Báo cáo Y học: Loss-of-function variants of the human melanocortin-1 receptor gene in melanoma cells define structural determinants of receptor function doc

Loss-of-function variants of the human melanocortin-1 receptor
gene in melanoma cells define structural determinants
of receptor function
Jesu
´
sSa
´
nchez Ma
´
s
1
, Concepcio
´
n Olivares Sa
´
nchez
1
, Ghanem Ghanem
2
, John Haycock
3
,
Jose
´
Antonio Lozano Teruel
1
, Jose
´
Carlos Garcı
´
a-Borro

´
n
1
and Celia Jime
´
nez-Cervantes
1
1
Department of Biochemistry and Molecular Biology, School of Medicine, University of Murcia, Spain;
2
LOCE,
Free University of Brussels, Brussels, Belgium;
3
Department of Engineering Materials, University of Sheffield, Sheffield, UK
The a-melanocyte-stimulating hormone (aMSH) receptor
(MC1R) is a major determinant of mammalian skin and hair
pigmentation. Binding of aMSHtoMC1Rinhumanmel-
anocytes stimulates cell proliferation and synthesis of pho-
toprotective eumelanin pigments. Certain MC1R alleles
have been associated with increased risk of melanoma. This
can be theoretically considered on two grounds. First, gain-
of-function mutations may stimulate proliferation, thus
promoting dysplastic lesions. Second, and opposite, loss-of-
function mutations may decrease eumelanin contents, and
impair protection against the carcinogenic effects of UV
light, thus predisposing to skin cancers. To test these possi-
bilities, we sequenced the MC1R gene from seven human
melanoma cell (HMC) lines and three giant congenital nevus
cell (GCNC) cultures. Four HMC lines and two GCNC
cultures contained MC1R allelic variants. These were the

known loss-of-function Arg142His and Arg151Cys alleles
and a new variant, Leu93Arg. Moreover, impaired response
to a superpotent aMSH analog was demonstrated for the
cell line carrying the Leu93Arg allele and for a HMC line
homozygous for wild-type MC1R. Functional analysis in
heterologous cells stably or transiently expressing this vari-
ant demonstrated that Leu93Arg is a loss-of-function
mutation abolishing agonist binding. These results, together
with site-directed mutagenesis of the vicinal Glu94, demon-
strate that the MC1R second transmembrane fragment is
critical for agonist binding and maintenance of a resting
conformation, whereas the second intracellular loop is
essential for coupling to the cAMP system. Therefore, loss-
of-function, but not activating MC1R mutations are com-
mon in HMC. Their study provides important clues to
understand MC1R structure-function relationships.
Keywords: melanocortin 1 receptor; melanoma; loss-of-
function mutations; functional coupling; structure-function
relationships.
G protein-coupled receptors (GPCRs) constitute the largest
family of cell surface receptors involved in signal transduc-
tion, with over 1% of the human genome encoding for more
than 1000 proteins of this type [1]. The structural hallmarks
of GPCRs are an heptahelical transmembrane structure,
with an N-terminal extension of variable length facing the
extracellular side of the cell membrane, and an intracellular
C-terminus, which is often post-translationally modified by
acylation of conserved Cys residues [2]. Recent evidence
supports a role of GPCRs in the control of normal and
aberrant cell growth. Indeed, many potent mitogens stimu-

late cell proliferation upon binding to their cognate GPCRs
[3–5], and the mas oncogene belongs to this superfamily [6].
Moreover, activating mutations of members of the GPCR
family cause several dysplatic syndromes such as hyper-
functioning thyroid adenoma [7], familial male precocious
puberty [8], and Jansen-type metaphyseal chondrodysplasia
[9].
The melanocortin 1 receptor (MC1R) is a GPCR
involved in the regulation of key aspects of mammalian
skin biology, which belongs to a subfamily of the GPCRs
comprising five members designated MC1 to MC5 [10]. The
genes encoding for the mouse and human MC1R were
cloned in 1992 [11]. The human MC1R gene maps to
chromosome 16q2 and contains an open reading frame of
954 base pairs corresponding to a 317 amino acids protein.
It is highly polymorphic [12], and specific variants have been
found associated with red hair and fair skin [13–15].
The preferential natural agonists of MC1R are aMSH
and adrenocorticotropic hormone. Both proopiomelano-
cortin-derived peptides bind to the MC1R with the same
Correspondence to C. Jime
´
nez-Cervantes, Department of Biochemistry
and Molecular Biology, School of Medicine, University of Murcia,
Apto 4021. Campus de Espinardo, 30100 Murcia, Spain.
Fax: + 34 68 830950, Tel.: + 34 68 364676,
E-mail:
Abbreviations: FSK, forskolin; GPCR, G protein coupled receptor;
GCNC, giant congenital nevus cells; HMC, human melanoma cells;
MC1R, human melanocortin 1 receptor; mc1r, mouse melanocortin 1

receptor; aMSH, a-melanocyte stimulating hormone; NDP-MSH,
[Nle4,D-Phe7]-a-melanocyte stimulating hormone; TM,
transmembrane.
Note: The research group web site is available at />bbmbi/melanocitos.htm
Note: Nucleotide sequence data are available at the DDBJ/EMBL/
GenBank databases under the accession numbers AF326275 (con-
sensus wild-type MC1R sequence), and AF529884 (Leu93Arg MC1R
variant). The SWISS-PROT entry for human MC1R is Q01726.
(Received 20 August 2002, revised 14 October 2002,
accepted 23 October 2002)
Eur. J. Biochem. 269, 6133–6141 (2002) Ó FEBS 2002 doi:10.1046/j.1432-1033.2002.03329.x
affinity and, upon binding to the receptor, trigger the
cAMP cascade, thus activating a variety of intracellular
signaling pathways [16]. As a result of MC1R activation,
the activity of the rate-limiting enzyme in melanin synthe-
sis, tyrosinase, is increased and skin pigmentation is
promoted. Melanin pigments are complex heteropolymers,
which can be classified into two main groups: the brown to
black eumelanins, and the reddish to yellow, sulfur-
containing phaeomelanins [17]. Although both types of
melanins are found in different relative proportions in all
skin types, the phaeomelanin/eumelanin ratio is higher in
individuals with red hair and fair skin [18]. Activation of
MC1R by its agonists promotes the switch from phaeo- to
eumelanogenesis, and increases the eumelanin/phaeomela-
nin ratio [10]. Eumelanins are photoprotective pigments,
and UV irradiation is considered the main ethiologic factor
for skin cancers. Thus, it can be hypothesized that an
impairment of the normal function of the aMSH/MC1R
system as a result of loss-of-function mutations in the

MC1R gene, might lead to an increased risk of melanoma.
In keeping with this view, an association of several MC1R
allelic variants with increased melanoma and nonmel-
anoma skin cancer risk has been demonstrated [19–21].
These variants were subsequently shown to be loss-of-
function mutations [22].
In addition to its effect on melanocyte differentiation, it is
well established that aMSH stimulates normal melanocyte
proliferation [23]. Because of this mitogenic activity, it could
also be thought that hyperactivity of the aMSH/MC1R
system might promote abnormal melanocyte growth, thus
contributing to premalignant or malignant phenotypes. In
agreement with this, growth of normal melanocytes and
nevus cells in culture, but not of melanoma cells, is
dependent on aMSH and/or other stimulators of the cAMP
cascade [24].
Most studies on the possible involvement of MC1R
gene variants in melanoma reported thus far are case-
control studies where MC1R was sequenced from
peripheral blood of melanoma patients or healthy indi-
viduals. These studies have established an increased risk
of melanoma associated with MC1R loss-of-function
variants leading to light skin phototypes, and hence to
increased UV sensitivity. However, they might have failed
to detect somatic gain-of-function mutations of the
MC1R gene within melanocytes, leading to increased,
aMSH-independent proliferation. In order to establish
whether or not activating mutations are present in
malignant or premalignant melanocytes, we have
sequenced the entire open reading frame of the MC1R

gene from cultured HMC and GCNC. The functional
properties of the allelic variants found have been
analyzed. Moreover, we have compared the aMSH-
triggered responses in heterologous cells expressing the
receptor variants under study, and the ones of malignant
melanocytes of defined MC1R genotype. Our results
show that loss-of-function, but not gain-of-function,
mutations of MC1R are indeed frequent in HMC lines,
and that impairment of signaling through the cAMP
cascade occurs in these cells even in the absence of
mutations in the coding region of the gene. Finally, our
study of the natural MC1R variants highlights several
aspects of the structure–function relationships in the
MC1R protein, such as the critical importance of the
TM2 fragment and the second cytosolic loop, and can
target the design of site-directed mutagenesis studies.
MATERIALS AND METHODS
Cell culture
Seven HMC lines were used. HBL and LND1 cell lines were
established at the LOCE, Brussels, Belgium. DOR, IC8 and
T1C3 cells were a gift from J. F. Dore
´
, INSERM, Lyon,
France. The IC8 and T1C3 cells are clones of the same
melanoma line and were isolated based on their different
metastatic potential. A375-SM cells were a gift from I. J.
Fidler (University of Texas M. D., Houston, TX, USA),
and C8161 a gift from Prof Meyskens (University of
California, Irvine, CA, USA). All HMC lines were cultured
as previously described [25] in HAM-F10 medium supple-

mented with 5% fetal bovine serum, 5% newborn calf
serum, 2 m
M
glutamine, 100 UÆmL
)1
penicillin,
0.1 mgÆmL
)1
streptomycin sulfate and 0.1 mgÆmL
)1
kana-
mycin sulfate (all from Gibco, Paisley, UK). Three primary
cultures of GCNC were also analyzed. Isolation and culture
of GCNC was performed as described [26]. Briefly, the
tissue was incubated overnight in HAM-F10 medium
containing 0.6 UÆmL
)1
dispase and 0.05 UÆmL
)1
collage-
nase, supplemented with 200 UÆmL
)1
penicillin G,
0.2 mgÆmL
)1
streptomycin sulfate, 0.2 mgÆmL
)1
kanamycin
sulfate and 25 lgÆmL
)1

gentamycin. The detached cells were
washed, seeded in culture flasks at the density of
10
5
cellsÆmL
)1
andincubatedfor48hwith0.1mgÆmL
)1
geneticin in the culture medium described, supplemented
with 2% Ultroser-G, 16 n
M
phorbol 12-myristate 13-
acetate, and 0.1 m
M
isobutyl methylxanthine. GCNC were
cultured for a maximum of 15 passages.
DNA extraction, amplification of the
MC1R
gene
and sequencing
Genomic DNA was extracted from cultured cells with the
Wizard kit (Promega, Madison, WI). The complete MC1R
coding sequence was amplified by PCR, with the forward
primer CCT
AAGCTTACTCCTTCCTGCTTCCTGG
ACA (called universal MC1R forward primer), and the
reverse primer CTG
GAATTCACACTTAAAGCGCG
TGCACCGC. These primers match nucleotides 435–456
and 1418–1439, respectively, according to the sequence

reported in [11], and yield a 1023-bp fragment that can be
cloned by means of added HindIII and EcoRI restriction
sites (underlined). Thirty PCR rounds (denaturation for
1 min at 95 °C, annealing for 2 min at 68 °C and extension
for 3 min at 72 °C, followed by a final 10 min extension at
72 °C) were performed using 1 lg of genomic DNA, 0.5 lg
of each primer, 200 l
M
each dNTP and 2.5 U of the
proofreading Pfu polymerase. The PCR products were
purified by agarose gel electrophoresis and completely
sequenced in both strands using internal primers, at the
DNA sequencing facility of the ÔCentro de Investigaciones
Biolo
´
gicasÕ, Madrid, Spain. When necessary for functional
studies, the amplification product was cloned in the
expression vector pcDNA3 (Invitrogen, Carlsbad, CA,
USA), using the added restriction sites, following standard
procedures [27]. The identity of the clones was ascertained
by complete resequencing of the cloned inserts.
6134 J. Sa
´
nchez Ma
´
s et al.(Eur. J. Biochem. 269) Ó FEBS 2002
Transient expression of MC1R
HEK 293T cells were grown in six-well plates with RPMI
1640, 10% fetal bovine serum, 100 UÆmL
)1

