Identification Of The Pathogen Causing Root And Stem Rot Disease Asparagus (Asparagus Officinalis L.) Cultivated In Ninh Thuan Province

NGUYEN TAT THANH
UNIVERSITY
TRUE LEARNING - TRUE PRACTICE - TRUE SUCCESS - TRUE FUTURE
NGUYEN TAT THANH

FACULTY OF BIOTECHNOLOGY

GRADUATION THESIS

IDENTIFICATION OF THE PATHOGEN
CAUSING ROOT AND STEM ROT DISEASE

ASPARAGUS (Asparagus officinalis L.)
CULTIVATED IN NINH THUAN PROVINCE

Student’s name

: Pham Thi Hong Gam

Student ID

:1711543905

Supervisor

: MSc. Nguyen Thi Nha

Ho Chi Minh City, 2020


TABLE OF CONTENTS

ACKNOWLEDGEMENTS.......................................................................................... i

TABLE OF CONTENTS............................................................................................. ii
ABSTRACT.................................................................................................................. V
LIST OF FIGURES..................................................................................................... vi
LIST OF TABLES...................................................................................................... vii
LIST OF ACRONYMS............................................................................................. viii

INTRODUCTION....................................................................................................... ix
CHAPTER 1. LITERATURE REVIEW.................................................................. 1

1.1 An overview of asparagus plants............................................................................. 1
1.1.1 Classify................................................................................................................. 1
1.1.2 Morphological characteristics............................................................................. 2

1.1.3 Ecological characteristics.....................................................................................2
1.2 The nutritious and economic value of the asparagus plant.................................... 3

1.2.1 The nutritious and medicinal value of the asparagus plant.................................. 3

1.2.2 The economic value of asparagus.........................................................................3
1.3 Production and consumption of asparagus in the World and Vietnam.................. 4

1.3.1 Production and consumption of asparagus in the World...................................... 4

1.3.2 Production and consumption of asparagus in Vietnam....................................... 4
1.4 Diseases of asparagus............................................................................................. 5

1.5 Identify the pathogen through morphological characteristics.................................8
1.6 Identify the pathogen through molecular characteristics....................................... 8

1.6.1 PCR reaction......................................................................................................... 8

1.6.2 ITS sequence region............................................................................................. 8
1.6.3 Electrophoresis.....................................................................................................9

ii


1.7 Research situation in the world and Vietnam......................................................... 9

1.7.1 Research situation in the world......................................................................... 9

1.7.2 Research situation in Vietnam........................................................................... 10
CHAPTER 2. CONTENTS AND METHODS....................................................... 12
2.1 Place of administration.......................................................................................... 12
2.2 Contents................................................................................................................. 12

2.3 Research materials................................................................................................. 12
2.4 Methods................................................................................................................. 12

2.4.1 Sampling............................................................................................................. 12
2.4.2 Isolation

and

identification

of the

pathogenthrough

morphological

characteristics................................................................................................................12

2.4.2 Pathogenicity test................................................................................................ 14

2.4.3 Determination of the pathogen by molecular identification............................... 14
2.5 Inquiry into the temperature and pH effects of the growth and development of

pathogens....................................................................................................................... 19
2.5.1 Inquiry into the temperature effects of the growth and development of pathogens.
19
2.5.2 Inquiry into the temperature effects of the growth and development of pathogens.

19
The experiment to investigate the effect on the pH on the growth and development of

the fungus were arranged including 5 treatments, 3 replicates/treatment, each treatment

was one petri dish with a diameter of 9 cm................................................................... 19
CHAPTER 3. RESULTS AND DISCUSSION...................................................... 20

3.1 Morphological and cultured characteristics of asparagus root and stem rot

pathogen in Ninh Thuan............................................................................................... 20
3.1.1 Symptoms of disease.......................................................................................... 20
3.1.2 Isolation and purification of the pathogen......................................................... 21
iii

3.1.3 Microscopic characteristics of the fungus that cause root and stem rot............ 22
3.2

Pathogenicity tests............................................................................................... 23

3.3

Identify the pathogen through molecular characteristics.................................... 24

3.3.1 Results of electrophoresis of the PCR products in the ITS 18S rRNA sequence

region............................................................................................................................ 24

3.3.2 Sequencing PCR products..................................................................................25
3.3.3 BLAST fungal strains isolated........................................................................... 26

3.3.4 Phylogenetic trees.............................................................................................. 27
3.4

Inquiry into the temperature and pH effects of the growth and development of

fungi F. equiseti and F. proliferatum........................................................................... 29
3.4.1 Inquiry into the temperature effects of the growth and development of fungi F.

equiseti and F. proliferatum......................................................................................... 29
3.4.2 Inquiry into the pH effects of thegrowth and development of fungi F. equiseti
and F. proliferatum....................................................................................................... 32

CONCLUSIONS AND RECOMMENDATIONS................................................... 37
REFERENCES........................................................................................................... 38

APPENDICES............................................................................................................. 41

IV


ABSTRACT
The study “Identification of the pathogen causing root and stem rot disease
Asparagus (Asparagus Officinalis L.) cultivated in Ninh Thuan province” was

carried out between April

2020 and September 2020 in Molecular Biology lab,

Faculty of Biotechnology, Nguyen Tat Thanh University to identify the root and stem

rot pathogens in Asparagus. The contents of this study include: Identification of

morphology and culture characteristics of root and stem rot disease among the
Asparagus cultivated in Ninh Thuan; Identification of molecular pathogen;

Pathogenicity test; Inquiry into the temperature and Hydrogen power (pH) effects of
the growth and development of pathogens.
Results:

1.

Isolations of asparagus root and stem rot pathogen on PGA medium at room

temperature for seven days, the mycelium is white, the filaments are spongy and
pigmented on agar medium. Fungal spores are crescent-shaped with the septum.
2.

Genetic characteristics based on the 18S rRNA gene sequence revealed that

fungal strains Fusarium sp. in this study originated from the same species with the
strains of Fusarium equiseti (isolated from many countries in the world such as
Pakistan, China) and Fusarium proliferatum (isolated in the Netherlands with 100%
similarity).

3.

The mycelium is mostly suitably grown and developed at 25 - 30 °C and

becomes inhibited at 40 °C. The pH effect also influences the growth and development
of both fungi in this study. The pH, which is acidic to neutral, is consistent with the
growth and development of Fusarium equiseti and Fusarium proliferatum.

V


LIST OF FIGURES
Figure 1.1 Asparagus plant........................................................................................... 1
Figure 1.2 Common disease on asparagus....................................................................7
Figure 1.3 ITS rRNA sequence region.........................................................................9
Figure 3.1 Symptoms of root and stem rot disease in the field.................................. 20
Figure 3.2 Morphology of colonization on PGA medium..........................................22
Figure 3.3 Fungal spores under a microscope............................................................23

Figure 3.4 Results of pathogenicity test..................................................................... 24
Figure 3.5 Total DNA test......................................................................................... 24
Figure 3.6 Results of the electrophoresis of PCR products....................................... 25
Figure 3.7 Results of reading the sequence file using BioEdit software....................26
Figure 3.8 Results of BLAST strains isolated from group 1 on the gene bank......... 26
Figure 3.9 Results of BLAST strains isolated from group 2 on the gene bank..........26
Figure 3.10 Phylogenetic tree isolated fungus.......................................................... 28
Figure 3.11 Effect of temperature on growth of F. equiseti on petri dishes.............. 30
Figure 3.12 Effect of temperature on growth of F. proliferatum on petri dishes....... 31
Figure 3.13 Effect of pH on growth of F. equiseti. on petri dishes............................ 33
Figure 3.14 Effect of pH on growth of F. equiseti on petri dishes............................ 35

vi


LIST OF TABLES
Table 2.1 Component content of PCR reaction.......................................................... 17
Table 2.2 PCR cycling conditions............................................................................. 17
Table 3.1 Reference strains........................................................................................ 27
Table 3.2 Assessment of the effect of temperature on the growth of fungi F. equiseti29
Table 3.3 Assessment of the effect of temperature on the growth of F. proliferation 30
Table 3.4 Assessment of the effect of pH on the growth of F. equiseti.................... 33
Table 3.5 Assessment of the effect of pH on the growth of F. proliferation........... 34

vii


LIST OF ACRONYMS
bp

Base pair

DNA

Deoxyribonucleic Acid

RNA

Ribonucleic Acid

rRNA

ribosome Ribonucleic Acid

BC

Before Christ

ha

Hectare

ITS

Internal transcribed spacer

NCBI

National Center for Biotechnology Information

BLAST

Basic Local Alignment Search Tool

WHO

World Healthy Organization

PGA

Potato glucose agar

WA

Water agar

rpm

Round per min

PLS

Plant lysis buffer

PBB

Plant binding buffer

PWB

Plant wash buffer

EB

Elution buffer

TBE

Tris - Borate - EDTA

Rnase

Ribonuclease

PCR

Polymerase Chain Reaction

cv

Coeff Var

LSD

Least significant difference

Vlll


INTRODUCTION

1. Rationale for this thesis
Asparagus (Asparagus officinalis L.), belongs to the genus Asparagus,

Asparagaceae is a perennial vegetable native in the Middle East. The product is a spear
of the tree which is used as vegetables with high nutritious substances helping humans
in health improvement. Asparagus plants are more and more appreciated and expanded
in several provinces such as Hai Phong, Binh Phuoc, Lam Dong, Tien Giang, Long An,

Ho Chi Minh City, and Ninh Thuan. In Binh Phuoc, Long An, Ninh Thuan provinces,
and Ho Chi Minh City, the Asparagus has gradually replaced the low-value and lowyield vegetable crops to become the province's specific crops.
Asparagus is a light-demanding species and grows well in the tropics whose

average annual temperature is always high. Among the areas growing asparagus, Ninh

Thuan province is the location with the most suitable conditions of soil and climate
for planting and development on the large-scale. Besides aloe vera, rice, apple, and

grape, asparagus is identified as an agriculturally featured product of the province.
Asparagus, which is a high-class vegetable and a crop with high economic value,

whose market is large both in domestic regions and foreign countries, therefore the
acra growing asparagus has increased significantly in recent years.
However, the Asparagus is a long-day crop that is often affected by pests and
diseases which are idiopathic in the farming process. These idiopathic and common
diseases including root and stem rot, Phytophthora rot, Phomopsis stem blight, rust,
gray mold, purple spots, viral diseases, etc make the young shoots of the Asparagus

grow poorly as well as affect the productivity and quality of asparagus in Ninh Thuan.
In particular, root and stem rot diseases are common with the red-brown pale and
oval-shaped lesions on the roots, which gradually rot the tissue. Rotten asparagus

plants infect each other and the disease can spread exponentially and affect the quality
and productivity of asparagus growing areas. It is worth noting that until now,

comprehensive studies have not yet been carried out to identify the root and stem rot
pathogens in asparagus in our country. With all above reasons, we implemented the
thesis "Identification of the pathogen causing root and stem rot disease
IX


Asparagus (Asparagus officinalis L.) cultivated in Ninh Thuan province" to find

the causation of the disease and take the most appropriate preventive measures.

2. Objectives
-

Identification of morphological characteristics of pathogens

-

Identification of molecular characteristics of the ITS rRNA sequence of
pathogens.

-

Determination of the effects of temperature, pH on the growth and development
of pathogens on asparagus under in-vitro conditions.

X

Chapter 1. Literature review

CHAPTER 1. LITERATURE REVIEW
1.1 An overview of asparagus plants

1.1.1 Classify
Scientific name and location of Asparagus
in the classification system:

Kingdom : Plantae
Phylum

: Mangoliophyta

Class

: Liliopsid

Order

: Aspagales

Family

: Asparagaceae

Genus

: Asparagus

Species

'.Asparagus officinalis
Figure 1.1 Asparagus plant

Asparagus with the scientific name of Asparagus Officinalis L. belonging to the

genus Asparagus is a large genus comprising approximately 150 species which are
mostly herbaceous perennials accompanied with tender woody shrubs and vines '.
There are only three species including A. officinalis, A. schoberrioides, and A.

cochinchinensis differentiate between male and female flowers on distinctive plants.
But only Asparagus Officinalis is used for vegetable purposes, the others are used as
ornamental or other purposes.

Currently, asparagus is divided into three categories: green asparagus, white

asparagus, and purple asparagus. Green asparagus, which is represented by the
asparagus varieties known as California 500 and uc - 157, have high productivity and

easy methods in cultivation and harvest despite their moderate value in commercial.

White asparagus, which is represented by the Mary Washington variety, is a popular
cultivar for high yield and quality. White asparagus, which is soft, crunchy, has milder
flavor than green asparagus varieties because the texture of the white asparagus is less

1

Chapter 1. Literature review

woody. White asparagus products are most popular in the markets, especially in the

European markets. Purple asparagus is another form of green asparagus and white

asparagus. They contain a great deal of sugar and little graininess. Its purple color

comes from the high levels of anthocyanins (powerful antioxidants) in the buds. Purple
asparagus is grown in Italy, American, and some other countries at an insignificant

acre.
1.1.2 Morphological characteristics
Asparagus is known as a perennial, shrub, herbaceous plant. Its tree is about

1.3 - 3.8 meters high, which can live from 15 to 20 years. When the tree grows tall, the

trunk turns green and has many branches 2.
Asparagus leaves are undeveloped and coniferous with little drainage, which

helps it be capable of good drought tolerance. The fruit is a berry with an average

diameter of 8 - 9 mm. When ripping, fruits are red with three compartments, each with

5-6 black seeds, tough seed skin, the average diameter of 3 - 4 mm. 1000 seeds
weigh about 20 grams, 40 - 60 seeds /g3.

The primary roots are very short and die as soon as the seeds germinate, the
cylindrical roots are upright, the other roots grow horizontally. Asparagus spears

grow up near the cylindrical roots which contain the highest level of tree nutrition.
1.1.3 Ecological characteristics
Asparagus seeds can germinate at 20 °C with the low germination rate at 27%,

the suitable temperature for asparagus to sprout is at approximately 23 - 25 °C and to

grow is at approximately 20 - 30 °C. Asparagus can withstand cold temperatures
theoretically, but in the condition that the temperature is below 10 °C or water is not

available, trees will stop growing.

Areas with robust light intensity are considered being suitable for asparagus
growth. Asparagus is a plant that is compatible with moisture. Therefore the regular

humidity reaches at 80 - 85%, asparagus spears are stimulated to grow more, soft, and
sweet. However, the high humidity in the air also can make the plant weak and

susceptible to disease 2. Asparagus is suitable for sandy soils, heavy soil, with good
2


Chapter 1. Literature review

drainage, pH from 6 to 7. Asparagus has a well-developed root system that requires a
high clearance of soil for maximum growth.

1.2 The nutritious and economic value of the asparagus plant

1.2.1 The nutritious and medicinal value of the asparagus plant

Asparagus can be processed into many dishes such as asparagus salad, stir-fried
asparagus beef with mustard sauce, asparagus smoothie, etc depending on the personal

taste and preferences.
Asparagus is a highly nutritious vegetable that is low in calories with almost no

fat, very little sodium, and high glutathione (26 - 40 mg / 100g in fresh weight) more
than any fruit and vegetable 4.
Asparagus is a rich source of carbohydrates, protein, calcium, iron, fiber, and

ascorbic acid. In addition to fiber, vitamins E, c, A, pyridoxine (B6), riboflavin (B2),

thiamin (Bl), and folic acid, nearly !4 the weight of 100 grams of asparagus are
minerals essential for the human body such as potassium, magnesium, calcium, iron 4,5.

Vitamin c (ascorbic acid) is an antioxidant that can help prevent cancer,

coronary artery disease, and arthritis as well as reduce the effects of aging. It enhances
the effectiveness of other antioxidants involving vitamin E, which has recently been
proven the capability in reducing heart disease. Asparagus has a high ascorbic acid

content ranging from 6 - 12 mg / 100 g of white asparagus and green asparagus 6.
Glutathione is a sulfur-containing antioxidant with anti-cancer properties.

Glutathione often participates in the human body's immune system. Rich source of

glutathione in asparagus, avocado, and watermelon contains 28 - 35 mg glutathione /

100g fresh weight4’7.
1.2.2 The economic value of asparagus

Asparagus is a premium vegetable with great nutritious value and significant

economic benefits. It is not only raw material for the canning industry but is a valuable
exported product grown in many countries around the world such as Europe, Asia, and

America. In the US, asparagus is rated as the 10th position among vegetables 2.
3


Chapter 1. Literature review

The world's import market mainly involving Europe, Japan, Thailand, Singapore,
and Taiwan, Korea at the present for asparagus is up to thousands of tons per year and

has a tendency to increase year by year2.

In Vietnam, asparagus was planted during the French colonial period. Many
regions in the country have grown asparagus for export processing such as Dong Anh

(Ha Noi), Kien An (Hai Phong), Duc Trong (Lam Dong). The main export markets of
Vietnamese asparagus are Western European countries.

1.3 Production and consumption of asparagus in the World and Vietnam

1.3.1 Production and consumption of asparagus in the World
Currently, the area growing asparagus over the world is about 265,000 hectares

(ha), of which Asia is the largest asparagus growing region in the world. Some
countries with asparagus plants growing in large scale are China, America, Mexico,

Germany, Peru, and Spain. China is the one which owns the largest area at 93,000 ha,

followed by Mexico at 29,000 ha, Germany at 28,500 ha, and Peru at 22,000 ha.
( )

Approximately 20,700 acres of asparagus were harvested in the US in 2019. US
acreage growing asparagus at the current time is just about one-third as the one 15

years ago due to the increasing imports from Central and South America. Essentially
all of the US commercial asparagus production occurs in Michigan, California, and

Washington. The national average yield in 2019 was around 4 076 pounds per acre. In

2019, total asparagus production was 84.39 million pounds. Approximately 502.4
million pounds of fresh asparagus was imported in 2017, mostly from Mexico, Peru,
and Chili. The value of the 2017 US commercial asparagus crop was approximately

$73.1 million.
( )
1.3.2 Production and consumption of asparagus in Vietnam

In Vietnam, the asparagus plant was introduced in the 1960s - 1970s. But in that
time, the market can not be found, therefore asparagus can not develop. It was not

until 2005 that the asparagus tree reappeared in Vietnam again with its appreciable
4


Chapter 1. Literature review

value2. Some regions in the North have grown asparagus for export such as Dong Anh
(Ha Noi), Kien An (Hai Phong), however the yield is not high at about 3-4 tons per
hectare. Due to a cold winter in the North, the tree can only harvest in late spring­

summer. Harvesting time in a year is only 4-5 months. Asparagus trees can plant

through the year round if farmers can actively water and take care of seedlings
according to technical requirements. However, it is to avoid planting during times of

the year with heavy rainfall (June to September).

The situation of asparagus cultivation in Ninh Thuan province: Ninh Thuan
province is known as the land of sunshine and winds with the annual average
temperature ranging from 26 to 27 °C , in which the total heat is up to 9 500 - 10
000 °C. Strong winds and sandy soil are suitable conditions for the growth and

development of asparagus. Asparagus trees have been tested in Ninh Thuan province
since 2005. Besides aloe vera, rice, apple, and grape, asparagus is identified as an

agriculturally featured product of the province. Asparagus planting area in 2017
reached 700 ha, the average yield 22 - 25 tons/hectare/year. Asparagus is grown

densely in the cities of Phan Rang - Thap Cham and Ninh Phuoc, which brings about
3-4 times more income than growing other vegetables in the same area unit. This is
one of the crops that make economic breakthroughs and adapt to the dry climate
conditions of Ninh Thuan.
1.4 Diseases of asparagus

With a tropical monsoon climate, hot and rainy weather like our country, without
proper care, asparagus will be susceptible to fungal infections. Fungal pathogens are

the agent that causes many diseases on asparagus such as root and stem rot,

Phytophthora rot, dry branches, rust, gray mold, purple spots, etc. That causes
underdeveloped shoots and plants, which affect the yield and quality of asparagus in
Ninh Thuan.

Because asparagus provides both nutritious values in daily meals and high

economic value for the farmer, it is very grave for the plant to become infected with

factors such as fungi and bacteria. Some pathogens produce toxins in the hosts. For
example, Fusarium produces the mycotoxins as Trichothecenes. That can cause
5


Chapter 1. Literature review

diseases such as cancer, hemorrhage, edema, and immunodeficiency. The World

Health Organization (WHO) reports that mycotoxins pose a danger to human and

animal health. For this reason, asparagus fungal disease needs correctly controlled.
Some common diseases on the current asparagus plant are:

Root and stem rot is one of the most important diseases of the asparagus plant
worldwide. The disease's first record in the US in 1908 8. Over the years the disease
has been called dwarf asparagus, wilt and root rot, seedling blight, crown rot complex,
and Fusarium stem and crown rot. The disease affects seedlings and mature plants.

Symptoms of disease in older plants include gradual yellowing and death. Sapling and
shoots develop slowly, which stop growing. The stem is wrinkled, yellowed, and

withered. The crown and roots are initially light reddish-brown, oval in shape,
gradually rotting tissues and turning dark brown. Rotten asparagus plants infect each
other, and the disease can spread exponentially. These fungi exist in the soil for a very

long time, which can grow as some saprophytic bacteria and reproduce a lot. The

fungus infects the tree through old roots, crown roots, wounds on trees. Fusarium
species can spread by soil, plant debris, seeds, or nursery trees.

Rust affects the premature depletion of asparagus caused by the fungus Puccinia

asparagi DC. The disease was first described in 1805 in France 9. It was initially small
oval spots, then expanded to 10-20 mm long, with a light green color, sometimes

difficult to recognize especially on young plants. The second stage of the disease is
yellow-orange in the middle is concave and then turns light brown and swollen like

pustules. As these pustules age, they release large numbers of reddish-brown oozing
spores that continue to infect l0. Stage three, on the lesions, appear black spores loaf
containing spores. This spore form helps the fungus survive the winter and cause it to

return next season. This phase requires moisture to infect, and rust outbreaks typically
occur from rain, prolonged rain 1 *’12.
Phytophthora spear rot was first described in California in 1938 8. There are
many types of Phytophthora fungi found from the disease samples that are confirmed

to be caused by the fungus Phytophthora megasperma Drechs 13. Symptoms include

soft, wet sprouts, mucus both above and below the ground. The disease develops to rot

6


Chapter 1. Literature review

both the base of the shoots and the spear on the land. Always wet soil is a favorable
condition for fungal spores to germinate and infect diseases. Studies show that
asparagus yield is reduced during the rainy season harvests.

Asparagus purple spot disease caused by the fungus Pleospora herbarium
(anamorph Stemphylium vesicarium) was first reported in the US in 1981 1 . Diseased

plants initially have small purple spots around, light brown in the middle and concave.
The disease usually appears in the base of shoots and the maternal stem tree. In areas

with a long rainy season, many patches of fog cause serious harm, seriously infected
plants will lose their leaves, dry and die, on shoots become barren and slow to grow in
height.

Figure 1.2 Common disease on asparagus. (A): Root and stem rot disease;
(B): Purple spot disease; (C): Phytophthora rot; (D): Asparagus rust)

7


Chapter 1. Literature review

1.5 Identify the pathogen through morphological characteristics

According to research in Spain, asparagus plants can exhibit symptoms of

stunting, root rot, crown roots, and stems. Reddish-brown, oval lesions on the surface
of the base and stem, the foliage can become stunted, wilted, and yellow lead to the

death of seedlings. The samples were collected and isolated on potato agar (PDA).
Isolation plates are incubated at 25 °C for two days in the dark, then for 5 to 8 days
inoculated with a 12-hour morning cycle 15. Create branched mycelium, which is
usually colorless, turning brown as you age. The fungus can be cotton-like or flat or

spread on the culture medium. Macroconidia transparent, with 3-5 septum, slightly
curved, the size ranges from 3 to 8 X 11 - 70 pm. Microconidia without a septum, oval

to elliptical in size 2 - 4 X 4 - 8 pm.
1.6 Identify the pathogen through molecular characteristics

1.6.1 PCR reaction
Polymerase chain reaction (PCR) was invented by Mullis in 1983 and patented in

1985. Its principle is based on the use of DNA polymerase which is an in vitro
replication of specific DNA sequences. This method can generate tens of billions of

copies of a particular DNA fragment (the sequence of interest, DNA of interest, or
target DNA) from a DNA extract (DNA template).

Amplification is executed using a repeating heat cycle. The PCR reaction
consists of several repetitive cycles in series. Each cycle consists of three phases as
denaturation, annealing, and extension.

1.6.2 ITS sequence region

The Internal transcribed spacer (ITS) buffer zone is an area interspersed with
rDNA sequences encoding rRNAs. The rRNA will combine with proteins to form a
ribosome function for protein synthesis.

The ribosomal RNA (rRNA) region consists of multiple copies (up to 200
duplicate for the haploid genome) arranged in parallel repetitions consisting of small

18S subunits, 5.8S, and large 28S subunit genes separated by internally transcribed

buffers (ITS1 and ITS2) 16. This zone contains highly conserved areas sufficient to
8


Chapter 1. Literature review

design primers for homogeneous species (RNA ribosome genes), interspersed with
highly variable regions allowing differentiation at multiple levels of the taxonomy

(ITS region)16.

The ITS region is short in size (about 500 - 800 bp), easily amplified by PCR
reaction. PCR can amplify this region with characteristic primers. The researchers

selected the ITS region to find the genetic regions specific to the species, thereby
quickly identifying the species. The ITS region has been used in research to find and

determine the genetic diversity of many fungal species.

PFPWM-F3
[""I

I

‘

PFPRIM-R4
ITS1
18SrRNA^

‘

‘

^TS4

ITS86^

-----ITS1 ------------ Ị

5 8S rRNA

— ITS2------

28S rRNA

•--------------------- -280bp

~500-s00bp

Figure 1.3 ITS rRNA sequence region
1.6.3 Electrophoresis

Electrophoresis is a technique commonly used in studying the structure and
biology of charged molecules (DNA, proteins, and enzymes). Agarose gel

electrophoresis for DNA testing using 0.3 - 2% agarose as a gel plate, depending on the
size of the DNA. If the DNA size is less than 1 kb, the agarose content used is about 1 2%, the agarose content commonly used in laboratories is about 0.7 - 0.8% 17.
1.7 Research situation in the world and Vietnam

1.7.1 Research situation in the world
Root and stem rot is one of the most important diseases of the asparagus plant
worldwide. The disease's was first recorded in the US in 1908 8. It is caused by several
species of Fusarium spp. This affects seeds and mature plants.

The first Fusarium pathogen found to be associated with this disease was
Fusarium oxysporum in 1941 18. F. proliferatum was also discovered as a pathogen in

1979. Fusarium species that cause asparagus disease have isolated from asparagus
9


Chapter 1. Literature review

fields across New Zealand l9. