Báo cáo Y học: Holliday junction binding and processing by the RuvA protein of Mycoplasma pneumoniae ppt

Holliday junction binding and processing by the RuvA protein
of
Mycoplasma pneumoniae
Stuart M. Ingleston
1
, Mark J. Dickman
2
, Jane A. Grasby
3
, David P. Hornby
2
, Gary J. Sharples
4
and Robert G. Lloyd
1
1
Institute of Genetics, University of Nottingham, Queen’s Medical Centre, Nottingham, UK;
2
Transgenomic Research Laboratory,
Krebs Institute, Department of Molecular Biology and Biotechnology, University of Sheffield, UK;
3
Krebs Institute, Centre for
Chemical Biology, University of Sheffield, UK;
4
Department of Biological Sciences, University of Durham, UK
The RuvA, RuvB and RuvC proteins of Escherichia coli act
together to process Holliday junctions formed during
recombination and DNA repair. RuvA has a well-defin ed
DNA binding surface that is sculptured specifically to
accommodate a Holliday junction and allow subsequent
loading of RuvB and RuvC. A negatively charged pin pro-

jecting from th e centre limits b inding of linear duplex DNA.
The a mino-acid sequences forming the pin are highly con-
served. However, in certain Mycoplasma and Ureaplasma
species the structure is extended by f our amino acids and two
acidic residues forming a crucial charge barrier are missing.
We investigated the signific ance of these d ifferences by
analysing RuvA from Mycoplasma pneumoniae. Gel retar-
dation and surface plasmon resonance assays revealed that
this protein binds Holliday junctions and other branched
DNA structures in a manner similar to E. coli RuvA. Sig-
nificantly, it binds duplex DNA more readily. However it
does not support branch migration mediated by E. coli
RuvB and when bound to junction DNA is unable to pro-
vide a platform for stable binding of E. coli RuvC. It also
fails to restore radiation resistance to an E. coli ruvA mutant.
The data p resented suggest that the modified pin region
retains the ability to promote junction-spe cific DNA bind-
ing, but acts as a physical obstacle to linear duplex DNA
rather than as a charge barrier. T hey also indicate that such
an obstacle may interfere with the binding of a resolvase.
Mycoplasma species may therefore process Holliday junc-
tions via uncoupled branch migration and resolution reac-
tions.
Keywords: recombination; DNA repair; RuvABC resolva-
some.
The formation and s ubsequent processing of Holliday
junctions are key stages in recombination and DNA repair
that provide the means to repair b roken DNA molecules,
generate recombinants in genetic crosses and rescue repli-
cation forks s talled at lesions in the template strands [1–4].

Once formed, t hese four-way branched DNA structures are
targeted by junction-specific DNA helicases and endonuc-
leases that act, respectively, to move the branch point along
the DNA (branch migration) and to cut specific DNA
strands at or near the crossover, thus releasing duplex DNA
products (resolution). In Escherichia c oli, the resolution
reaction appears to be coupled to branch migration via the
formation of a specialized molecular machine composed
of three p rotein s ubunits, RuvA, RuvB and RuvC [5,6].
A tetramer of RuvA binds one face of an open Holliday
junction to form a specific complex that supports the
loading of two RuvB ring helicases on opposing duplexes
and of a dimer of RuvC endonuclease on the other face of
the junction in the space between the RuvB rings [ 7,8]. Th e
RuvAB proteins catalyse junction branch migration while
RuvC resolves the structure to duplex products by intro-
ducing a pair of symmetrically related incisions at specific
sequences as the DNA strands move through the complex
[8–10].
The RuvA protein plays a pivotal role in processing
Holliday junctions. I t functions as a s pecificity factor f or
junction binding, provides a RuvA-junction scaffold for
assembly of RuvB and RuvC, and actively participates in
the b ranch migration and resolution reactions [11,12]. The
atomic structure of RuvA reveals four
L
-shaped monomers
comprising a fourfold symmetrical platform uniquely
adapted for binding four-way branched DNA molecules
[13,14]. Grooves on the concave surface of the tetramer

accommodate each duplex arm o f the junction in an open
square conformation [13–16]. Two helix-hairpin-helix
motifs from each monomer make co ntacts with the
phosphodiester backbone on the minor groove side of e ach
duplex arm of the junction [16,17]. The junction can be
bound by a single tetramer of R uvA [15,16] or en closed
between two tetramers [18]. It is not known if binding o f a
single tetramer of RuvA is sufficient f or branch migration
by RuvAB. This reaction may require a double tetramer of
RuvA or the assembly of a RuvABC resolvasome to anchor
the complex [18]. In the case of the octameric RuvA
complex, one of the tetramers would need to be released to
permit loading of RuvC for Holliday junction resolution.
At the intersection of the grooves, negatively charged pins
consisting of Glu55 and Asp56 from each monomer project
towards the centre of t he Holliday junction [13,14]. The four
pairs of negative charges prohibit binding of duplex DNA
across the centre of the tetram er and ensure high junction
Correspondence to R. G. Lloyd, Institute of Genetics, University of
Nottingham, Queen’s Medical Centre, Nottingham, NG7 2UH, UK.
Fax: + 0 1 15 9709906, Tel.: + 0115 9709406,
E-mail:
Abbreviations: bio, biotin; SA, streptavidin; RU, response units.
(Received 1 November 2001, revised 3 J anuary 2002, accepted
22 January 2002)
Eur. J. Biochem. 269, 1525–1533 (2002) Ó FEBS 2002
specificity [12]. Both acidic residues m ay also participate
directly in the branch migration reaction by forming water-
mediated contacts with unpaired bases [16]. Mutations that
alter the charge on these residues stimulate the rate of