penicillin and
0.1 mgÆmL
)1
streptomycin. Transfection was carried out
with the Superfect reagent (Qiagen, Paisley, UK), as per
instructions, with 1.5 lg plasmid DNA per well. Three
hours after adding the transfection mix, the medium was
removed. Cells were gently washed with 500 lLNaCl/P
i
and 1 mL of fresh medium was added. After 24 h, cells were
completely serum-deprived for an additional 24 h before
binding or coupling assays.
Radioligand binding assay
Transfected cells were incubated (1 h, 37 °C) with increas-
ing concentrations of [Nle4,
D
-Phe7]-aMSH (NDP-MSH,
Sigma, Saint Louis, MO, USA), ranging from 10
)12
to
10
)6
M
and a fixed amount of
125
I-labelled-NDP-MSH
(Amersham Pharmacia Biotech, Little Chalfont, Bucking-
hamshire, UK), corresponding to 10
)10
M

and 0.1 lCi per
well, in a final volume of 500 lL RPMI. Cells were then
washed twice with RPMI for 5 min at room temperature,
and trypsinized. The cell suspension was pipetted into
plastic tubes and the associated radioactivity was measured.
Non-specific binding was estimated from the radioactivity
bound in the presence of 10
)6
M
NDP-MSH or to cells
transfected with empty vector and incubated with
125
I-
labelled-NDP-MSH alone, with similar results.
Determination of agonist-induced cAMP increases
Cells were serum-deprived for 24 h and then incubated
with 10
-13
)10
-7
M
NDP-MSH, for 20 min. The medium
was aspirated, cells quickly washed with 1 mL ice-cold
NaCl/P
i
,lysedwith350lLpreheated0.1
M
HCl (70 °C),
and carefully scrapped. The resulting mix was freeze-dried
for 90 min, washed with 100 lLH

2
O, and freeze-dried for
another 20 min. Dried samples were dissolved in suitable
volumes of 50 m
M
Tris, 4 m
M
EDTA, pH 7.5, from 65 to
300 lL, depending on the expected cAMP content. cAMP
was measured by radioimmunoassay (Amersham Phar-
macia Biotech), as per instructions. Parallel dishes for
protein determination were included. Cells were dissolved
in 10 m
M
phosphate buffer pH 7, 1% Igepal CA-640,
containing 0.1 m
M
EDTA, and 0.1 m
M
phenyl-
methanesulfonyl fluoride. The protein concentration in
these lysates was determined by the bicinchoninic acid
method.
Construction and cloning of a MC1R tagged-sequence
The wild-type and Leu93Arg variant sequences of MC1R
were tagged by adding a (HA)
2
His
6
tag to the C-terminus

of the protein. This tag corresponds to the sequence
RFYPYDVPDYAGYPYDVPDYAHHHHHH, placed
immediately after the C-terminal W317 residue of
MC1R. It contains two consecutive influenza virus
hemagglutinin epitopes (HA) and a terminal hexahistidine
sequence (His6). In order to prepare the constructs, we
amplified the tag sequence from the pREP1-cdc2Ha6His
vector (a kind gift from Prof Jose
´
Cansado, Department
of Genetics and Microbiology, University of Murcia,
Spain) by using the primers CGC
GAATTCTACCCA
TACGAT (forward) and AGC
TCTAGATTAGTGGT
GATG (reverse), containing EcoRI and XbaIsites
(underlined). We also amplified the complete coding
sequence of the wild-type and Leu93Arg variant of
MC1R with the universal MC1R forward primer and
the GCG
TCTAGATCAGAATTCCCAGGAGCACGT
CAG reverse primer. This primer contains an EcoRI
restriction site before a stop codon (shown in bold) and a
XbaI site immediately after it. PCR amplification reactions
were performed with 30 ng of template DNA, 0.5 lgof
each corresponding primer, 200 l
M
each dNTP and 2.5 U
of the proofreading Pfu polymerase. Thirty rounds of
amplification were carried out (denaturation 1 min at

95 °C, annealing 2 min at 48 °C and extension for 3 min
at 72 °C). The MC1R amplicons were cloned into
pcDNA3 by means of the HindIII and XbaIrestriction
sites. The tag sequence was then cloned into the MC1R-
pcDNA3 constructs, with the added EcoRI and XbaI
sites. The identity of the products was verified by complete
sequencing.
Construction of the Glu94Lys MC1R variant
The Glu94Lys variant was generated in two PCR steps.
First, we used the universal MC1R forward primer and the
reverse primer GACGGCCGTCTTCAGCACGTTGCT,
which introduces the desired amino acid change (variant
base shown in bold), to yield a 328-bp fragment. This
ampliconwasthenusedasaforwardprimerwiththerev-
erseCTG
GAATTCACACTTAAAGCGCGTGCACCGC
(stop codon in bold, EcoRI site underlined). The resulting
cDNA was cloned into pcDNA3. The sequence of this
artificial variant was ascertained by double strand DNA
sequencing.
Western blot and related procedures
Cells were solubilized in 50 m
M
Tris/HCl, pH 8.8, 1 m
M
EDTA, 1% Igepal CA-630 and 10 m
M
iodoacetamide,
and then centrifuged at 105 000 g,for30mininatable-
top Beckman TL-100 ultracentrifuge. Electrophoresis was

performed in 10% acrylamide gels, under reducing
conditions. For immunochemical detection of the tagged
MC1R constructs in extracts from transfected cells, 10 lg
of protein from each sample were mixed in a 2 : 1 ratio
with sample buffer (0.18
M
Tris/HCl, pH 6.8, 15%
glycerol, 0.075% bromophenol blue, 9% SDS, and 3
M
2 mercaptoethanol). For deglycosylation studies, the
extracts were heated at 95 °C for 5 min prior to incuba-
tion at 37 °C for 4 h in the presence of 5 U of
N-glycosidase F (from Roche, Mannheim, Germany) in
a50-m
M
phosphate buffer, pH 7.0, containing 10 m
M
EDTA and 0.1% SDS. Control samples were treated
under identical conditions, except for the omission of the
glycosidase. These samples were processed as previously
described for electrophoresis. Gels were transferred to
poly(vinylidene difluoride) (PVDF) membranes, blocked
with 5% nonfat dry milk and incubated overnight at 4 °C
with a monoclonal anti-HA Ig (Sigma) as per instructions.
Staining of immunoreactive bands was performed with a
chemiluminescent substrate (Amersham Pharmacia Bio-
tech), after incubation with a peroxidase-labeled secondary
Ó FEBS 2002 Loss-of-function MC1R variants in human melanoma (Eur. J. Biochem. 269) 6135
antibody. Comparable loading and transfer were ascer-
tained by cutting the lower portion of the membrane

