Báo cáo Y học: Rum1, an inhibitor of cyclin-dependent kinase in fission yeast, is negatively regulated by mitogen-activated protein kinase-mediated phosphorylation at Ser and Thr residues pptx

Rum1, an inhibitor of cyclin-dependent kinase in fission yeast,
is negatively regulated by mitogen-activated protein kinase-mediated
phosphorylation at Ser and Thr residues
Kentaro Matsuoka
1,2
, Nobutaka Kiyokawa
1
, Tomoko Taguchi
1
, Jun Matsui
1
, Toyo Suzuki
1
, Kenichi Mimori
1
,
Hideki Nakajima
1
, Hisami Takenouchi
1
, Tang Weiran
1
, Yohko U. Katagiri
1
and Junichiro Fujimoto
1
1
Department of Pathology, National Children’s Medical Research Center, Tokyo, Japan;
2
Department of Pathology,
Keio University, School of Medicine, Tokyo, Japan

The p25
rum1
is an inhibitor of Cdc2 kinase expressed in fis-
sion yeast and plays an important role in cell-cycle control.
As its amino-acid sequence suggests that p25
rum1
has puta-
tive phosphorylation sites for mitogen-activated protein
kinase (MAPK), we investigated the ability of MAPK to
phosphorylate p25
rum1
.Directin vitro kinase assay using
GST-fusion proteins of wild-type as well as various mutants
of p25
rum1
demonstrated that MAPK phosphorylates the
N-terminal portion of p25
rum1
and residues Thr13 and Ser19
are major phosphorylation sites for MAPK. In addition,
phosphorylation of p25
rum1
by MAPK revealed markedly
reduced Cdc2 kinase inhibitor ability of the protein.
Together with the fact that replacement of both Thr13 and
Ser19 with Glu, which mimics the phosphorylated state of
these residues, also significantly reduces the activity of
p25
rum1
as a Cdc2 inhibitor, it was suggested that the phos-

phorylation of Thr13 and Ser19 negatively regulates the
function of p25
rum1
. Further evidence indicates that phos-
phorylation of Thr13 and Ser19 may retain a negative effect
on the function of p25
rum1
even in vivo. Therefore, MAPK
may regulate the function of p25
rum1
via phosphorylation of
its Thr and Ser residues and thus participate in cell cycle
control in fission yeast.
Keywords: cell cycle; Rum1; Cdc2; mitogen-activated pro-
tein kinase; phosphorylation.
The yeasts have been the favored organisms for investiga-
tion of the basic biology, genetics, and biochemistry of the
cell cycle [1]. Studies of the fission yeast Schizosaccharomy-
ces pombe have played an instrumental role in the discovery
of proteins that regulate the mitotic cycle. S. pombe appears
to be able to control its cell cycle with considerably fewer
components than are used by other eukaryotes, including
the budding yeast Saccharomyces cerevisiae. For example,
S. pombe relies on a single cyclin-dependent kinase (CDK),
Cdc2, to coordinate its mitotic cell-cycle events. Only four
cyclins, Cdc13, Cig1, Cig2, and Puc1, and only one CDK
inhibitor (CKI), namely p25
rum1
, have been identified in
S. pombe [1]. Therefore, S. pombe is considered to provide a

simple model of cell-cycle regulation.
CDKs are undoubtedly key molecules in cell-cycle
progression in virtually all eukaryotes, including fission
yeast, and are required for the G
1
–S transition as well as for
initiation of mitosis [2–4]. To control the cell-cycle process,
however, CDK activities must be regulated appropriately,
kept low during those phases of the cell cycle when they are
not required and only increase when they are needed to
bring about cell-cycle progression. Therefore, a mechanism
tightly regulating their activities during the cell cycle must be
present.
In S. pombe, the activity of Cdc2 is regulated positively
and negatively by at least three kinds of biochemical
events. First, Cdc2 must associate with B-type cyclin to
display its kinase activity. It was reported that Cdc2-Cdc13
is the mitotic kinase [5,6] while Cdc2-Cig2 promotes the
G
1
–S transition (G
1
–S kinase) [7–9]. The Cdc2–Cig1
complex is suggested to also contribute to the G
1
–S
transition because a cdc13Dcig2D double mutant can still
go through S phase while the cdc13Dcig2Dcig1D triple
mutant cannot [9,10]. It is noteworthy that these B-type
cyclins are strictly regulated in terms of protein amounts

during cell cycling by transcription and ubiquitin-mediated
proteolysis [11]. Second, the kinase activity of Cdc2 is also
regulated by the phosphorylation state of specific amino-
acid residues. In S. pombe, the phosphorylations at Tyr15
and Thr167 residues of Cdc2 regulate its kinase activity
negatively and positively, respectively. The phosphoryla-
tion of Tyr15 is regulated by a combination of protein
kinases, Wee1 and Mik1, and protein phosphatase, Cdc25,
whereas the regulatory mechanism of Thr167 is largely
unknown [12–16]. In addition to the above biochemical
events, CKI also plays an important role in the regulation
of CDK activity [1].
p25
rum1
, the only known CKI in S. pombe, was originally
isolated by Moreno & Nurse in a screen for genes that, when
Correspondence to N. Kiyokawa, Department of Pathology,
National Children’s Medical Research Center, 3-35-31, Taishido,
Setagaya-ku, Tokyo 154-8567, Japan. Fax/Tel.: + 81 3 3487 9669,
E-mail:
Abbreviations: CDK, cyclin-dependent kinase; CKI, CDK inhibitor;
MAPK, mitogen-activated protein kinase; MAP3K, MAPK kinase
kinase; MAP2K, MAPK kinase; ERK, extracellular signal-regulated
kinase; JNK, c-Jun amino-terminal kinase; GST, glutathione-
S-transferase; EMM, Edinburgh minimal medium; YES, yeast extract
+ supplements; PI, propidium iodide.
(Received 26 February 2002, revised 8 May 2002,
accepted 31 May 2002)
Eur. J. Biochem. 269, 3511–3521 (2002) Ó FEBS 2002 doi:10.1046/j.1432-1033.2002.03033.x
overproduced, would induce extra rounds of DNA replica-

tion [17]. The over-replication can be extensive, with cells
having more than 16 times the normal complement of
DNA, thus earning rum1 its name (replication uncoupled
from mitosis). Direct in vitro assays have demonstrated that
p25
rum1
is an effective inhibitor of Cdc2–Cdc13 and Cdc2–
Cig2, but not Cdc2–Cig1 [18–20]. The p25
rum1
begins to
accumulate at anaphase, persists in G
1
and is destroyed
during S phase [20]. This molecule is thought to play a
central role in maintenance of the G
1
phase by regulating
CDK activity [17–19,21]. By inhibiting G
1
–S kinase activity,
p25
rum1
determines the cell-cycle timing of the G
1
–S
transition (Start), maintaining cells in the pre-Start state
until they have attained the minimal critical mass required
to initiate the cell cycle. In addition, it would stabilize Cdc18
and promote S-phase initiation [22]. As a consequence, this
molecule determines the length of the G