branch migration and attenuate the enhanced junction
resolution observed with the RuvABC complex [ 12].
The negatively charged pin of RuvA is conserved in
almost all bacteria w ith the exception of three species,
Mycoplasma pneumoniae, M. genitalium and Ureaplasma
urealyticum. Mycoplasmas belong to the class Mollicutes
and are most closely related to Gram-positive bacteria,
although their genomes have experienced a drastic com-
pression in size. In t his work w e have examined the
properties of M. pneumoniae RuvA (MpRuvA) protein to
determine the function of the m odified p in. The interaction
between MpRuvA and branched DNA substrates and its
inability to form heterologous co mplexes w ith E. coli Ruv
proteins reveal important differences in junction binding
and processing by Mycoplasma species.
MATERIALS AND METHODS
Strains and plasmids
E. co li K-12 strains AB1157 (ruv
+
), SR2210 (ruvA200),
TNM1208 (DruvAC65 rus-1) have been described previ-
ously [25,29]. Strain SI171, a DruvAC65 derivative of BL2 1
(DE3), was used for overexpression of RuvA proteins [17].
EcRuvA was overexpressed from the pT7-7 construct,
pAM159 [17]. The Mycoplasma pneumoniae M129 [30] ruvA
gene was recovered by PCR from genomic DNA obtained
from R. Herrmann (Universita
¨
t Heidelberg, Germany).
Oligonucleotides (5 ¢-AAACTAAGG

CATATGATTGCT
TCAA-3¢ and 5 ¢-TGCGCCTTAT
GGATCCGGGACG
CTT-3¢) were designed t o amplify the gene and provided
NdeIandBamHI sites (underlined) f or cloning the PCR
product in pT7-7. The resulting construct, pSI66, was used
for o verexpression of Mp RuvA.CellsweregrowninLB
medium supplemented with ampicillin (50 lgÆmL
)1
)as
required for maintenance of plasmids. Sensitivity to UV
light was measured as described [25].
Protein purification
Purification of MpRuvA followed a similar protocol to
that described f or EcRuvA [17,31]. RuvB and R uvC
proteins were overexpressed and purified as described
previously [32,33]. Protein concentrations were estimated
by a modified Bradford assay using a Bio-Rad assay kit and
bovine serum albumin as standard. Amounts of RuvA,
RuvB and RuvC are expressed as m oles of the monomeric
protein.
DNA substrates
Oligonucleotide synthesis was performed on an Applied
Biosystems 394 DNA synthesiser using cyanoethyl phos-
phoramidite chemistry. The biotin phosphoramidite was
obtained f rom Glen Research. DNA substrates were
prepared by annealing a ppropriate oligonucleotides follow-
ing t he procedure described by Parsons [34]. The seq uence
of oligonucleotides used for the 50 bp junctions J11 and J12,
containing mobile cores of 1 1 a nd 12 bp, respectively, have

been described [23,24], as have those for Y junction and
linear duplex DNA substrates [20,24]. Gel retardation and
branch migration assays used substrates in which a single
strand had been 5¢
32
P-labelled using [c-
32
P] ATP and
polynucleotide kinase prior to annealing. For SPR analysis
the following oligonucleotides were used to make a 50-bp
static junc tion, J0, labelled with biotin ( bio) at the 5¢ end of
one strand: 1 (bio-AAAAATGGGTCAACGTGGGCAA
AGATGTCCTAGCAATGTAATCGTCTATGACGTT),
2 ( GTCGGATCCTCTAGACAGCTCCATGTTCACTG
GCACTGGTAGAATTCGGC), 3 (TGCCGAATTCTA
CCAGTGCCAGTGAAGGACATCTTTGCCCACGTTG
ACCC), 4 ( CAACGTCATAGACGATTACATTG CTAC
ATGGAGCTGTCTAGAGGATCCGA). A three-strand
junction was made by o mitting strand 4 and a 37-bp duplex
DNA by annealing oligonucleotides 5 (bio-AATGCTA
CAGTATCGTCCGGTCACGTACAACATCCAG) and
6 (CTGGATGTTGTACGTGACCGGACGATACTGT
AGCATT).
Gel retardation assays
Binding mixtures (20 lL) contained 0.2 ng
32
P-labelled J11,
Y j unction, or linear duplex DNA in 50 m
M
Tris/HCl

pH 8.0, 5 m
M
EDTA, 1 m
M
dithiothreitol, 100 lg/mL
BSA and 6% (v/v) glycerol. Samples were incubated on ice
with RuvA protein for 10 min prior to loading onto a 4%
polyacrylamide gel in low ionic strength buffer (6.7 m
M
Tris/HCl pH 8.0, 3.3 m
M
sodium acetate, 2 m
M
EDTA). In
RuvAC-junction assays, RuvA was added prior to the
addition of RuvC. Electrophoresis was at 160 V for 90 min
with continuous buffer circulation. Gels were dried and
analysed by autoradiography and phosphorimaging.
Branch migration assays
Reaction mixtures (20 lL) contained 0.2 ng o f
32
P-labelled
J12 in 20 m
M
Tris/HCl pH 7.5, 5 m
M
EDTA, 2 m
M
dithiothreitol, 100 lgÆmL
)1

BSA. RuvA protein was added
before RuvB and reactions incubated at 37 °Cfor30min
and terminated by t he addition of 5 lLofstopmix(2.5%
SDS, 200 m
M
EDTA, 10 mgÆmL
)1
proteinase K) with
incubation for a further 10 min. Reaction products were
separated on 10% PAGE in Tris/borate/EDTA buffer
(89 m
M
Tris/HCl, pH 8.0, 89 m
M
borate, 2.5 m
M
EDTA)
at 160 V for 9 0 min and analysed as described above.
Surface plasmon resonance
Surface plasmon resonance was performed using a BIAcore
2000
TM
(Uppsala, Sweden). Oligonucleotides were diluted
in buffer [10 m
M
Hepes pH 7.4, 150 m
M
NaCl, 3 m
M
EDTA, 0.05% (v/v) surfactant P20] to a final concentration

of 1 ngÆmL
)1
and passed o ver a streptavidin (SA) sensor
chip at a flow rate of 10 lLÆmin
)1
until approximately 100–
200 response units (RU) of the oligonucleotide was bound
to the sensor chip surface . Proteins were a lso diluted in
Hepes/Na Cl/P
i
/EDTA/P20 and a range of concentrations
(4–8000 n
M
) w ere i njected over the DNA-charged sensor
chip at a flow rate of 20 lLÆmin
)1
for 3 min and allowed to
dissociate for 5 min. Bound protein was removed by
injecting 10 lLof1
M
NaCl. This regeneration p rocedure
did not alter the ability of EcRuvA to bin d Holliday
1526 R. G. Lloyd et al. (Eur. J. Biochem. 269) Ó FEBS 2002
junction. Analysis of the data was performed using
BIA-
EVALUATION
software. T o r emove t he effects of t he bulk
refractive index change at the beginning and end of
injections (which occur as a re sult of a difference in the
composition of the running buffer and the injected protein),

a control sen sorgram obtained over t he streptavidin s urface
was subtracted from each protein injection.
Kinetic analysis
The dissoc iation rate constants were calculated using linear
regression analysis assuming a zero order dissociation using
the equation:
dR=dt ¼ k
d
R
0
e
Àk
d
ðtÀt
0
Þ
where dR/dt is the rate of c hange of t he SPR signal, R and
R
0
, is the response at time t and t
0
. k
d
is the dissociation rate
constant.
Equilibrium binding analysis
BIAcore equilibrium binding experiments were performed
as described [35] with minor modifications. The instrument
was equilibrated at 2 5 °Cwith10m
M

Hepes, pH 7.4,
150 m
M
NaCl, 3 m
M
EDTA, 0.05% (v/v) surfactant p20 at
a flow rate of 100 lLÆmin
)1
. Baseline data were collected for
45 min at the start of t he experiment, b efore the incorpor-
ation o f t he prote in into the running buffer. After equilib-
rium binding profiles had been generated, the responses
from the four flow cells were baseline corrected during t he
initial w ashing phase. The r esponse from t he reference flow
cell was subtracted from the other three flow cells to correct
for refractive index changes, nonspecific binding and
instrument drift.
RESULTS
The modified pin structure of
Mp
RuvA
The negatively charged pin of E. co li RuvA (EcRuvA) has
two acidic r esidues (Glu55 and Asp56) flanked by b sheets
[13,14]. This arrangement is conserved in the RuvA
sequences from 45 other b acterial species [12] (Fig. 1A and
data not shown), which suggests that the pin architectures
are probably very similar, as demonstrated for Mycobacte-
rium leprae RuvA [18]. However, three bacterial species
(M. pneumoniae, M. genitalium, and Ureaplasma urealyti-
cum) carry RuvA orth ologs in which the sequences forming

the pin region differ significantly from this pattern (Fig. 1B).
These RuvA p roteins have a n additional four amino acids
and l ack acidic residues at the apex of the intervening loop.
Acidic residues that may potentially compensate for the loss
of the negative charge are located nearby in the two
Mycoplasma sequences but are positioned in the region
corresponding to b sheet 6 in the EcRuv A structure [17]. The
global structure of the two RuvA proteins would have to be
radically altered t o accommodate these r esidues in the same
position as in EcRuvA. In addition, only one acidic residue is
retained in U. urealyticum RuvA (Fig. 1B). However, c on-
servation o f sequences in the flanking b sheets suggests that
the g eneral architecture of the pin is probably m aintained.
Thus, the likely net effe ct of the altered sequence between b5
and b6 is to produce an extended a nd uncharged pin.
Interaction of
Mp
RuvA with a Holliday junction
To investigate the effect of these alterations in pin structure
on the DNA binding properties of RuvA we purified the
Mycoplasma pneumoniae RuvA protein and compared its
activity with that of EcRuvA. The protein was o verex-
pressed in a DruvAC derivative of E. coli BL21 (DE3) to
prevent contamination with EcRuvA and purified using t he
procedure devised previously. A synthetic Holliday junction
containing an 11-bp mobile core was used as a substrate in
gel retardation assays to assess the ability of the protein t o
bind junction DNA. Both MpRuvA and EcRuvA bound
the junction. Each formed two distinct complexes (Fig. 2A).
In the case of the E. coli protein, the two complexes

represent the binding of either a single tetramer of RuvA
(complex I) or of two tetramers (complex II). The data
presented i ndicate that MpRuvA has the ability t o f orm
similar complexes. However, Mp RuvA complex II appears
less stable as most of the j unction is found in complex I
(Fig. 2 A, lanes l–t). In both cases, 100 n
M
of protein was
sufficient to bind all of the junction DNA mole cules
(Fig. 2 A, lane j and t). Further quantitative studies revealed
that MpRuvA may have a slightly higher affinity for
junction DNA than EcRuvA (Fig. 2B). The k
d
values
estimated from t hese data were 18 n
M
for MpRuvA and
42 n
M
for EcRuvA.
Specificity of Holliday junction binding by
Mp
RuvA
The E. coli RuvA protein targets four-way junctions with
high specificity [19,20]. Mutations that reduce the net charge
on each subunit r esult in a significant increase in affinity for
duplex DNA [12]. We investigated the junction specificity of
MpRuvA by analysing its binding to a Y-shaped junction
and to linear duplex DNA. Like the E. coli protein,
MpRuvA formed two complexes with a Y junction.

However, as with the f our-way junction, only small
amounts of complex II were detected, which again suggests
that the loading of two tetramers is less favoured (Fig. 3A).
No binding to linear duplex DNA was detected with
EcRuvA (Fig. 3B, lanes b and c) in keeping with its high
selectivity for branched molecu les. However, traces of two
complexes we re d etected w ith Mp RuvA, even at relatively
low concentrations of protein (Fig. 3B, lanes d and e).
To analyse the structure specificity of MpRuvA more
quantitatively we m ade use of surface plasmon resonance.
Biotinylated DNA substrates [a Holliday junction (J0)
lacking a homologous core, a th ree-strand derivative of J0,
and duplex DNA] were immobilized on different flow cells
on a streptavidin sensor chip. The binding of EcRuvA and
MpRuvA to these substrates was examined and the results
are shown in Fig. 3C,D. EcRuvA showed the expected
preference for Holliday junction DNA over both three-
strand and duplex DNA as evident from t he gradient of
dissociation illustrate d on the sensorgram (Fig. 3C). Disso-
ciation rate constants were c alculated u sing the equation
described in Materials and methods. Whilst this equation
may not fit the entire range of protein concentrations under
all of the experimental conditions described here, it repre-
sents the best case scenario, a s the analysis is comparative in
nature and describes the net stability of the protein:DNA
complex. The rate constants reveal a three to fourfold
difference between the linear duplex/three-strand substrates
Ó FEBS 2002 Mycoplasma RuvA protein (Eur. J. Biochem. 269) 1527
and Holliday junction bound by Ec RuvA (Table 1),
illustrating the additional stability of the Holliday junc-

tion-RuvA complex. The binding of the MpRuvA is shown
in Fig. 3D and shows little difference in the dissociation rate
constants for the three different DNA-MpRuvA complexes,
demonstrating that these complexes have equal stabilities.
Figure 3E shows a direct comparison of the binding of
EcRuvA an d MpRuvA to linear duplex DNA and shows
the additional stability of the MpRuvA bound DNA
complex c ompared to the EcRuvA bound DNA complex.
But the results also show an increase in the amount of
MpRuvA binding to duplex DNA compared to Ec RuvA,
as indicated by t he response (Figs 3C–E). MpRuvA also
formed a complex with a short 24 bp duplex that was not
bound detectably by Ec RuvA (data not shown). The SPR
data are broadly consistent with the results obtained f rom
gel retardation assays confirming that MpRuvA has a
reduced specificity for Holliday junctions. SPR analysis also
shows that the EcRuvA and MpRuvA bind to the DNA
with fast association rate c onstants (k
a
). This results in
mathematical mo dels that poorly fit the data, and calcula-
tions using k
a
and k
d
to obtain the equilibrium dissociation
constant would be erroneous.
Equilibrium binding analysis was p erformed to further
analyse the interaction of Mp RuvA with Holliday junction
and duplex DNA (Fig. 4). RuvA protein was placed directly

in the running buffer and continually passed over the sensor
chip surface containing duplex or Holliday junction
attached to different flow cells. The binding profile of the
MpRuvA inte raction w ith these DNA substrates is shown
in Fig. 4A. The sensorgram reveals that MpRuvA protein,
like EcRuvA (Fig. 4B), binds with high affinity to the
Fig. 1. The modified pin s tructure of
MpRuvA. (A) Structure of the EcRuvA-
Holliday junction DNA complex [15].
A tetramer of R uvA (opposing monomers
are in shades of grey) binds the Holliday
junction in an open square conformation.
The duplex arms o f the junction are bo und
in grooves on th e concave surface o f the
protein a nd converge at a centrally located
pin structure fo rm ed by Glu55 and Asp56
(red) i n each RuvA subunit. (B) Alignment
of bacterial RuvA p roteins showing
conservation of the p in region. Residues
42–65 of EcRuvA are aligned with
homologous sequen ces from selected
bacterial species. Residues conserved in
the m ajority of RuvA sequences f rom 46
bacteria (data not shown) are highlighted in
bold. Arrows denote the pos ition of b sheets
5and6intheEcRuvA structure [14,17].
Acidic pin residues are highlighted in red, as
are negatively charged residues located
nearby in the Ruv A sequences from
M. pneumoniae, M. genitalium,and

U. ur ealyticum.
1528 R. G. Lloyd et al. (Eur. J. Biochem. 269) Ó FEBS 2002
Holliday junction at relatively low concentrations of protein
(0.112 and 1.12 n
M
). Binding to duplex DNA is not
observed until a concentration of 1 1.2 n
M
is passed over
the sensor c hip surface (Fig. 4A). Significantly, these results
reveal that MpRuvA has a higher affinity for duplex DNA
than the EcRuvA protein. Binding of EcRuvA to duplex
DNA is not evident until a concentration of 90.4 n
M
is
reached (Fig. 4B). Thus MpRuvA bound to t he duplex at a
10-fold lower concentration and assuming the mechanism
and mode of binding is the same, the MpRuvA has a 10-fold
higher affinity for duplex DNA. Despite this difference,
MpRuvA retains H olliday junction specific ity with s imilar
kinetics and stoichiometry as EcRuvA.
Mp
RuvA is unable to interact with
E. coli
RuvB
and RuvC proteins
RuvA and R uvB mediate the branch migration of Holliday
junctions and in vitro promote the dissociation of synthetic
junction su bstrates to yield flayed duplex products [19]. We
examined MpRuvA to see if it could form a branch