before blocking and staining for total protein with Amido
Black.
RESULTS AND DISCUSSION
Seven HMC lines and three GCNC cultures were selected
for genotyping and functional studies, based mostly on
previous observations of high MC1R gene expression at the
mRNA level [28]. Sequencing of the complete coding region
of MC1R after amplification of genomic DNA with suitable
primers [29,30] showed that four HMC, and two GCNC
cultures harbored MC1R variants (Table 1). The variants
found were the well-known Arg151Cys and Arg142His
alleles and a new variant not reported so far, to the best of
our knowledge, the Leu93Arg allele. That this variant was
indeed present in the sample and was not the result of a
PCR artifact was ascertained by repeated amplification and
sequencing reactions, and by the observation that the same
allele was found in the IC8 and T1C3 cell lines, which both
come from the same parental cell line and correspond to two
clones isolated on the basis of their different metastatic
potential (J. F. Dore
´
, personal communication). The posi-
tions within the MC1R molecule of the substitutions found
in our study are shown in Fig. 1, where several other
functionally relevant residues are also highlighted.
The Arg151Cys and Arg142His alleles are two well-
documented loss-of-function MC1R variants [22,34]. The
Arg151Cys allele is strongly associated with red hair
[14,15,22,35], and its functional impairment might be related
to deficient coupling to the cAMP signaling pathway, as it

has been reported that the binding properties of the mutant
receptor are very similar, if not identical, to wild-type
[22,34]. The Arg142His substitution has a similar functional
effect, with conserved binding properties but strongly
impaired coupling to the cAMP generation system [22].
Interestingly, both substitutions are located in the second
intracellular loop of the receptor protein, thus highlighting
the contribution of this region to efficient coupling to G
S
.
Moreover, Arg142 is part of a DRY sequence conserved in
most if not all GPCRs, and particularly in all members of
the melanocortin receptors subfamily.
WenexttriedtocorrelatetheMC1R genotype of several
of the HMC lines with their degree of responsiveness to
agonists, by studying their cAMP levels after treatment with
the superpotent melanocortin analog NDP-MSH (Fig. 2).
LND1 and HBL cells, homozygous for the wild-type allele,
both responded with strong and concentration-dependent
increases in cAMP, although the maximal levels of the
second messenger were higher for the former. Surprisingly,
both DOR cells, homozygous for wild-type MC1R,andIC8
cells, carrying one variant Leu93Arg allele, failed to increase
their cAMP intracellular levels in response to the superpotent
agonist. That this failure is not due to a defective adenylyl
cyclase was shown by a strong stimulation of the enzyme
activity in cells treated with the specific activator forskolin
(Fig. 2, B). Conversely, DOR and IC8 cells also failed to
respond to the natural agonists aMSH and adrenocortico-
tropic hormone, employed at a saturating concentration of

10
)7
M
(not shown). It is worth noting that the unrespon-
siveness of DOR cells is also unrelated to a lack of MC1R
gene expression, as we have previously found that the
mRNA levels for MC1R are comparable in DOR, LND1
and HBL cells, and higher in these HMC than in normal
human melanocyte cultures [28]. Moreover, both DOR and
IC8 cells display a significant number of specific binding sites,
in the range of 2500 ± 500 sites per cell. This is approxi-
mately 50% as compared to the responsive HBL cells. The
lack of functional coupling of these cell lines, particularly of
DOR cells homozygous for the wild-type MC1R, is therefore
perplexing and will be the subject of further studies.
On the other hand, as opposed to the well-known
Arg142His and Arg151Cys variants, no functional data are
available for the new Leu93Arg allele. Although the
unresponsiveness of the IC8 HMC line suggested that it
may correspond to a loss-of-function mutation, no clear
conclusion could be drawn at this stage, as DOR cells,
homozygous for wild-type MC1R, were also defective in
signaling through cAMP. Therefore, we performed a func-
tional analysis of the Leu93Arg MC1R. For comparison,
Table 1. Occurrence of MC1R variant alleles in human melanoma and
GCN cells.
Cell line Genotype
a
Variant allele
A375-SM 3 Arg151Cys

C8161 1 Arg151Cys
DOR 0 –
HBL 0 –
IC8
b
1 Leu93Arg
LND1 0 –
T1C3
b
1 Leu93Arg
GCN1 1 Arg151Cys
GCN2 0 –
GCN3 3 Arg142His
a
0, homozygous wild-type; 1, variant heterozygous; 2, variant
compound heterozygous; 3, variant homozygous.
b
The IC8 and
T1C3 cells lines derive from the same patient, and correspond to
two different clones selected on the basis of their different meta-
static potential.
Fig. 1. Structure of MC1R. The topology of the TM fragments is
depicted according to the model proposed in [31], and the length of the
signal peptide (hatched first 22 amino-terminal residues) was estimated
according to [32]. The allelic variants found in this study, as well as
other natural loss-of-function mutations described in the literature
(reviewed in [33]) are specified (gray circles) and highlighted by an
arrow.
6136 J. Sa
´

nchez Ma
´
s et al.(Eur. J. Biochem. 269) Ó FEBS 2002
the Arg151Cys receptor was also included in the study.
Figure 3 shows the coupling properties of the wild-type and
mutant receptors, as analyzed in clones of stably transfected
CHO cells. As expected, Arg151Cys clones failed to respond
to saturating concentrations of NDP-MSH with increases in
their intracellular cAMP levels, thus confirming results by
others [22,34]. A complete lack of functional coupling was
also observed for the Leu93Arg receptor. Next, the binding
properties of both variants were compared to wild-type, in
order to determine whether lack of agonist-induced cAMP
generation was related to impaired binding or coupling
properties. Clones stably transfected with the Leu93Arg
form were unable to specifically bind significant levels of
radiolabeled agonist (Fig. 4). However, and as previously
reported by others [22], the affinity for NDP-MSH was
identical, within experimental error, for the wild-type and
the Arg151Cys receptors (not shown).
This result was in keeping with the lack of hormone-
induced cAMP generation, and suggested that the func-
tional impairment was mostly explained by the inability of
the mutant receptor to bind melanocortins. However, the
possibility still existed that the unresponsiveness of the
clones stably transfected with the Leu93Arg variant could
be related to other causes, such as low expression or
aberrant processing of receptor molecules. To check these
possibilities, we performed transient expression experiments
using HEK 293T cells. Previous studies have shown that, in

Fig. 2. Functional coupling of several HMC lines of defined MC1R
genotype. (A) Dose–response curves for intracellular cAMP levels in
different HMC lines treated with increasing concentrations of NDP-
MSH. Results are shown as mean ± SD (n ‡ 3). (B) Levels of cAMP
in human melanoma cell lines treated with a saturating concentration
of NDP-MSH (10
)7
M
), or with the adenylyl cyclase stimulator
forskolin (FSK, 10
)5
M
), for 20 min. Results are the mean ± SD of
two independent experiments, each performed in triplicate dishes.
Fig. 3. Lack of functional coupling of the Arg151Cys and Leu93Arg
MC1R in stably transfected CHO cells. CHO cells from clones stably
transfected with the variants indicated, and selected on the basis of
high MC1R expression at the mRNA level, were seeded in six-well
plates, grown to semiconfluence and serum-deprived for 24 h. Then,
the cells were challenged with vehicle or with 100 n
M
NDP-MSH for
20 min, before cell lysis and determination of the cAMP contents in the
lysates. For each clone, parallel dishes were solubilized for protein
determination. Results are the mean ± SD of two independent
experiments, each performed in triplicate dishes (n ¼ 6). Similar results
were obtained with two independent clones for each variant.
Fig. 4. Inability of the Leu93Arg MC1R variant to bind NDP-MSH.
Clones of CHO cells stably transfected with the variant or wild-type
receptor were seeded in six-well plates, and incubated with a fixed

amount of
125
I-labelled-NDP-MSH in 500 lLofserum-freemedium
in the presence of increasing concentrations of unlabeled agonist. After
washing and harvesting as described in Materials and methods, the
radioactivity associated with the cell pellets was counted. Results are
the mean ± SD of two independent experiments, each performed in
triplicate dishes (n ¼ 6).
Ó FEBS 2002 Loss-of-function MC1R variants in human melanoma (Eur. J. Biochem. 269) 6137
this system, the expression of MC1R binding sites is high,
with B
max
values ranging from 2 to 8 pmolesÆmg protein
)1
,
depending on the construct under study [30]. Figure 5
shows that the Leu93Arg mutant was also unable to
mediate cAMP increases (A) or bind significant levels of
radiolabeled agonist (B), under conditions of strong over-
expression in transiently transfected HEK 293T cells. Under
identical conditions, the wild-type construct, which was
expressed at a density of 2.2 ± 0.25 pmoles binding sites
per mg protein, was highly efficient in eliciting a cAMP
response in cells challenged with NDP-MSH. Moreover,
MC1R mRNA levels for the wild-type and Leu93Arg alleles
were very similar in transiently transfected cells (C). This
was expected, as the two constructs are identical except for
the single base substitution in codon 93 determining the Arg
to Leu mutation. On the other hand, in order to detect
Fig. 5. The Leu93Arg MC1R variant is adequately expressed in transiently transfected HEK 293T cells, but fails to bind agonists or elicit agonist-

induced cAMP increases. (A) Functional coupling to cAMP production in cells transfected with empty vector (pcDNA), wild-type receptor or the
Leu93Arg variant. Cells were serum deprived 24 h before the measurement of cAMP under basal conditions (empty bars), or after stimulation with
NDP-MSH (10
)7
M
, closed bars). Results are the mean ± SD of quadruplicate independent dishes. (B) Equilibrium binding of
125
I-labelled-NDP-
MSH to the transiently expressed wild-type and Leu93Arg variants. Transiently transfected cells seeded in six-well dishes were incubated for 1 h in
thepresenceof10
)10
M
125
I-labelled-NDP-MSH, corresponding to 0.1 lCi per well. Data are given as specifically bound c.p.m., after subtraction of
the radioactivity bound to cells treated under identical conditions but in the presence of 10
)6
M
unlabeled NDP-MSH. Results are the mean ± SD
of quadruplicate independent dishes. (C) Comparable levels of MC1R mRNA in cells transfected with the wild-type or Leu93Arg constructs. Cells
were seeded in 25 cm
2
flasks and transfected with empty vector (–), or the wild-type (WT) or Leu93Arg (L93R) receptors, under conditions
comparable to the transfections for functional studies. Total RNA was extracted and analyzed for MC1R mRNA abundance by Northern blot
(upper), as previously described [28]. Comparable loading was ascertained by probing the membranes with a GAPDH probe (lower). Specific
signals were detected in a GS-525 phosphorimager from Bio-Rad (Hercules, CA). (D) Upper: Western blot detection of epitope-tagged Leu93Arg
(Arg93-T) and wild-type (WT-T) receptors. The electrophoretic mobility of molecular weight markers is shown on the left, and the molecular weight
of the specific bands is shown on the right (expressed in kDa). The specificity of the bands is clearly demonstrated by their absence in the lane
corresponding to cells transfected with empty vector (–). Lower: effect of treatment with N-glycosidase F on the electrophoretic mobility of the
tagged receptor protein. Control and glycosidase F-treated (EndoF) extracts from cells transfected with the WT-T construct were analyzed by
Western blot using the anti-HA monoclonal antibody. Upon treatment with the glycosidase, the band of higher molecular size was transformed into

a band comigrating with the lower molecular weight form.
6138 J. Sa
´
nchez Ma
´
s et al.(Eur. J. Biochem. 269) Ó FEBS 2002
possible effects on protein stability and/or processing, two
constructs were prepared, where an epitope-containing tag
was included at the C-terminus of the wild-type and Arg93
proteins, so as to enable the detection of the transiently
expressed proteins by Western blots. These constructs,
termed WT-T and Arg93-T were identical to the ones used
in functional studies, except for the presence of an in frame
C-terminal extension coding for 27 amino acids, with two
HA and an His6 epitope.
The protein levels of the tagged Arg93 protein were easily
detectable by Western blot. By means of an antihemagglu-
tinin antibody, an identical electrophoretic pattern, with two
bands corresponding to apparent molecular weights of 34
and 38.7 kDa were detected for the WT-T and Arg93-T
receptors (D). The relationship of these bands was studied
by deglycosylation of the samples followed by Western
blotting. In samples deglycosylated with N-glycosidase F,
only the higher mobility band was observed, thus showing
that this band does not correspond to a degradation
product of the higher molecular weight protein. Rather, the
faster band is very likely the de novo form of the tagged
MC1R, which, upon glycosylation and post-translational
processing, gives raise to the lower mobility band. In any
case, the slightly lower levels of the Arg93-T protein, as

compared to the wild-type, do not seem to be sufficient to
account for the complete loss of functional response in
terms of agonist binding or coupling to adenylyl cyclase,
specially considering the high overexpression obtained
under our experimental conditions. Moreover, the identical
electrophoretic pattern strongly suggests that the Leu93Arg
mutation has no effect on the processing of the receptor
molecule, at least as studied with the tagged forms of the
protein. Taken together, these results show that the
efficiency of expression of wild-type and Leu93Arg MC1R
is similar at the mRNA and protein levels, yet neither
agonist binding or functional coupling can be demonstrated
for the Leu93Arg mutant.
Therefore, the lack of specific binding of melanocortins to
the Leu93Arg receptor most likely reflects an actual impair-
ment of the receptor binding properties. Consistent with this
hypothesis, a pocket located between TM domains 2, 3 and 6
or 7 is probably responsible for the docking of agonists
[32,36,37]. Within this pocket, acidic residues Glu94 in TM2
and Asp117 or Asp121 in TM3 have been shown to be
critical for ligand–receptor interactions [37]. These negatively
charged residues are presumably spatially adjacent and
would provide a hydrophilic binding pocket interacting with
the positively charged Arg8 of the
D
-Phe7-Arg8-Trp9 core
sequence of NDP-MSH [37]. Within this context, it appears
likely that the introduction of a positively charged residue at
position 93 might either interfere with the positively charged
Arg8 residue of the agonist, or alternatively, counteract a

negative charge in the receptor protein important for
electrostatic interaction with the agonist. It is worth noting
that a constitutively active variant of the mouse Mc1r, the
naturally occurring somber E
so)3J
allele is also associated
with a substitution of a charged residue in TM2, namely
Glu92Lys, and that Glu92 in Mc1r is equivalent to Glu94 in
human MC1R. Interestingly, the constitutively active som-
ber Mc1r might also display a reduced binding affinity [38].
Therefore, the functional properties of the naturally
occurring Leu93Arg variant, along with site-directed muta-
genesis studies reported by others [37], strongly suggest that
the TM2 fragment of human MC1R plays a pivotal role in
agonist binding, and might also be an important determi-
nant of the receptor coupling properties. To further explore
this possibility, we generated an artificial construct homo-
logous to the mouse somber E
so)3J
allele, namely Glu94Lys,
and analyzed its functional properties in transiently trans-
fected HEK 293T cells. The coupling behaviour of the
MC1R mutant was highly reminiscent of the one reported
by Robbins et al. [38] for the mouse somber allele (Fig. 6A).
After transfection in HEK 293T cells, human Glu94Lys
MC1R displayed a noticeable agonist-independent consti-
tutive activity, as shown by the induction of high levels of
cAMP. These levels corresponded to approximately 50% of
the maximal stimulations achieved, and were approximately
twice as high as those found in cells transfected with the

wild-type receptor. Also in keeping with results reported for
themouseE
so)3J
allele, higher stimulations of adenylyl
cyclase were only obtained at high agonist doses (Fig. 6A),
consistent with a loss of binding affinity observed in
radioligand binding assays (Fig. 6B). This reduced affinity
for NDP-MSH of the Glu94Arg variant was evident by a
Fig. 6. Functional analysis of an artificial MC1R homologue of the
mouse somber E
so)3J
constitutively active allele. (A) Functional
coupling to the cAMP production system. (B) Displacement curves of
125
I-labelled-NDP-MSH (10
)10
M
in the incubation medium) by the
indicated concentrations of unlabeled ligand. The radioactivity bound
by the Glu94Lys variant in the absence of competing ligand was
approximately four times lower than for the wild-type receptor.
Ó FEBS 2002 Loss-of-function MC1R variants in human melanoma (Eur. J. Biochem. 269) 6139
two logs rightwards shift of the displacement curve and by
the lower amount of radioactivity bound in the absence of
competitor (in spite of the lack of statistically significant
differences in the number of binding sites, B
max
).
In summary, our results show that impaired signaling
through the MSH/MC1R pathway is common in HMC

lines, consistent with previous reports of increased melan-
oma risk in individuals carrying germline mutations of the
MC1R gene [19–21], and with the notion that loss-of-
function mutations in the MC1R gene sensitize human
melanocytes to the DNA damaging action of UV light [39].
Moreover, functional analysis of naturally occurring vari-
ants highlights important features of structure-function
relationships within the receptor protein, and points to the
extracellular side of TM2 as a major determinant of agonist
binding. Within this region, results by others have shown
that removal of the negative charge at position 94 strongly
diminishes agonist binding affinity [37], without yielding a
constitutively active receptor. We have shown here that the
change of a neutral side chain for a positively charged amino
acid at position 93 completely abolishes agonist binding.
Moreover, the nonconservative substitution of Glu94 for a
positively charged Lys residue not only decreases binding
affinity by two logs, but also confers constitutive activity to
the mutant receptor. Therefore, the balance of electric
charges in the external side of TM2 (and, most likely, their
interactions with adjacent negative charges in TM3) not
only determines the ability of the receptor protein to bind
ligands with high affinity, but also the prevalence of a
resting, uncoupled conformation as opposed to an active
conformation able to couple to Gs in an agonist-independ-
ent fashion. Again consistent with the crucial role of charge
interactions between the external side of TM2 and TM3, the
Cys125Arg mutation confers constitutive activity to the fox
receptor, and the homologous Cys123Arg mutation in the
mouse receptor displays a similar pharmacology, highly

reminiscent of the one observed for the mouse Glu92Lys
and the human Glu94Lys variants [10, this study]. On the
other hand, residues present in the second intracellular loop
appear critical for interaction with G proteins. Several
naturally occurring mutations in, or near this region, such as
the Arg142His, Arg151Cys and Arg160Trp and Arg162Pro
variants found by us and others abolish efficient coupling
without major effects on binding [22,29,34, this study].
Notably, with the possible exception of the Arg142His
allele, all these mutations abolish completely a positive
charge in the relatively short second intracellular loop. It is
tempting to speculate that the overall positive charge of this
loop could be important for binding a negatively charged
surface of the Gs protein. In many GPCRs, the third
intracellular loop and the cytoplasmic C-terminal extension
are the main regions involved in coupling to the G proteins
[2]. It is clear that in the case of the MC1R, the contribution
on the second intracellular loop is also relevant.
ACKNOWLEDGEMENTS
This work has been supported by grants PM1999-0138, from the DGI,
Ministry of Science and Technology, Spain and PTR1995-0582-OP.
Jesu´ sSa
´
nchez Ma
´
s is recipient of a fellowship from the Fundacio
´
n
Se
´

neca, Comunidad Auto
´
noma de la Regio
´
ndeMurcia,and
Concepcio
´
nOlivaresSa
´
nchez of a FPI fellowship from the Ministry
of Education, Spain.
REFERENCES
1. Marinissen, M.J. & Gutkind, J.S. (2001) G-protein-coupled
receptors and signaling networks: emerging paradigms. Trends.
Pharmacol. Sci. 22, 368–376.
2. Probst, W.C., Snyder, L.A., Schuster, D.I., Brosius, J. & Sealfon,
S.C. (1992) Sequence alignment of the G-protein coupled receptor
superfamily. DNA Cell. Biol. 11, 1–20.
3. Rozengurt, E. (1986) Early signals in the mitogenic response.
Science 234, 161–166.
4. Moolenaar, W.H. (1991) Mitogenic action of lysophosphatidic
acid. Adv. Cancer Res. 57, 87–102.
5. Gutkind, J.S. (1998) Cell growth control by G protein-coupled
receptors: from signal transduction to signal integration. Oncogene
17, 1331–1342.
6. Young, D., Waitches, G., Birchmeier, C., Fasano, O. & Wigler,
M. (1986) Isolation and characterization of a new cellular onco-
gene encoding a protein with multiple potential transmembrane
domains. Cell 45, 711–719.
7. Parma, J., Duprez, L., Van Sande, J., Cochaux, P., Gervy, C.,

Mockel, J., Dumont, J. & Vassart, G. (1993) Somatic mutations in
the thyrotropin receptor gene cause hyperfunctioning thyroid
adenomas. Nature 365, 649–651.
8. Shenker, A., Laue, L., Kosugi, S., Merendino, J.J., Minegishi, T.
& Cutler, J.B. (1993) A constitutively activating mutation of the
luteinizing hormone receptor in familial male precocious puberty.
Nature 365, 652–654.
9. Schipani, E., Kruse, K. & Juppner, H. (1995) A constitutively
active mutant PTH-PTHrP receptor in Jansen-type metaphyseal
chondrodysplasia. Science 268, 98–100.
10. Lu, D., Chen, W. & Cone, R.D. (1998) The Pigmentary System. In
Physiology and Pathophysiology (Nordlund, J.J., Boissy, R.E.,
Hearing, V.J., King, R.A. & Ortonne, J.P., eds), pp. 183–197.
Oxford University Press, New York.
11. Mountjoy,K.G.,Robbins,L.S.,Mortrud,M.T.&Cone,R.D.
(1992) The cloning of a family of genes that encode the melano-
cortin receptors. Science 257, 1248–1251.
12. Harding, R.M., Healy, E., Ray, A., Ellis, N.S., Flanagan, N.,
Todd, C., Dixon, C., Sajantila, A., Jackson, I.J., Birch-Machin,
M.A. & Rees, J.L. (2000) Evidence for variable selective pressures
at MC1R. Am.J.Hum.Genet.66, 1351–1361.
13. Valverde, P., Healy, E., Jackson, I.J., Rees, J.L. & Thody, A.J.
(1995) Variants of the melanocyte-stimulating hormone receptor
gene are associated with red hair and fair skin in humans. Nature
Genet. 11, 328–330.
14. Box, N.F., Wyeth, J.R., O’Gorman, L.E., Martin, N.G. & Sturm,
R.A. (1997) Characterization of melanocyte stimulating hormone
receptor variant alleles in twins with red hair. Hum. Mol. Genet. 6,
1891–1897.
15. Smith, R., Healy, E., Siddiqui, S., Flanagan, N., Steijlen, P.M.,

Rosdahl, I., Jacques, J.P., Rogers, S., Turner, R., Jackson, I.J.,
Birch-Machin, M.A. & Rees, J.L. (1998) Melanocortin 1 receptor
variants in an Irish population. J. Invest. Dermatol. 111, 119–122.
16. Busca
´
, R. & Ballotti, R. (2000) Cyclic AMP a key messenger in the
regulation of skin pigmentation. Pigment Cell Res. 13, 60–69.
17. Prota, G. (1992) Melanins and Melanogenesis. Academic Press,
Inc. San Diego.
18. Thody, A.J. & Graham, A. (1998) Does alpha-MSH have a role in
regulating skin pigmentation in humans? Pigment Cell Res. 11,
265–274.
19. Palmer, J.S., Duffy, D.L., Box, N.F., Aitken, J.F., O’Gorman,
L.E., Green, A.C., Hayward, N.K., Martin, N.G. & Sturm, R.A.
(2000) Melanocortin-1 receptor polymorphisms and risk of mel-
anoma: is the association explained solely by pigmentation phe-
notype? Am.J.Hum.Genet.66, 176–186.
20. Bastiaens, M.T., ter Huurne, J.A.C., Kielich, C., Gruis, N.A.,
Westendorp, R.G.J., Vermeer, B.J. & Bavinck, J.N.B. (2001)
6140 J. Sa
´
nchez Ma
´
s et al.(Eur. J. Biochem. 269) Ó FEBS 2002
Melanocortin-1 receptor gene variants determine the risk of
nonmelanoma skin cancer independently of fair skin and red hair.
Am.J.Hum.Genet.68, 884–894.
21. Box, N.F., Duffy, D.L., Irving, R.E., Russell, A., Chen, W.,
Griffyths, L.R., Parsons, P.G., Green, A.C. & Sturm, R.A. (2001)
Melanocortin-1 receptor genotype is a risk factor for basal and

squamous cell carcinoma. J. Invest. Dermatol. 116, 224–229.
22. Schioth, H.B., Phillips, S.R., Rudzish, R., Birch-Machin, M.A.,
Wikberg,J.E.S.&Rees,J.L.(1999)Lossoffunctionmutations
of the human melanocortin 1 receptor are common and are
associated with red hair. Biochem. Biophys. Res. Commun. 260,
488–491.
23. Abdel-Malek, Z., Swope, V.B., Suzuki, I., Akcali, C., Harriger,
M.D., Boyce, S.T., Urabe, K. & Hearing, V.J. (1995) Mitogenic
and melanogenic stimulation of normal human melanocytes by
melanotropic peptides. Proc. Natl. Acad. Sci. 92, 1789–1793.
24. Shih, I.M. & Herlyn, M. (1993) Role of growth factors and their
receptors in the development and progression of melanoma.
J. Invest. Dermatol. 100, 196S–203S.
25. Morandini, R., Boeynaems, J., Hedley, S., MacNeil, S. & Gha-
nem, G. (1998) Modulation of ICAM-1 expression by alpha-MSH
in human melanoma cells and melanocytes. J. Cell Physiol. 175,
276–282.
26. Smit, N., Westerhof, W., Asghar, S., Pavel, S. & Siddiqui, A. (1989)
Large-scale cultivation of human melanocytes using collagen-
coated sephadex beads (cytodex 3). J. Invest. Dermatol. 92, 18–21.
27. Sambrook, J., Fritsch, E.F. & Maniatis, T. (1989) Molecular
Cloning: A. Laboratory Manual, 2nd edn. Cold Spring Harbor
Laboratory, Cold Spring Harbor, NY.
28. Loir, B., Pe
´
rez Sa
´
nchez, C., Ghanem, G., Lozano, J., Garcı
´
a-

Borro
´
n, J.C. & Jime
´
nez-Cervantes, C. (1999) Expression of the
MC1 receptor gene in normal and malignant human melanocytes.
A semiquantitative RT-PCR study. Cell. Mol. Biol. 45, 1083–1092.
29. Jime
´
nez-Cervantes, C., Olivares, C., Gonza
´
lez, P., Morandini, R.,
Ghanem,G.&Garcı
´
a-Borro
´
n, J.C. (2001) The Pro162 variant is a
loss-of-function mutation of the human melanocortin 1 receptor
gene. J. Invest. Dermatol. 117, 156–158.
30. Jime
´
nez-Cervantes,C.,Germer,S.,Gonza
´
lez, P., Sa
´
nchez, J.,
Olivares,C.&Garcı
´
a-Borro
´

n, J.C. (2001) Thr40 and Met122 are
new partial loss-of-function natural mutations of the human
melanocortin 1 receptor. FEBS Lett. 508, 44–48.
31. Prusis, P., Schioth, M.B., Muceniece, R., Herzyk, P., Afshar, M.,
Hubbard, R.E. & Wikberg, J.E.S. (1997) Modeling of the three-
dimensional structure of the human melanocortin 1 receptor,
using an automated method and docking of a rigid cyclic mela-
nocyte-stimulating hormone core peptide. J. Mol. Graph. Model.
15, 307–317.
32. Nielsen, H., Engelbrecht, J., Brunak, S. & von Heijne, G.
(1997) Identification of prokaryotic and eukaryotic signal
peptides and prediction of their cleavage sites. Protein Engineering
10, 1–6.
33. Sturm, R.A., Teasdale, R.D. & Box, N.F. (2001) Human pig-
mentation genes: identification, structure and consequences of
polymorphic variation. Gene 277, 49–62.
34. Fra
¨
ndberg, P A., Doufexis, M., kapas, S. & Chhajlani, V. (1998)
Human pigmentation phenotype: a point mutation generates
nonfunctional MSH receptor. Biochem. Biophys. Res. Commun.
245, 490–492.
35. Flanagan, N., Healy, E., Ray, A., Philips, S., Todd, C., Jackson,
I.J., Birch-Machin, M.A. & Rees, J.L. (2000) Pleiotropic effects of
the melanocortin 1 receptor (MC1R) gene on human pigmenta-
tion. Hum. Mol. Genet. 9, 2531–2537.
36. Haskell-Luevano, C., Sawyer, T.K., Trumpp-Kallmeyer, S.,
Bikker, J.A., Humblet, C., Gantz, I. & Hruby, V.J. (1996) Three-
dimensional molecular models of the hMC1R melanocortin
receptor: complexes with melanotropin peptide agonists. Drug

Des. Discov. 14, 197–211.
37. Yang, Y., Dickinson, C., Haskell-Luevano, C. & Gantz, I. (1997)
Molecular basis for the interaction of [Nle4,
D
-Phe7] melanocyte
stimulating hormone with the human melanocortin-1 receptor
(melanocyte alpha-MSH receptor). J. Biol. Chem. 272, 23000–
23010.
38. Robbins, L.S., Nadeau, J.H., Johnson, K.R., Kelly, M.A., Roselli-
Rehfuss, L.R., Baack, E., Mountjoy, K. & Cone, R.D. (1993)
Pigmentation phenotypes of variant extension locus alleles result
from point mutations that alter MSH receptor function. Cell 72,
827–834.
39. Scott, M.C., Wakamatsu, K., Ito, S., Kadekaro, A.L., Kobayashi,
N., Groden, J., Kavanagh, R., Takakuwa, T., Virador, V.,
Hearing, V.J. & Abdel-Malek, Z.A. (2002) Human melanocortins
1 receptor variants, receptor function and melanocyte response to
UV radiation. J. Cell. Sci. 115, 2349–2355.
Ó FEBS 2002 Loss-of-function MC1R variants in human melanoma (Eur. J. Biochem. 269) 6141