1
phase interval. By
inhibiting mitotic CDK activity, p25
rum1
also prevents the
premature-onset of mitosis in cells that have not initiated
DNA replication [17].
Although a number of studies have clarified the function
and regulatory mechanism of p25
rum1
[17–30], details
remain unclear. For example, the amino acid sequence of
p25
rum1
has revealed the presence of five putative phos-
phorylation sites for mitogen-activated protein kinase
(MAPK), i.e. Thr5, Thr13, Thr16, Ser19, and Thr58 [17],
while the precise roles of these sites are largely unknown.
Whether these sites are indeed phosphorylated by MAPK,
and have any functional importance in regulating p25
rum1
activity, has not yet been determined.
MAPK is a central component of the evolutionarily
conserved growth-promoting signaling pathway. The
MAPK cascade, which transmits extracellular signals from
cell surface receptors to nuclear transcription factors [31],
consists of a module of three sequentially activated protein
kinases, namely, MAPK kinase kinase (MAP3K), MAPK
kinase (MAP2K), and MAPK. The extracellular signals
are mediated intracellularly as an activation of MAP3K

that further activates MAP2K by phosphorylating specific
Ser and Thr residues on it. The activated MAP2K then
phosphorylates specific Thr and Tyr residues on MAPK,
leading to the activation of this kinase. Once activated,
MAPK not only phosphorylates its cytoplasmic targets but
also promotes their nuclear translocation and subsequent
modulation of transcriptional factors resulting in stimulus-
dependent alterations in gene expression. In many mam-
malian cells, three distinct classes of MAPK families,
including the extracellular signal-regulated kinase (ERK)
family, c-Jun N-terminal kinase (JNK) family, and the p38
MAPK family, have been identified. In the case of fission
yeast, MAPK Sty1/Spc1 is found to be highly related to
the p38 MAPKs [32,33]. Although it is well documented
that MAPKs are important in cell growth and prolifer-
ation of eukaryotic cells, how stimulation of MAPKs
culminates in cell-cycle progression is still poorly under-
stood.
In an attempt to clarify the functional correlation
between MAPK and p25
rum1
in cell-cycle regulation, we
generated and examined a series of recombinant p25
rum1
proteins containing various mutations in their putative
MAPK phophsorylation sites. Here, we show that MAPK
can phosphorylate p25
rum1
leading to suppression of the
activity of this molecule as a CKI in vitro.Wefurther

demonstrate the possibility that this regulatory mechanism
of p25
rum1
also plays a role in vivo.
MATERIALS AND METHODS
Materials
The 796-bp fragment of rum1 cDNA (nucleotides 107–902)
was amplified by PCR from cDNA prepared from S. pombe
(Library-in-a-Tube
TM
S. pombe, log phase, BIO 101, Inc.,
Vista, CA, USA) using the primers, 5¢-GTTTTTGG
ATTGTCAGTTCG-3¢ (sense) and 5¢-CATGAATAAGG
CAGAAGAGT-3¢ (antisense). PCR was performed using
high-fidelity UlTma
TM
DNA polymerase (PerkinElmer Co.,
Foster City, LA, USA). The PCR product was subcloned
into the EcoRV site of pGEMÒ-5zf(+) vector (Promega,
Madison, WI, USA). The obtained cDNA was sequenced
and used as a template for PCR in the following experi-
ments. Enzymes used for molecular biological manipulation
were obtained from New England Biolabs, Inc. (New
EnglandBiolabs,Bevery,MA,USA).Allchemicalreagents
were obtained from Sigma–Aldrich Fine Chemicals (St
Louis, MO, USA), unless otherwise indicated.
Plasmid construction
All plasmids generated and used in this study are listed in
Table 1. Oligonucleotides used for PCR primers were as
follows: antisense primer 5¢-GTGATTG

ATCATTTAT
ATAAACGGTAT-3¢ (carries a BclIsite);DN2-sense
primer, 5¢-TCGCTA
GGATCCCTTCAACACCACCTA
3¢; DN13–sense primer, 5¢-GGTTGTG
GATCCCATCTA
CCCCAGAGTCTCCT-3¢; DN16-sense primer, 5¢-CTCC
AT
GGATCCCAGAGTCTCCTGGGAGTT-3¢; DN41-
sense primer, 5¢-TAGATG
GGATCCCTGAAAGCGAT
TTACC-3¢. Each sense primer carries a BamHI site. The
underlined nucleotides contain the mutated sequence for
generating restriction sites. To generate a pGEX-rum1-
DN2 plasmid, rum1 cDNA fragments (nucleotides 124–
Table 1. Plasmid list.
pGEX-rum1-WT (DN2)
pGEX-rum1-DN13
pGEX-rum1-DN16
pGEX-rum1-DN41
pGEX-rum1-DN74
pGEX-rum1-DC52
pGEX-rum1-DC81
pGEX-rum1-DC102
pGEX-rum1-DC130
pGEX-rum1-5A
pGEX-rum1-13A
pGEX-rum1-16A
pGEX-rum1-19A
pGEX-rum1-58A

pGEX-rum1-13A16A
pGEX-rum1-13A19A
pGEX-rum1-16A19A
pGEX-rum1-13A16A19A
pGEX-rum1-13E19E
pESP-rum1-WT (DN2)
pESP-rum1-13E19E
3512 K. Matsuoka et al. (Eur. J. Biochem. 269) Ó FEBS 2002
877) were amplified by PCR using the antisense primer
and DN2-sense primer. A 741-bp BamHI and blunt-ended
BclI fragment of the cDNA that corresponding to amino
acids 3–230 of p25
rum1
was excised and subcloned into
pGEX-3X bacterial expression vector (Pharmacia Biotech,
Uppsala, Sweden) at BamHI and blunt-ended EcoRI
sites. The consequent pGEX-rum1-D2 vector was desig-
nated wild type vector in this study for convenience. To
generate rum1 mutants containing different N-terminal
deletions, rum1 cDNA fragments were amplified by PCR
using the antisense primer and eitherDN13-sense (nucleo-
tides 157–877), DN16-sense (nucleotides 166–877), or
DN41-sense primer (nucleotides 244–877). The BamHI
and EcoRI fragments (493 bp, 484 bp, and 406 bp,
respectively) were excised from the PCR products and
were subcloned into a pGEX-rum1-WT vector at BamHI
and EcoRI sites. The consequent plasmids were designa-
ted pGEX-rum1-DN13, -DN16, and -DN41 corresponding
to amino acids 14–230, 17–230, and 42–230 of p25
rum1

,
respectively. To generate a pGEX-rum1-DN74 vector, a
310-bp blunt-ended NdeII and EcoRI fragment was
excised from the rum1 cDNA and subcloned into a
pGEX-rum1-WT vector at blunt-ended BamHI and
EcoRI sites. Consequent plasmid is correspond to amino
acids 75–230 of p25
rum1
.Togeneraterum1 mutants
containing different C-terminal deletions, BamHI and
either EcoRI, blunt-ended NarI, XmnI, or AluIfragments
(526 bp, 445 bp, 383 bp, and 298 bp, respectively) were
excised from the PCR products amplified with antisense
and DN2-sense primers and were subcloned into a
pGEX-3X vector at BamHI and (blunt-ended) EcoRI
sites. The consequent plasmids were designated pGEX-
rum1-DC52, -DC81, -DC102, and -DC130 corresponding
to amino acids 3–178, 3–149, 3–128, and 3–100 of
p25
rum1
, respectively. All plasmids described above were
sequenced after the construction.
The pGEX-rum1-WT plasmid was used to generate
different rum1 mutants by site-directed mutagenesis using
the Transformer
TM
Site-Directed Mutagenesis kit (Clontech
Laboratories, Inc., Palo Alto, CA, USA) and the following
oligonucleotides: 5A, 5¢-GGTCGTGGGATCCCTTCA
G

CACCACCTATGCGAGGG-3¢; 13A, 5¢-GCGAGGGTT
GTGT
GCTCCATCTACCCCAGAGTCTCCTGGG-3¢;
16A, 5¢-GGGTTGTGTACTCCATCT
GCCCCAGAGTC
TCCTGGG-3¢; 19A, 5¢-CTACCCCAGAG
GCTCCTGG
GAG-3¢;58A,5¢-GCACATTTCCACCT
GCACCTGCT
AAAACTCCC-3¢;13A19A,5¢-GCGAGGGTTGTGT
G
CTCCATCTACCCCAGAG
GCTCCTGGG-3¢; 13E19E,
5¢-CACCACCTATGCGAGGGTTGTGT
GAGCCATC
TACCCCAGAG
GAGCCTGGGAGTTTTAAAG-3¢.
The underlined nucleotides contain the mutated sequence.
All mutants were sequenced after the mutagenesis.
To generate a glutathione S-transferase (GST)-fusion
protein expression vector for fission yeast, a BamHI and
blunt-ended BclI fragment was excised from either pGEX-
rum1-WT or -E13E19 and subcloned into pESP-1 (Strata-
gene Cloning Systems, La Jolla, CA, USA) at BamHI and
SmaI sites. To obtain an in-frame sequence between GST
and rum1 genes, subsequent plasmids were digested with
BamHI and re-ligated after blunt-ending with klenow DNA
polymerase. The consequent plasmids were designated
pESP-rum1-WT and -E13E19, respectively, and were
sequenced after construction.

Generation and purification of GST fusion proteins
of p25
rum1
E. coli strain BL21 (Riken Gene Bank, Ibaragi, Japan) was
transformed with the resulting pGEX plasmids, cultured in
Luria–Bertani broth with 50 mgÆL
)1
of ampicillin at 25 °C,
andinducedfor3hwith0.1m
M
isopropyl thio-b-
D
-galactoside. Subsequent purification of GST fusion
proteins on glutathione–Sepharose was performed as des-
cribed previously [34]. The GST fusion proteins bound to
glutathione–SepharoseÒ4B (Pharmacia) were eluted by
10 m
M
of reduced form of glutathione and subsequent
protein concentration was measured by Bradford method
using Bio-Rad protein assay kit (Bio-Rad Laboratories,
Hercules, CA, USA). Purified GST fusion proteins were
separated on a 10% SDS/polyacrylamide gel and stained
with Coomassie Blue.
In vitro
kinase assay
In this study, mainly two types of in vitro kinase assay were
performed. First, we examined whether MAPK phosphory-
lates p25
rum1

by in vitro kinase assay. GST-p25
rum1
fusion
proteins were bound on glutathione–SepharoseÒ4B. After
intensive washing with NaCl/P
i
and kinase assay buffer
(50 m
M
Tris/HCl, pH 7.5, 10 m
M
MgCl
2
,1m
M
dithiothre-
itol, 1 m
M
EGTA, 100 l
M
ATP), the precipitates were
mixed with 100 ng of either purified sea star Pisaster
ochraceus oocyte MAPK, p44
mpk
(Seikagaku Co., Tokyo,
Japan) or recombinant murine Erk2 prepared from E. coli
(New England Biolabs) and incubated for 15 min at room
temperature in 30 lL of kinase assay buffer with 10 lCi of
[c-
32

P]ATP (specific activity > 3000 CiÆm
M
)1
; NEN Life
Science Products, Inc., Boston, MA, USA). Subsequent
specific activity of ATP in the assays was 90.8 c.p.m.Æp-
mol
)1
. Reactions were stopped by adding 6 lLof6· SDS-
sample loading buffer [350 m
M
Tris/HCl, pH 6.8, 600 m
M
dithiothreitol, 36% glycerol, 350 m
M
SDS, 0.012% (w/v)
Bromophenol Blue]. After separation on a 10% SDS/
PAGE gel, phosphorylated proteins were visualized with
autoradiography as described previously [35]. As positive
and negative controls for MAPK activity, Histone H1 (5 lg
per test) and GST were used as substrates, respectively.
Second, the inhibitory effect of p25
rum1
on Cdc2 kinase
activity was also tested by in vitro kinase assay. The kinase
activity of 25 ng of either Cdc2 complex purified from sea
star P. ochraceus oocytes (Upstate biotechnology, Lake
Placid, NY, USA) or the recombinant human Cdc2/cyclin
B complex (prepared from Spondoptera frugiperda sf9 cells
using baculovirus system, New England Biolabs) was

examined using histone H1 as a substrate in 30 lLof
kinase assay buffer with 10 lCi of [c-
32
P] ATP, essentially as
described above. To test the effects on phosphorylation
activity of Cdc2 kinase against Histone H1, GST-fusion
proteins of wild-type and various mutants of p25
rum1
purified on glutathione–SepharoseÒ4B were added to each
kinase reaction mixture. As a negative control not affecting
Cdc2 kinase activity, GST was also tested.
To test whether phosphorylation of p25
rum1
affects
electrophoretic mobility and the activity as a Cdc2 kinase
inhibitor of this protein, GST–p25
rum1
proteins bound on
glutathione–SepharoseÒ4B were nonisotopically phos-
phorylated by MAPK as described above with an exception
Ó FEBS 2002 MAP kinase negatively regulates Rum1 (Eur. J. Biochem. 269) 3513
of the absence of [c-
32
P]ATP. After intensive washing,
nonisotopically prephosphorylated GST–p25
rum1
were used
for following SDS/PAGE and Cdc2 kinase assays.
Binding of GST–p25
rum1

to the Cdc2–cyclin B complex
Either untreated or prephosphorylated GST-p25
rum1
pro-
teins bound on glutathione–SepharoseÒ4B were incubated
with 50 ng of Cdc2-cyclin B complex of human origin in
50 lLofNaCl/P
i
for 1 h at 4 °C. After intensive washing
with NaCl/P
i
, proteins bound on sepharose beads were
separated by SDS/PAGE and were transferred to a nitro-
cellulose membrane. Immunoblotting assay was performed
as described previously [35] using monoclonal anti-Cdc2 Ig
(Santa Cruz Biotechnology, Santa Cruz, CA, USA).
Expression of GST–p25
rum1
in
S. pombe
The expression of GST–p25
rum1
in S. pombe was induced
using an ESP
TM
Yeast Protein Expression System (Strata-
gene) according to the manufacturer’s protocol. Briefly,
p25
rum1
expression vectors, either pESP-rum1-WT or

-E13E19, were transformed into SP-Q01 S. pombe cells
using a YEASTMAKER
TM
Yeast Transformation System
(Clontech Laboratories, Inc., Palo Alto, CA, USA). After
being grown on Edinburgh minimal medium (EMM) agar
supplemented with thiamine at 30 °C, positive clones were
selected by PCR using specific primers for the pESP vector
(Stratagene); sense, 5¢-GTACTTGAAATCCAGCAAGT
ATATAGC-3¢;antisense,5¢-CAAAATCGTAATATGCA
GCTTGAATGGGCTTCC-3¢. The selected positive colony
was grown in yeast extract plus supplements (YES) medium
to D
600
¼ 1.0 at 30 °C. After intensive washing in H
2
O,
yeast cells were further cultured in EMM broth without
thiamine at 30 °C for 24 h to induce the expression of GST
fusion proteins of either the p25
rum1
-WT or the -E13E19
mutant.
To determine DNA contents, 1 · 10
7
cells were harvested
andwashedwithH
2
O. After fixation in 70% ethanol, cells
were stained with propidium iodide and analyzed by flow

cytometry (EPICS XL, Beckman Coulter, Inc., Westbrook,
MA, USA). To determine the expression of GST-fusion
proteins, protein extracts were prepared using Y-PER
TM
Fig. 1. MAPK phosphorylates the N-terminal portion of p25
rum1
.
(A) GST fusion proteins of wild-type (WT) (lane 3) and the DN74
deletion mutant, lacking 74 N-terminal amino acids (lane 2), of p25
rum1
were produced in E. coli. After purification with glutathione–
Sepharose, a 1.8-lg sample of each protein was separated by SDS/
PAGE in 10% acrylamide gel and visualized with Coomassie Blue-
staining. Purified GST proteins (GST, lane 4) were also examined. The
molecular mass standards are presented in lane 1. (B) GST fusion
proteins shown in (A) are schematically presented. In the DN74
mutant, all of the putative Ser or Thr phosphorylation residues for
MAPK, Thr5, Thr13, Thr16, Ser19, and Thr58, are deleted. Shaded
box represents GST. (C) Using GST fusion proteins shown in (A) as
substrates (lanes 2,3), an in vitro kinase assay was performed with
MAPK purified from sea star oocytes as described in Materials and
methods. GST protein (lane 4) and Histone H1 (lane 5) were also
examined as negative and positive control substrates, respectively. In
each kinase assay, the same amounts of GST and GST fusion proteins
as presented in (A) were examined.
3514 K. Matsuoka et al. (Eur. J. Biochem. 269) Ó FEBS 2002
(Yeast Protein Extraction Reagent, PIERCE, Rockford, IL,
USA). Fifty-microgram samples of each protein extract were
applied for electrophoretic separation by SDS/PAGE, and
Western immunoblotting was performed using rabbit poly-

clonal anti-GST antibody (Boeringer Manheim Biochemica,
Manheim, Germany) as described previously [35].
RESULTS
In vitro
phosphorylation of p25
rum1
by MAPK
As putative phosphorylation sites for MAPK were found in
the amino acid sequence of p25
rum1
[17], we first examined
whether MAPK can phosphorylate p25
rum1
in vitro by
generating GST fusion proteins of p25
rum1
. When recom-
binant GST-fusion p25
rum1
-WT prepared from E. coli
(Fig. 1A) was incubated with MAPK purified from sea
star oocytes in the presence of
32
P-labeled ATP, apparent
incorporation of
32
P into GST–p25
rum1
was observed
(Fig. 1C). We also similarly used recombinant murine

MAPK and obtained identical results. Given that GST
protein itself was not labeled with
32
P under the same
conditions (Fig. 1C), it is obvious that MAPK phosphory-
lates p25
rum1
-WT in vitro.
The amino acid sequence data suggested that putative
phosphorylation sites of p25
rum1
, Thr5, Thr13, Thr16,
Ser19, and Thr58, are clustered in the N-terminal portion.
We then tested whether an actual phosphorylation site(s) by
MAPK is present in the N-terminal portion of p25
rum1
.To
test this, we generated a GST-fusion deletion mutant of
p25
rum1
lacking 74 amino acids from the N-terminus (DN74,
Fig. 1B). As shown in Fig. 1C, in vitro kinase assay revealed
that MAPK cannot translocate
32
PintoDN74 mutants,
indicating that the MAPK phosphorylation site(s) is indeed
located in the N-terminal portion of p25
rum1
protein within
amino acids 3–74.

N-Terminal deletion does not influence the activity
of p25
rum1
as a Cdc2 kinase inhibitor
The p25
rum1
protein is known to inhibit the kinase activity
of a complex of Cdc2 and B type cyclin and thereby regulate
the cell cycle of fission yeast. Consistently, GST fusion
p25
rum1
-WT effectively inhibited the phosphorylation of
histone H1 mediated by a Cdc2 kinase complex purified
from sea star oocytes in vitro (Fig. 2, lane 2) and
32
P
incorporation into histone H1 was reduced to less than 30%
of that in the absence of p25
rum1
-WT, as assessed by
Fig. 2. Inhibition of Cdc2 kinase activity by
GST fusion proteins of p25
rum1
. (A) GST
fusion proteins of various C-terminal deletion
mutants of p25
rum1
, as indicated, were gener-
ated and examined by SDS/PAGE essentially
as in Fig. 1A. (B) GST fusion proteins shown

in (A) are schematically presented together
with the DN74 mutant. (C) Inhibitory effects
of GST–p25
rum1
fusion proteins on Cdc2
kinase activity were examined by in vitro kin-
ase assay. The transphosphorylation activity
of Cdc2 kinase complex purified from sea star
oocytes toward histone H1 was examined in
thepresenceorabsence(lane8)ofGSTfusion
proteins of wild-type (lane 2) and C- and
N-terminal deletion mutants (lanes 1, 3–6) of
p25
rum1
, as indicated. In lane 7, GST protein
was tested as a negative control. In each assay,
the same amounts of GST fusion proteins as
presented in (A) were examined. (D) Subse-
quent phosphorylation of histone H1 in each
experiment was quantified by densitometry
and expressed as a percentage of that treated
with Cdc2 kinase alone (lane 8). The
mean + SD numbers obtained from three
independent experiments were presented.
Ó FEBS 2002 MAP kinase negatively regulates Rum1 (Eur. J. Biochem. 269) 3515
densitometry. We also similarly used recombinant human
Cdc2–cyclin B complex and obtained identical results.
When GST–p25
rum1
-DN74 protein was similarly examined,

inhibition of Cdc2 kinase activity comparable to that of
p25
rum1
-WT was observed (Fig. 2C,D, compare lanes 1 and
2). In contrast, a C-terminal deletion induced apparent loss
of the activity of p25
rum1
as a Cdc2 kinase inhibitor. As
shown in Fig. 2C,D, functional reduction of p25
rum1
depends on the length of C-terminal deletion and longer
deletions yielded greater recovery of the phosphorylation of
histone H1 mediated by Cdc2 kinase in an in vitro kinase
assay. These data indicate that the catalytic domain of
p25
rum1
is located in its C-terminal portion and deletion
of 74 N-terminal amino acids does not affect the activity of
p25
rum1
as an inhibitor of Cdc2 kinase.
Effect of N-terminal phosphorylation
on p25
rum1
function
Although an N-terminal deletion does not directly affect the
Cdc2 kinase inhibitor function of p25
rum1
, it is possible that
the N-terminal portion contributes to functional regulation

of this protein upon phosphorylation. Therefore, we next
examined whether N-terminal phosphorylation of p25
rum1
mediated by MAPK affects the activity of this protein as a
Cdc2 kinase inhibitor. We thus prepared the phosphory-
lated GST–p25
rum1
-WT by combining MAPK and noniso-
topic ATP. In contrast to theuntreated case (Fig. 3A, lane 1),
the same amount of prephosphorylated p25
rum1
-WT failed
to inhibit the Cdc2 kinase activity (Fig. 3A, lane 2) and
incorporation of
32
P into histone H1 comparable to that
achieved in the absence of p25
rum1
-WT (Fig. 3A, lane 4) was
observed. As prephosphorylated GST–p25
rum1
itself did not
show apparent transphosphorylation activity towards his-
tone H1 (Fig. 3A, lane 3), recovery of the
32
P translocation
into histone H1 being mediated by MAPK, possibly
contaminating in the process of p25
rum1
prephosphoryla-

tion, could be ruled out. In contrast, pretreatment with a
combination of MAPK and nonisotopic ATP did not affect
the activity of GST–p25
rum1
-DN74proteinsasaCdc2
kinase inhibitor (Fig. 3B). Therefore, the data indicate that
N-terminal phosphorylation of p25
rum1
indeed reduces the
Cdc2 kinase inhibitor activity of this protein.
Determination of the MAPK-mediated phosphorylation
sites in p25
rum1
In the experiment presented in Fig. 1,  60 pmol phosphate
were incorporated in 35 pmols p25
rum1
, suggesting the
presence of two phosphorylation sites for MAPK in the
molecule. Next we determined which Ser and Thr residues
in p25
rum1
are responsible for MAPK-mediated phosphory-
lation. To test this, we first generated various N-terminal
deletion mutants of p25
rum1
as indicated in Table 1, and
examined
32
P incorporation into these mutants mediated by
MAPK. The DN41 mutant showed almost no

32
P incor-
poration, whereas the DN16 mutant showed an  50%
reduction of phosphorylation (data not shown), suggesting
that Ser19 is a MAPK phosphorylation site. In contrast, the
DN13 mutant showed almost equivalent
32
P incorporation
in comparison with that of DN16 (data not shown),
suggesting that another MAPK phosphorylation site is
Thr5 or Thr13. We further determined the MAPK-medi-
ated phosphorylation sites in p25
rum1
by generating amino-
acid point mutants of wild-type in which each Ser and Thr
residue was replaced with Ala. Consistent with the data
obtained using the N-terminal deletion mutants, A16 or
A58 mutants in which Thr16 or Thr58 were replaced with
Ala showed no reduction in
32
P incorporation after kinase
assay with MAPK (data not shown). In addition, there was
no significant reduction in
32
P incorporation mediated by
MAPK with the A5 mutant in which Thr5 were replaced
with Ala as compared with that of wild-type (data not
shown). Therefore, it was suggested that Thr5, Thr16, and
Thr58 are not responsible for MAPK-mediated phosphory-
lation. In contrast, the A13 and A19 mutants in which

Thr13 and Ser19 were replaced with Ala, respectively, both
showed an  50% reduction of
32
P incorporation as
compared with that of wild-type (Fig. 4A,B), indicating
that these two amino-acid residues are major phosphoryl-
ation sites in p25
rum1
mediated by MAPK. To confirm this,
we generated an A13A19 mutant (Fig. 4C) in which both
Thr13 and Ser19 were replaced with Ala (Fig. 4D), and
found that this mutant showed only a faint incorporation of
32
PmediatedbyMAPK(Fig.4E).Basedonthesedata,
Thr13 and Ser19 were assumed to be major MAPK-
mediated phosphorylation sites in p25
rum1
.
Fig. 3. Functional modulation of p25
rum1
by MAPK-mediated phos-
phorylation. (A) The same amounts of GST–p25
rum1
-WT proteins were
nonisotopically phosphorylated (P, lanes 2 and 3) or not phosphory-
lated (lane 1) by MAPK prior to the assay. Cdc2 kinase activity against
histone H1 was examined by in vitro kinase assay in the presence or
absence (lane 4) of either untreated (lane 1) or prephosphorylated (lane
2) GST–p25
rum1

proteins and consequent inhibition of Cdc2 kinase
activity was compared. In lane 3, the background phosphorylation
level in the absence of Cdc2 kinase of prephosphorylated GST-p25
rum1
added to lane 2 was examined. (B) GST fusion proteins of the DN74
mutant were similarly examined as in (A).
3516 K. Matsuoka et al. (Eur. J. Biochem. 269) Ó FEBS 2002
Effect of Glu13/Glu19 mutation on the function
of p25
rum1
It has been well documented in some proteins that
replacement of Ser and Thr residues with Glu mimics the
conformational and functional changes of the proteins
mediated by phosphorylation at these residues. To test
whether phosphorylation of Thr13/Ser19 does indeed lead
to inactivation of p25
rum1
function, we generated a GST–
E13E19 mutant of p25
rum1
in which both Thr13 and Ser19
are replaced with Glu. When the GST–E13E19 mutant was
examined by SDS/PAGE, it exhibited retardation of
electrophoretic mobility as compared with that of GST–
p25
rum1
-WT (Fig. 5A). It was reported that phosphoryl-
ation of protein leads to an electrophoretic mobility change
in many cases [35]. Indeed, GST–p25
rum1

-WT prephos-
phorylated by MAPK had a mobility shift on SDS/PAGE
gel similar to that observed for the GST–E13E19 mutant
(Fig. 5A). In contrast, pretreatment with a combination of
MAPK and nonisotopic ATP did not affect the electropho-
retic mobility of GST–p25
rum1
-D74 that lacks N-terminal
portion (Fig. 5C). Considering the above, it is most likely
that replacement of Thr13 and Ser19 with Glu mimics the
change in electrophoretic mobility of p25
rum1
mediated by
phosphorylation at Thr13/Ser19.
Next, we examined whether Glu13/Glu19 mutation alters
the function of p25
rum1
as a Cdc2 kinase inhibitor using an
in vitro kinase assay. In comparison with the significant
inhibition achieved by wild-type, the E13E19 mutant
showed only a limited inhibition of the
32
P translocation
in histone H1 mediated by Cdc2 kinase (Fig. 5D). As shown
in Fig. 5D, wild-type was sufficient to inhibit Cdc2 kinase
activity even at lower concentration, whereas E13E19
mutant presented a weak inhibition of Cdc2 kinase activity
only at higher concentration, indicating that replacement of
Thr13/Ser19 with Glu inactivates the function of p25
rum1

.
The data strongly suggest that phosphorylation of Thr13/
Ser19 blocks the activity of p25
rum1
as a Cdc2 inhibitor.
As it was reported previously, p25
rum1
interacts with the
complex of Cdc2 and B type cyclin and thus inhibits the
Cdc2 kinase activity. Therefore we tested whether MAPK-
mediated phosphorylation of p25
rum1
prevents this interac-
tion with Cdc2 kinase complex and hence abolishes the
activity of p25
rum1
as a Cdc2 kinase inhibitor. As shown in
Fig. 5E, untreated GST–p25
rum1
protein could bind with
Cdc2–cyclin B complex. However, when phosphorylated
Fig. 4. Phosphorylation of wild-type and
A13A19 mutant of p25
rum1
by MAPK.
(A) GST fusion proteins of wild-type (WT)
(lanes 1 and 3), the A13 deletion mutant
(lane 2), and the A19 mutant (lane 4) of
p25
rum1

were examined as in Fig. 1A,C (upper
panels and lower panels, respectively).
(B) Subsequent phosphorylation of GST
fusion proteins in each experiment was
quantified and expressed as a percentage of
wild-type proteins as in Fig. 2D. (C) GST
fusion proteins of wild-type (lane 1) and the
A13A19 mutant (lane 2) of p25
rum1
were
generated and examined by SDS/PAGE,
essentially as in Fig. 1A. (D) The GST fusion
proteins are schematically presented. In the
A13A19 mutant of p25
rum1
(lane 2), both the
Thr13 and the Ser19 residues of the WT were
replaced with Ala. (E) Phosphorylation activ-
ities of MAPK against GST-fusion proteins of
either the wild-type (lane 1) or the A13A19
mutant of p25
rum1
(lane 2) were examined as in
Fig. 1(C).
Ó FEBS 2002 MAP kinase negatively regulates Rum1 (Eur. J. Biochem. 269) 3517
GST–p25
rum1
was similarly tested, no reduction of the
binding between p25
rum1

and Cdc2 was observed (Fig. 5E).
We also tested the E13E19 mutant and observed that its
binding to Cdc2–cyclin B complex is comparable to that of
wild-type (data not shown).
All of the above data were obtained from in vitro studies.
Therefore, we next examined whether the Glu13/Glu19
mutation inactivated p25
rum1
function in yeast cells. It was
reported that overexpression of p25
rum1
induces massive
over-replication in S. pombe, thereby leading to elongation
of the cells as well as an increase in DNA content [17].
Consistent with the previous report, GST–p25
rum1
induced
a massive increase in DNA content and cell elongation upon
expression in S. pombe, as assessed by flow cytometry and
microscopic observation, respectively (Fig. 6A). The data
indicate that p25
rum1
retains its function in yeast cells even in
the form of GST-fusion protein. When the GST-E13E19
mutant was expressed in S. pombe, however, no significant
change in either DNA content or cell size was observed
(Fig. 6A). As immunoblot analysis revealed a level of
protein expression of the GST–E13E19 mutant comparable
to that of GST–p25
rum1

, it is suggested that the GST–
E13E19 mutant did not function as a Cdc2 kinase inhibitor
in yeast cells.
DISCUSSION
Our data clearly indicate that p25
rum1
is a potent substrate
for MAPK. In vitro experiments also revealed that
MAPK mediated phosphorylation negatively regulates the
activity of p25
rum1
as a Cdc2 inhibitor. Direct in vitro kinase
assay using GST fusion proteins of wild type as well as
various mutants of p25
rum1
demonstrated that residues
Thr13/Ser19 are major phosphorylation sites for MAPK.
Since the weak but visible phosphorylation of A13A19
mutant by MAPK was observed (Fig. 4E), the other Ser or
Thr residue(s) might also be involved in the phosphorylation
by MAPK. However, Glu13/Glu19 mutation (E13E19
mutant), which mimics the phosphorylated state of Thr13/
Ser19, significantly abolishes p25
rum1
function in in vitro,itis
suggested that residues Thr13/Ser19 are essential for
phosphorylation-mediated inactivation of the protein by
MAPK. Given that E13E19 mutant also abolishes p25
rum1
function in yeast cells, it is most likely that the Thr13/Ser19

phosphorylation negatively regulates p25
rum1
activity even
in vivo. We also found that C-terminal deletion inhibits the
p25
rum1
activity of Cdc2 kinase inhibitor, whereas
N-terminal deletion, including Thr13/Ser19, does not.
Therefore, we speculate that the C-terminal portion of
Fig. 5. Effect of E13E19 mutant of p25
rum1
on
Cdc2 kinase activity. (A) GST fusion proteins
of wild-type (WT) (lane 1) and the E13E19
mutant (lane 3) of p25
rum1
were generated and
examined by SDS/PAGE, essentially as in
Fig. 1A. Simultaneously, WT nonisotopically
prephosphorylated by MAPK was also
examined (lane 2). (B) The GST fusion
proteins are schematically presented. In lane 2,
wild-type was prephosphorylated at both
Thr13 and Ser19 by MAPK. In the E13E19
mutant (lane 3), both Thr13 and Ser19 were
replaced with Glu. (C) Both untreated (lane 1)
and prephosphorylated (lane 2) GST fusion
proteins of the DN74 mutant were examined
as in (A). (D) Cdc2 kinase activity against
Histone H1 was examined by in vitro kinase

assay in the presence or absence (lane 7) of
different concentrations (lanes 1 and 4,
0.45 lg; lanes 2 and 5, 0.9 lg; lanes 3 and 6,
1.8 lg) of wild-type (lanes 1–3) and the
E13E19 mutant (lanes 4–6) proteins. (E)
Either untreated (lane 4) or prephosphoryl-
ated (lane 5) GST–p25
rum1
immobilized on the
glutathion–Sepharose beads were incubated
with Cdc2-cyclin B complex. The Cdc2 pro-
teins bound to GST p25
rum1
were detected by
immunoblotting as described in Materials and
methods. As negative controls for coprecipi-
tation, GST proteins were similarly examined
(lanes 2 and 3). As a positive control for im-
munoblotting, Cdc2–cyclin B complex was
appliedinlane1(CNT).
3518 K. Matsuoka et al. (Eur. J. Biochem. 269) Ó FEBS 2002
p25
rum1
is a catalytic domain of the protein while the
N-terminal portion is a regulatory domain mediating a
reduction in activity upon phosphorylation of Thr13/Ser19
by MAPK.
At this moment, the precise mechanism of negative
regulation of the function of p25
rum1

that induced by Thr13/
Ser19 phosphorylation is unclear. As p25
rum1
interacts with
the complex of Cdc2 and B type cyclin and thus inhibits the
Cdc2 kinase activity, it is possible that phosphorylation of
p25
rum1
at Thr13/Ser19 prevent its interaction with the
Cdc2-B type cyclin complex. However, our data in the
present study indicated that MAPK-mediated phosphory-
lation does not affect interaction between p25
rum1
and
Cdc2–cyclin B complex. Further experiments to clarify the
mechanism of phosphorylation-mediated functional regu-
lation of p25
rum1
are now underway.
The CKI p25
rum1
plays an important role in the
regulation of G
1
phase in the fission yeast cell cycle [17–
24]. By preventing Cdc2 kinase activity, p25
rum1
has two
essential roles. First, it determines the length of the pre-Start
G

1
period. Secondly, it prevents mitosis from occurring in
early G
1
cells [17]. As the regulation of CDK activity must
be accurate, the function of p25
rum1
must also be regulated
tightly in the cell-cycle process. The regulatory mechanism
of p25
rum1
function has been well characterized by Correa-
Bordes et al. and Benito et al. [20,24]. According to their
observations, p25
rum1
protein levels are regulated sharply
and periodically during the cell cycle and can hence
contribute to appropriate control of the cell cycle. The
p25
rum1
begins to accumulate in anaphase, persisting in G
1
and disappearing during S phase. As p25
rum1
is stabilized
and polyubiquitinated in a mutant with a defective 26S
proteosome, it is suggested that degradation normally
occurs via the ubiquitin-dependent 26S proteosome
pathway.
Interestingly, these authors also observed that p25

rum1
is
phosphorylated by the Cdc2–B type cyclin complex at
residues Thr58 and Thr62, the distinct Thr residues from
MAPK-mediated phosphorylation residues which we iden-
tified. Among three Cdc2-cyclin complexes in fission yeast,
p25
rum1
inhibits the activities of Cdc2–Cdc13 and Cdc2–
Cig2 complexes but not the Cdc2–Cig1 complex [19,24]. In
contrast, Cdc2–Cig1, but neither Cdc2–Cdc13 nor Cdc2–
Cig2, is a Cdc2 kinase responsible for the phosphorylation
of p25
rum1
[20]. The mutation of one or both Thr58/Thr62
residues to Ala stabilizes p25
rum1
protein and induces
persistent expression of the protein, resulting in a cell-cycle
delay in G
1
and polyploidization due to occasional
re-initiation of DNA replication before mitosis. Therefore,
this phosphorylation might be the signal that targets
p25
rum1
for degradation by ubiquitination. Based on their
observations, earlier investigators concluded that periodic
accumulation and phosphorylation-initiated ubiquitinatio-
nation of p25

rum1
in G
1
phase play a role in setting a
threshold of cyclin levels important in determining the
length of the pre-Start G
1
phase and in ensuring the correct
order of cell-cycle events [20].
In contrast to their observation, we found MAPK-
phosphorylated p25
rum1
to show reduced activity as a Cdc2
kinase inhibitor in vitro, indicating that negative regulation
of the p25
rum1
function mediated by Thr13/Ser19 phos-
phorylation is independent of ubiquitination, rather being
induced by some conformational change of the protein.
Considering all of the above evidence together, we
speculate that p25
rum1
has, at a minimum, two distinct
and independent mechanisms of functional regulation,
both of which are mediated by phosphorylation. The
Fig. 6. Effect of E13E19 mutant of p25
rum1
on mitosis of S. pombe.
(A) The pESP expression vectors of GST fusion proteins of either the
wild-type (WT) (mid panels) or the E13E19 mutant (lower panels) of

p25
rum1
,aswellasvectoronly(upperpanels)wereintroducedinto
S. pombe as described in Materials and methods. After a 24-h culti-
vation, the cells were stained with PI and nuclear DNA contents were
examined by flow cytometry (left panels). At the same time, the mor-
phology of S. pombe in each transformation was also examined by
light microscopy (right panels). (B) Cell extracts were prepared from
S. pombes which had been transformed with wild-type (lane 1) and
E13E19 mutant (lane 2) expression vectors. Fifty micrograms of each
lysate were examined by immunoblot analysis using anti-GST Ig.
Ó FEBS 2002 MAP kinase negatively regulates Rum1 (Eur. J. Biochem. 269) 3519
function of p25
rum1
in the cell cycle may be regulated
mainly by ubiquitination-based control of protein levels
initiated by Cdc2–Cig1-mediated Thr58/Thr62 phosphory-
lation. However, Thr13/Ser19 phosphorylation by MAPK
should be an alternate or additional mechanism that
directly reduces p25
rum1
activity.
We have demonstrated the possibility that MAPK
negatively regulates p25
rum1
via phosphorylation of its Ser
and Thr residues, though it is still unclear whether this
regulatory mechanism is indeed utilized in vivo.Inthecase
of S. pombe, cells with deletion of sty1/spc1,agene
encoding S. pombe MAPK, are highly elongated as a

consequence of a delay in the timing of mitotic initiation,
which is exacerbated in response to stresses such as high
osmolarity and nutritional limitation [32]. Although such
mutants still undergo cell-cycle arrest in response to stress,
they are unable to resume proliferation and die [32,33].
These lines of evidence suggest that the Sty1/Spc1 MAPK
pathway is required for recovery from stress-induced cell-
cycle arrest in S. pombe. Activation of Sty1/Spc1 induces
nuclear translocation and subsequent phosphorylation of
the bZIP transcription factor Atf1, a homologue of ATF2
that is targeted by the mammalian SAPKs, whereas it is
currently unclear exactly how Sty1/Spc1 influences basal
cell-cycle machinery. However, several possibilities have
been raised [31]. One possibility is that Sty1/Spc1
promotes the expression of B-type cyclin Cdc13. Alter-
natively, Sty1/Spc1 may be required for the assembly or
stability of mitotic cyclin–CDK complexes or other cell-
cycle components. In relation to the second possibility, it
is plausible that Sty1/Spc1 phosphorylates p25
rum1
, inhib-
iting its activity as a negative regulator of Cdc2 kinase
and thereby stabilizes cyclin–CDK complexes. Interest-
ingly, it was observed in mammalian cells that MAPK
ERK is able to phosphorylate p27
KIP1
, a member of the
p21
CIP1/WAF1
CKI family, in vitro, preventing the CKI

from interacting with and inhibiting CDK2, a mammalian
G
1
–S CDK [36]. Moreover, expression of a dominant
negative Ras mutant or pharmacological inhibition of
MEK, both of which lead to inhibition of the MAPK
cascade, results in G
1
/S arrest, suggesting that ERK
modulates the timing of Start in vivo [37]. The above
evidence supports our hypothesis.
In conclusion, our data indicate that amino-acid residues
Thr13/Ser19 are responsible for phosphorylation mediated
by MAPK and that these residues negatively affect the
activity of p25
rum1
as a Cdc2 kinase inhibitor. Although
further studies are clearly necessary, investigation of
MAPK-mediated regulation of p25
rum1
may provide new
insights into the biochemical basis of cell-cycle control.
ACKNOWLEDGEMENTS
We thank M. Sone and S. Yamauchi for their excellent secretarial
work. This work was supported in part by a Grant for Pediatric
Research (12C-01) from the Ministry of Health and Welfare of Japan.
This work was also supported by a grant from the Japan Health
Sciences Foundation for Research on Health Sciences Focusing on
Drug Innovation. Additional support was provided by the Program of
the Research and Development Promotion Division, Science and

Technology Promotion Bureau, STA for Organized Research Combi-
nation System.
REFERENCES
1. Mendenhall, M.D. (1998) Cyclin-dependent kinase inhibitors of
Saccharomyces cerevisiae and Schizosaccharomyces pombe. Curr.
Top. Microbiol. Immunol. 227, 1–24.
2. Nurse, P. & Bissett, Y. (1981) Gene required in G1 for commit-
ment to cell cycle and in G2 for control of mitosis in fission yeast.
Nature 292, 558–560.
3. Piggott, J.R., Rai, R. & Carter, B.L. (1982) A bifunctional gene
product involved in two phases of the yeast cell cycle. Nature 298,
391–393.
4. Reed, S.I. & Wittenberg, C. (1990) Mitotic role for the Cdc28
protein kinase of Saccharomyces cerevisiae. Proc. Natl Acad. Sci.
USA 87, 5697–5701.
5. Moreno, S., Hayles, J. & Nurse, P. (1989) Regulation of p34cdc2
protein kinase during mitosis. Cell 58, 361–372.
6. Booher, R.N., Alfa, C.E., Hyams, J.S. & Beach, D.H. (1989) The
fission yeast cdc2/cdc13/suc1 protein kinase: regulation of catalytic
activity and nuclear localization. Cell 58, 485–497.
7. Obara-Ishihara, T. & Okayama, H. (1994) A B-type cyclin nega-
tively regulates conjugation via interacting with cell cycle ÔstartÕ
genesinfissionyeast.EMBO J. 13, 1863–1872.
8. Martin-Castellanos, C., Labib, K. & Moreno, S. (1996) B-type
cyclins regulate G1 progression in fission yeast in opposition to the
p25rum1 cdk inhibitor. EMBO J. 15, 839–849.
9.Mondesert,O.,McGowan,C.H.&Russell,P.(1996)Cig2,a
B-type cyclin, promotes the onset of S in Schizosaccharomyces
pombe. Mol. Cell Biol. 16, 1527–1533.
10. Fisher, D.L. & Nurse, P. (1996) A single fission yeast mitotic cyclin

B p34cdc2 kinase promotes both S-phase and mitosis in the
absence of G1 cyclins. EMBO J. 15, 850–860.
11. Glotzer, M., Murray, A.W. & Kirschner, M.W. (1991) Cyclin is
degraded by the ubiquitin pathway. Nature 349, 132–138.
12. Russell, P. & Nurse, P. (1986) cdc25+ functions as an inducer in
the mitotic control of fission yeast. Cell 45, 145–153.
13. Russell, P. & Nurse, P. (1987) Negative regulation of mitosis by
wee1+, a gene encoding a protein kinase homolog. Cell 49,559–
567.
14. Gould, K.L. & Nurse, P. (1989) Tyrosine phosphorylation of the
fission yeast cdc2+ protein kinase regulates entry into mitosis.
Nature 342, 39–45.
15. Featherstone, C. & Russell, P. (1991) Fission yeast p107wee1
mitotic inhibitor is a tyrosine/serine kinase. Nature 349, 808–811.
16. Lundgren, K., Walworth, N., Booher, R., Dembski, M., Kirsch-
ner, M. & Beach, D. (1991) mik1 and wee1 cooperate in the
inhibitory tyrosine phosphorylation of cdc2. Cell 64, 1111–1122.
17. Moreno, S. & Nurse, P. (1994) Regulation of progression through
the G1 phase of the cell cycle by the rum1+ gene. Nature 367,236–
242.
18. Correa-Bordes, J. & Nurse, P. (1995) p25rum1 orders S phase and
mitosis by acting as an inhibitor of the p34cdc2 mitotic kinase. Cell
83, 1001–1009.
19. Martin-Castellanos, C., Labib, K. & Moreno, S. (1996) B-type
cyclins regulate G1 progression in fission yeast in opposition to the
p25rum1 cdk inhibitor. EMBO J. 15, 839–849.
20. Benito, J., Martin-Castellanos, C. & Moreno, S. (1998) Regulation
of the G1 phase of the cell cycle by periodic stabilization and
degradation of the p25rum1 CDK inhibitor. EMBO J. 17,482–
497.

21. Moreno, S., Labib, K., Correa, J. & Nurse, P. (1994) Regulation
of the cell cycle timing of Start in fission yeast by the rum1+ gene.
J. Cell Sci. S18, 63–68.
22. Jallepalli, P.V. & Kelly, T.J. (1996) Rum1 and Cdc18 link
inhibition of cyclin-dependent kinase to the initiation of DNA
replication in Schizosaccharomyces pombe. Genes Dev. 10,541–
552.
3520 K. Matsuoka et al. (Eur. J. Biochem. 269) Ó FEBS 2002
23. Labib,K.,Moreno,S.&Nurse,P.(1995)Interactionofcdc2and
rum1 regulates Start and S-phase in fission yeast. J. Cell Sci. 108,
3285–3294.
24. Correa-Bordes, J., Gulli, M.P. & Nurse, P. (1997) p25rum1 pro-
motes proteolysis of the mitotic B-cyclin p56cdc13 during G1 of
the fission yeast cell cycle. EMBO J. 16, 4657–4664.
25. Kominami, K. & Toda, T. (1997) Fission yeast WD-repeat protein
pop1 regulates genome ploidy through ubiquitin-proteasome-
mediated degradation of the CDK inhibitor Rum1 and the
S-phase initiator Cdc18. Genes Dev. 11, 1548–1560.
26. Kominami, K., Seth-Smith, H. & Toda, T. (1998) Apc10 and
Ste9/Srw1, two regulators of the APC-cyclosome, as well as the
CDK inhibitor Rum1 are required for G1 cell-cycle arrest in
fission yeast. EMBO J. 17, 5388–5399.
27. Jallepalli, P.V., Tien, D. & Kelly, T.J. (1998) sud1 (+) targets
cyclin-dependent kinase-phosphorylated Cdc18 and Rum1 pro-
teins for degradation and stops unwanted diploidization in fission
yeast. Proc. Natl Acad. Sci. USA 95, 8159–8164.
28. Stern, B. & Nurse, P. (1998) Cyclin B proteolysis and the cyclin-
dependent kinase inhibitor rum1p are required for pheromone-
induced G1 arrest in fission yeast. Mol Biol. Cell 9, 1309–1321.
29. Sanchez-Diaz, A., Gonzalez, I., Arellano, M. & Moreno, S. (1998)

The Cdk inhibitors p25rum1 and p40SIC1 are functional homo-
logues that play similar roles in the regulation of the cell cycle in
fission and budding yeast. J. Cell Sci. 111, 843–851.
30. Maekawa, H., Kitamura, K. & Shimoda, C. (1998) The Ste16
WD-repeat protein regulates cell-cycle progression under starva-
tion through the Rum1 protein in Schizosaccharomyces pombe.
Curr. Genet. 33, 29–37.
31. Wilkinson, M.G. & Millar, J.B. (2000) Control of the eukaryotic
cell cycle by MAP kinase signaling pathways. FASEB J. 14, 2147–
2157.
32. Shiozaki, K. & Russell, P. (1995) Cell-cycle control linked to
extracellular environment by MAP kinase pathway in fission
yeast. Nature 378, 739–743.
33. Millar, J.B., Buck, V. & Wilkinson, M.G. (1995) Pyp1 and Pyp2
PTPases dephosphorylate an osmosensing MAP kinase control-
ling cell size at division in fission yeast. Genes Dev. 9, 2117–2130.
34. Frangioni, J.V. & Neel, B.G. (1993) Solubilization and purifica-
tion of enzymatically active glutathione S-transferase (pGEX)
fusion proteins. Anal. Biochem. 210, 179–187.
35. Kiyokawa, N., Lee, E.K., Karunagaran, D., Lin, S.Y. & Hung,
M.C. (1997) Mitosis-specific negative regulation of epidermal
growth factor receptor, triggered by a decrease in ligand binding
and dimerization, can be overcome by overexpression of receptor.
J. Biol. Chem. 272, 18656–18665.
36. Kawada, M., Yamagoe, S., Murakami, Y., Suzuki, K., Mizuno, S.
& Uehara, Y. (1997) Induction of p27Kip1 degradation and
anchorage independence by Ras through the MAP kinase sig-
naling pathway. Oncogene 15, 629–637.
37. Takuwa, N. & Takuwa, Y. (1997) Ras activity late in G1 phase
required for p27kip1 downregulation, passage through the

restriction point, and entry into S phase in growth factor-
stimulated NIH 3T3 fibroblasts. Mol. Cell Biol. 17, 5348–5358.
Ó FEBS 2002 MAP kinase negatively regulates Rum1 (Eur. J. Biochem. 269) 3521