migration complex with E. coli RuvB. Heterologous branch
migration activity has previously been demonstrated using
M. leprae RuvA with E. coli RuvB [21] and E. coli RuvA
with Thermus thermophilus RuvB [22]. MpRuvA was
incubated with E. coli RuvB and synthetic Holliday junc-
tion J12 in reactions containing Mg
2+
and ATP ( Fig. 5 A,
lanes j –p). In contrast to reactions containing EcRuvA
(Fig. 5A, lanes b–h), no unwinding of the synthetic Holliday
junction was detected in reactions containing MpRuvA.
Similar results were obtained using other junctions differing
in sequence and length of mobile core (data not shown). The
results indicate that MpRuvA is unable to form a functional
branch migration complex with E. coli RuvB.
The coupling o f branch m igration and resolution medi-
ated by the E. coli RuvABC resolvasome complex requires
the binding of RuvA to one face of the junction and RuvC
to the other [8,9]. Complexes formed by the loading of both
RuvA and RuvC on a synthetic junction can be detected
using a gel retardation assay [23]. W e used such an assay to
Fig. 2. Holliday ju nction binding by MpRuvA. (A) Gel retardation
assay showing the formation of complexes I and II with junction J11.
Binding mixtures cont ained 0 .2 ng
32
P-labelled J11 DNA and 0, 0.1,
0.5, 1, 2, 5, 10, 20, 50, and 100 n
M
of EcRuvA (lanes a–j) or MpRuvA
(lanes k–t) prot eins. (B) Titration o f MpRuvA and EcRuvA showing

the relative binding of J11. Values are the mean of two independent
experiments and are b ased on the f raction of the to tal DNA bound.
Fig. 3. Interaction of MpRuvA with branched DNA structures and lin-
ear du plex molecules. (A) Gel retardation assay showing binding of
RuvA prote ins to a Y-ju nction DNA substrate. Reac tions contained
0.2 ng
32
P-labelled DNA and RuvA at 2 n
M
(lanes b an d d) or 20 n
M
(lanes c and e). (B) Gel retardation assay showin g binding of RuvA
proteins to linear duplex DNA. Reactions contained 0.2 ng
32
P-labelled DNA and R uvA at 1 0 n
M
(lanes b and d) or 100 n
M
(lanes
c and e). (C) Surface plasmon resonance sensorgram sho wing binding
of EcRuvA (8 l
M
) to duplex, three-strand and Holliday junction
DNA. (D) Surface plasmon resonance sensorgram showing binding of
MpRuvA (6.4 l
M
) to d uple x, t hree-stran d a nd J0 DNA. (E) S urfac e
plasmon resonance sensogram showing the binding of EcRuvA (6 l
M
)

and MpRuvA (4 l
M
)toduplexDNA.
Ó FEBS 2002 Mycoplasma RuvA protein (Eur. J. Biochem. 269) 1529
investigate whether E. coli RuvC could b ind a junction
already bound by MpRuvA. With 200 n
M
RuvC an d l ow
concentrations of Ec RuvA, a RuvA/junction/RuvC com-
plex was visualized (Fig. 5B, lanes c and d). No such
complex could be detected using Mp RuvA (Fig. 5B, lanes
l–r). The only complexes seen were those f ormed b y t he
binding of RuvC alone or of a double tetramer of Mp RuvA
(complex II). The absence of Mp RuvA complex I may be
significant, especially as this is the predominant c omplex
formed in the absence of RuvC (Fig. 2A). It i s possible that
such complexes do bind RuvC but that such binding
destabilizes the RuvA–junction interaction.
Effect of
Mp
RuvA on DNA repair in
E. coli ruv
mutants
The ability of Mp RuvA protein t o promote D NA repair
in vivo was i nvestigated by introducing plasmid constructs
encoding MpRuvA or EcRuvA into E. coli strains SR2210
(ruvA200)andtheruv
+
control, AB1157. The plasmid
expressing MpRuvA (pSI66) failed to improve the UV

sensitivity of the ruvA mutant SR2210 (Fig. 6A), which is
not surprising given that MpRuvA fails to form productive
interactions with E. coli RuvB or RuvC. Indeed, s urvival
was a ctually reduced. This n egative effect is most likely due
to MpRuvA blocking the access of other junction process-
ing enzymes such as RecG [24]. Expression of MpRuvA also
reduced survival of the ruv
+
AB1157 strain (Fig. 6B).
However, the effect was rather modest and we conclude that
overexpression of MpRuvA does not interfere significantly
with junction processing by the r esident E. coli RuvABC
system.
To further investigate the ability of Mp RuvA to block
junction processing in vivo, we made use of strain TNM1208
(DruvAC rus-1). This strain lacks the RuvABC resolution
pathway due to deletion of the ruvA and ruvC genes.
However, it is resistant to UV light because the rus-1
mutation activates an alternative resolvase (RusA) that is
able to process Holliday junctions very efficiently in the
Table 1 . Dissociation rates fo r MpRuvA and EcRuvA-DNA complexes.
DNA
Dissociation rate constant (k
d
) (1/s) ± SD
a
MpRuvA EcRuvA
Holliday junction 6.1 · 10
)4
± 2.2 · 10

)5
5.5 · 10
)4
± 4.2 · 10
)5
Three-strand junction 7.4 · 10
)4
± 3.0 · 10
)5
17 · 10
)4
± 1.9 · 10
)4
Duplex 6.2 · 10
)4
± 2.3 · 10
)5
19 · 10
)4
± 2.2 · 10
)4
a
Determined using surface plasmon resonance analysis.
Fig. 4. Equilibrium bind ing profiles of MpRuvA and EcRuvA on Holl-
iday junction (J0) and linear duplex DNA substrates. (A) MpRuvA was
incorporated in the running buffer at concentrations of 0.0112 n
M
(a),
0.112 n
M

(b), 1.12 n
M
(c) and 11.2 n
M
(d). (B) EcRuvA was incor-
porated in the running buffer at concentrations of 0.00904 n
M
(a),
0.0904 n
M
(b), 0.904 n
M
(c), 9.04 n
M
(d) and 90.4 n
M
(e). The arrows
indicate the tim e at which the concentration of the protein was altered.
Fig. 5. Interactions between RuvA and either Ruv B or RuvC.
(A) B ranch m igration assay showing the dissociation of H olliday
junction to flayed duplex products. Reaction s contained 0.2 ng
32
P-labelled J12 DNA and proteins a s indicated. ( B) Gel r etardation
assay s howing the f orma tion of RuvAC-junction complexes. Binding
mixes contained 0.2 ng
32
P-labelled J12 DNA and proteins as indi-
cated.
1530 R. G. Lloyd et al. (Eur. J. Biochem. 269) Ó FEBS 2002
absence of RuvABC [25–27]. The introduction of a p lasmid

expressing EcRuvA into this strain increases sensitivity to
UV light (Fig. 6C), presumably by blocking Holliday
junction resolution by RusA [17]. The plasmid encoding
MpRuvA also increases sensitivity t o UV, but the effect is
considerably less severe (Fig. 6C). This finding suggests that
MpRuvA is less able to inhibit t he processing o f Holliday
junctions in vivo than Ec RuvA despite the fact that both
bind synthetic Holliday junctions with similar affinities
in vitro (Fig. 2A).
DISCUSSION
The n egatively charged central pin on the DNA binding
surface of RuvA plays a crucial role in junction targeting
and processing. It c onstrains the r ate of branch migration
by RuvAB and influences resolution by RuvABC [12]. The
importance of this structure is reflected in the high
conservation of the sequences forming the pin in th e
majority of bacteria with the exception of two Mycoplasma
species and one of Ureaplasma. In t he RuvA p roteins from
these organisms the pin sequence is extended by four
residues and lacks negatively charged residues at the apex of
the structure. We investigated the properties of the RuvA
protein from M. pneum oniae to see how these modifications
affected its interaction with DNA.
The MpRuvA protein bound the four-way branched
Holliday junction structure with a high affinity. However,
relative to EcRuvA, it displayed a n increased af finity for
Y-shaped duplex DNA structures, three-strand junctions
and linear duplex DNA. I ts affinity for linear duplex DNA
is app roximately 10-fold higher than the E. coli protein. The
results suggest that the m odified pin influences the a bility to

bind duplex DNA and is consistent with observations by
Ingleston et al. [12] showing that mutations in EcRuvA that
reduce the net negative c harge on t he pin, or which add
positive c harges, r esult in an increase i n b inding to duplex
DNA.
As with the E. coli protein, we found that a synthetic
Holliday junction c an bind e ither one or two tetramers of
MpRuvA. However the octameric complex (complex II)
appears less s table than t hat formed w ith EcRuvA. As the
pinregionofMpRuvA contains an additional f our amino
acids it is likely that the pin i s extended and this extension
could cause steric clashes across t he central cavity of the
open H olliday junction that interfere with stable binding
of a tetramer on both f aces. The reduced stability of the
octamer c omplex may explain the modest negative effect
of MpRuvA compared with EcRuvA on DNA repair
mediated by the RusA resolvase in strain TNM1208
(Fig. 6 C). This protein forms a very stable octameric
complex and when overexpressed is therefore much more
likely to prevent RusA gaining acce ss to a Holliday
junction. Single tetramers of EcRuvA and MpRuvA bind
junction DNA with similar affinities. However, such
complexes are less likely to inhibit R usA a s one face of
the junction would remain free of protein and this may be
sufficient for RusA to loa d on the DNA and resolve the
structure.
We found that MpRuvA is unable to p romote DNA
repair in E. coli ruvA mutants. This is most lik ely a
consequence of its failure to assemble a f unctional branch
migration c omplex with E. coli RuvB. Certain conserved

residues in domain III of EcRuvA (Leu16 7, Leu170, Tyr172
and Leu199) a re known t o participate in protein–protein
interactions with Ec RuvB [1 1,14]. MpRuvA has the first
three of these residues but differs in the replacement of
Leu199 with isoleucine. It is possible that this subtle change
accounts f or the inactivity of the hybrid MpRuv A-EcRuvB
branch migration motor, altho ugh other differences affect-
ing the architecture of MpRuvA domain III cannot be
excluded. Mycobacterium leprae RuvA, w hich retains a
conserved leucine at this position, forms an active branch
migration complex with EcRuvB [21]. Compensatory
changes in the MpRuvB sequence should correspond to
the alterations in MpRuvA that prevent heterologous
contacts with EcRuvB. Isoleucine r esidues at positions 148
and 150 in EcRuvB are critical for the formation of
complexes with EcRuvA [28]. In MpRuvB these amino
acids are replaced by the alternative hydrophobic residues,
valine and methionine, respectively. These substitutions at
the MpRuvA–RuvB interface are likely to be responsible for
blocking the formation of functional complexes between
MpRuvA and EcRuvB.
We also found that E. coli RuvC was unable to form a
complex w ith a junction already bound by MpRuvA, at
least not o ne stable e nough t o be d etected in a gel
retardation assay. In common with other Gram-positive
bacteria, M. pneumoniae lacks a homologue of RuvC [6]. It
is therefore possible that branch migration and resolution
are uncoupled in these species [18]. The assembly o f a
RuvABC complex i s ne cessary for e fficient resolution o f
Holliday junctions in E. coli and presumably imposes

constraints on the evolution of each Ruv protein. In
particular, RuvA may have to maintain a compact acidic
pin that does not project at the junction core so that the
conformation of the RuvA-bound junction allows stable
loading of R uvC. In the absence of a R uvC, the c onstraints
on MpRuvA would be reduced and limited to those factors
necessary for junction b inding and t he loading o f RuvB.
However, s everal Gram-positive bacteria that lack RuvC
apparently retain the conserved pin architecture of EcRuv A
[6,12]. In fact, M. pulmon is RuvA has a pin that more
Fig. 6. Survival of UV-irradiated Escherichia coli strai ns carrying
plasmids expressing either MpRuvA or EcRuvA proteins. (A) Strain
SR2210 ( ruvA 200 ). (B) Strain AB1157 (ruv
+
). (C) Strain TNM1208
(ruvAC rus-1). The plasmid constructs used are i dentified in (B). Values
are the me an of at least t wo independent experiments.
Ó FEBS 2002 Mycoplasma RuvA protein (Eur. J. Biochem. 269) 1531
closely resembles the standard pattern rather than its closely
related Mollicutes (Fig. 1B). In addition, M. leprae RuvA,
which has an apparently identical pin to EcRuvA, also f ails
to form junction complexes with EcRuvC in a gel retarda-
tion assay, perhaps suggesting t hat there are stabilizing
contacts across the j unction that are i ndependent of pin
structure [21]. Clearly there are subtle differences in the way
Holliday junctions are processed by Mycoplasmas.Further
insights into the mechanism of Holliday junction branch
migration and resolution await the identification and
characterization of t he novel resolvase employed in Gram-
positive eubacteria.

ACKNOWLEDGEMENTS
We thank Richard Herrm ann for Mycoplasma pneumoniae genomic
DNA. This work was supported by grants from the Biotechnology and
Biological Sciences Research Council, the Wellcome Trust, the Royal
Society, and the Medical Research Council. M. J. D. was in receipt of a
Prize Studentship from the Wellcome Trust.
REFERENCES
1. Seigneur, M., Bidneko, V., Ehrlich, S.D & Michel, B. (1998)
RuvAB a cts at a rrested replication forks. Cell 95 , 419–430.
2. McGlynn, P & Lloyd, R.G. (2000) Modulation of RNA poly-
merase by ( p)p pGpp reveals a RecG-dependent mechanism for
replicati on fork progre ssi on. Cell 101, 3 5–45.
3. Kowalczykowski, S .C. (2000) I nitiation of genetic recombination
and recombination-dependent replication. Trends Biochem. Sci.
25, 156–165.
4. Singleton, M.R., Scaife, S & Wigley, D.B. (2001) Structural ana-
lysis o f DNA replication fork reversal by R ecG. Cell 107, 79–89.
5. West, S.C. (1997) Processing of recombination i ntermediates by
the RuvABC proteins. Annu.Rev.Genet.31, 213–244.
6. Sharples, G.J., Ingleston, S.M & Lloyd, R.G. (1999) Holliday
junction processing in bacteria: i nsights from the evolutionary
conservation of RuvABC, RecG, and RusA. J. Bacteriol. 181,
5543–5550.
7. Parsons, C.A., Stasiak, A., Bennett, R.J & West, S.C. ( 1995)
Structure of a multisubunit complex that p ro motes DNA branch
migration. Na tur e 374, 3 75–378.
8. Davies, A.A & West, S.C. (1998) Formation of RuvABC-Holliday
junction complexes in vitro . Curr. Biol. 8, 725–727.
9. Zerbib, D.M., E
`

zard, C., George, H & West, S.C. (1998)
Co-ordinated actions of RuvABC in Holliday junction processing.
J. Mol. B iol . 281, 621–630.
10. Eggleston, A.K & West, S.C. (2000) Cleavage of Holliday junc-
tions by the Esch erichia co li RuvABC complex. J. Biol. Chem. 275,
26467–26476.
11. Nishino, T., Iwasaki, H., Kataoka, M., Ariyoshi, M., Fujita, T.,
Shinagawa, H & Morikawa, K. (2000) M odulation o f R uvB
function by the mobile domain III of the Holliday junction
recognition protein RuvA. J. Mol. Biol. 298, 407–416.
12. Ingleston, S.M., Sharples, G.J & Lloyd, R.G. (2000) The acidic pin
of RuvA modulates Holliday junction binding and processing by
the R uvABC resolvasome. EMB O J. 19, 6266–6274.
13. Rafferty, J.B., Sedelnikova, S.E., Hargreaves, D., Artymiuk, P.J.,
Baker, P.J., Sharples, G.J., Mahdi, A.A., Lloyd, R.G & Rice,
D.W. (1996) C rystal structure of DNA recombination protein
RuvA and a model for its b inding to the Holliday junction. Science
274, 415–421.
14. Nishino, T., Ariyoshi, M., Iwasaki, H., Shinagawa, H &
Morikawa, K. (1998) Functional analyses of the domain
structure in the Holliday junction binding protein RuvA. Structure
6, 11–21.
15. Hargreaves, D., Rice, D.W., Sedelnikova, S.E., A rtymiuk, P.J.,
Lloyd, R.G & Rafferty, J.B. (1998) Crystal structure of E. coli
RuvA with bound DNA Holliday junction at 6 A
˚
resolution. Nat.
Struct. Biol. 5, 441–446.
16. Ariyoshi, M., Nishin o, T., Iwasaki, H., Shinagawa, H &
Morikawa, K. (2000) Crystal structure of the Holliday junction

DNA i n complex with a single Ruv A tetramer. Proc. Natl Acad.
Sci. USA 97 , 8257–8262.
17. Rafferty, J.B., Ingleston, S.M., Hargreaves, D., Artymiuk, P.J.,
Sharples, G.J., Lloyd, R.G & Rice, D .W. (1998) Structural s imi-
larities between Escherichia coli RuvA and other DN A-binding
proteins and a mutational analysis of its binding to the Holliday
junction. J. Mol. Biol. 278, 105–116.
18. Roe, S.M., Barlow, T., Brown, T., Oram, M., Keeley, A.,
Tsaneva, I.R & Pearl, L.H. (1998) Crystal structure of an
octameric RuvA-H olliday j unct ion c omplex. Mol. Cell. 2,361–
372.
19. Parsons, C.A., Tsaneva, I., Lloyd, R .G & West, S.C. (19 92)
Interaction of E. coli RuvA and RuvB proteins with synthetic
Holliday junctions. Proc. Natl Acad. Sci. USA 89, 5452–5456.
20. Lloyd, R.G & Sharples, G .J. (1993) Proc essing of rec ombination
intermediates by the RecG and RuvAB proteins of Escherichia
coli. Nucleic Acids Res. 21, 1719–1725.
21. Arenas-Licea, J., van Gool, A.J., Keeley, A.J., Davies, A., West,
S.C & Tsaneva, I.R. (2000) F unctional interactions of Myco-
bacterium l eprae RuvA with Escherichia coli RuvB and R uvC on
Holliday junctions. J. Mol. Biol. 301, 839–850.
22. Yamada, K., Fukuoh, A., Iwasaki, H & Shinagawa, H. (1999)
Novel properties of the Thermus thermophilus RuvB protein,
which promotes branch-migration of Holliday j unctions. Mol.
Gen. Genet. 261, 1001–1011.
23. Whitby, M.C., Bolt, E.L., Chan, S.N & Lloyd, R.G. (1996)
Interactions between RuvA and RuvC a t Holliday junctions:
inhibition of j unction cleavage and formation o f a RuvA–RuvC–
DNA complex. J. Mol. B iol. 264, 878–890.
24. Lloyd, R.G & Sharples, G.J. (1993) Dissociation of synthetic

Holliday junctions by E. coli RecG prote in. EMBO J. 12,
17–22.
25. Mandal, T .N., Mahdi, A.A., Sharples, G.J & L loyd, R.G. (1993)
Resolution of Holliday intermediates in recombination and DNA
repair: indirect suppression of ruvA, ruvB and ruvC mutations.
J. Bacteriol. 17 5, 4325–4334.
26. Sharples, G.J., Chan, S.C., Mahdi, A.A., Whitby, M.C &
Lloyd, R.G. (1994 ) Processing of intermediates in recombination
and DNA repair: identific ation of a new endo nuclease that spe-
cifically cleaves Holliday junctions. EMBO J. 13, 6133–6142.
27. Mahdi, A.A., Sharples, G.J., Mandal, T.N & Lloyd, R.G.
(1996) Holliday junction resolvases encoded by homologous rusA
genes in Escherichi a coli K-12 and phage 82. J. Mol. Biol. 257,
561–573.
28. Han, Y W., Iwasaki, H., Miyata, T., Mayanagi, K., Yamada, K.,
Morikawa, K & S hinagawa, H. (2001) A unique b-hairpin pro-
truding from AAA
+
ATPase domain of RuvB motor protein is
involved in the interaction with RuvA DNA recognition protein
for branch migration of Holliday junctions. J. B iol. Chem. 276,
35024–35028.
29. Sargentini, N.J & Smith, K.C. (1989) Role of ruvAB genes in
UV- and c-radiation and chemical mutagenesis in Escherichia coli.
Mutation Res. 215, 115–129.
30. Himmelreich,R.,Hilbert,H.,Plagens,H.,Pirkl,E.,Li,B.C&
Herrmann, R. (1996) Complete sequence analysis of the genome
of the bacterium Mycoplasma pneumoniae. Nucleic Acids Res. 24,
4420–4449.
31. Sedelnikova, S.E., R afferty, J.B., Hargreaves, D., Mahdi, A.A.,

Lloyd, R.G & Rice, D .W. (1997) Crystallisation of E. coli RuvA
gives insight s i nto t he symmetry of a Ho lliday junction/protein
complex. Acta Crystallogr. D53, 122–124.
1532 R. G. Lloyd et al. (Eur. J. Biochem. 269) Ó FEBS 2002
32. Dunderdale, H.J., Sharples, G .J., Lloyd, R.G & West, S.C. (1994)
Cloning, overexpression, purification and characterization of the
Escherichia c oli RuvC Holliday junction resolvase. J. Biol. Chem.
269, 5187–5194.
33. Tsaneva, I.R., Illing, G.T., Lloyd, R.G & West, S.C. (1992)
Purification and physical properties o f the RuvA and RuvB pro-
teins of Escherichia coli. Mol. Gen. Genet. 235, 1–10.
34. Parsons, C.A., Kemper, B & West, S.C. (1990) Interaction of a
four-way junction in DNA with T4 endonuclease VII. J. Biol.
Chem. 265, 9285–9289.
35. Myszka, D.G., Jonsen, M.D & Graves, B.J. (1998) Equilibrium
analysis of high affinity interactions using BIAcore. Anal.
Biochem. 265, 326–330.
Ó FEBS 2002 Mycoplasma RuvA protein (Eur. J. Biochem. 269) 1533