and cathepsin L. Biochemistry
37, 7551–7560.
39. Higuchi, R., Krummel, B. & Saiki, R.K. (1988) A general method
of in vitro preparation and specific mutagenesis of DNA frag-
ments: study of protein and DNA interactions. Nucleic Acids Res.
16, 7351–7367.
40. Cohen, S.N., Chang, A.C.Y. & Hsu, L. (1972) Nonchromosomal
antibiotic resistance in bacteria: genetic transformation of
Escherichia coli by R factor DNA. Proc. Natl. Acad. Sci. USA 69,
2110–2114.
41. Lindahl, P., Alriksson, E., Jo
¨
rnvall, H. & Bjo
¨
rk, I. (1988) Inter-
action of the cysteine proteinase inhibitor chicken cystatin with
papain. Biochemistry 27, 5074–5082.
42. Laber, B., Krieglstein, K., Henschen, A., Kos, J., Turk, V., Huber,
R. & Bode, W. (1989) The cysteine proteinase inhibitor chicken
cystatin is a phosphoprotein. FEBS Lett. 248, 162–168.
43. Ellman, G.L. (1959) Tissue sulfhydryl groups. Arch. Biochem.
Biophys. 82, 70–77.
44. Barrett, A.J. & Kirschke, H. (1981) Cathepsin B, cathepsin H, and
cathepsin L. Methods Enzymol. 80, 535–561.
45. Mason, R.W. (1986) Species variants of cathepsin L and their
immunological identification. Biochem. J. 240, 285–288.
46. Dalet-Fumeron, V., Guinec, N. & Pagano, M. (1991) High-

performance liquid chromatographic method for the simulta-
neous purification of cathepsins B, H and L from human liver.
J. Chromatogr. 568, 55–68.
47. Hall, A., Abrahamson, M., Grubb, A., Trojnar, J., Kania, P.,
Kasprzykowska, R. & Kasprzykowski, F. (1992) Cystatin C based
peptidyl diazomethanes as cysteine proteinase inhibitors: influence
of the peptidyl chain length. J. Enzyme Inhibition 6, 113–123.
48. Guex, N. & Peitsch, M.C. (1997) Swiss-Model and Swiss-Pdb
Viewer: an environment for comparative protein modeling.
Electrophoresis 18, 2714–2723.
49. Scha
¨
gger, H. & von Jagow, G. (1987) Tricine-sodium dodecyl
sulfate-polyacrylamide gel electrophoresis for the separation
of proteins in the range from 1 to 100 kDa. Anal. Biochem. 166,
368–379.
Ó FEBS 2002 Second protease-binding loop of cystatin A (Eur. J. Biochem. 269) 5657
50. Gurney, R.W. (1953) Ionic Processes in Solution, pp. 90–105.
McGraw-Hill, New York.
51. Karush, F. (1962) Immunologic specificity and molecular struc-
ture. Adv. Immunol. 2, 1–40.
52. Bjo
¨
rk, I., Brieditis, I., Raub-Segall, E., Pol, E., Ha
˚
kansson, K. &
Abrahamson, M. (1996) The importance of the second hairpin
loop of cystatin C for proteinase binding. Characterization of the
interaction of Trp-106 variants of the inhibitor with cysteine
proteinases. Biochemistry 35, 10720–10726.

53. Craven, C.J., Baxter, N.J., Murray, E.H., Hill, N.J., Martin, J.R.,
Ylinenja
¨
rvi, K., Bjo
¨
rk, I., Waltho, J.P. & Murray, I.A. (2000)
Wild-type and Met-65 fi Leu variants of human cystatin A are
functionally and structurally identical. Biochemistry 39, 15783–
15790.
54. Guex, N., Diemand, A. & Peitsch, M.C. (1999) Protein modelling
for all. Trends Biochem. Sci. 24, 364–367.
55. Lakowicz, J.R. (1983) Principles of Fluorescence Spectroscopy,pp.
187–214. Plenum Press, New York.
5658 A. Pavlova et al.(Eur. J. Biochem. 269) Ó FEBS 2002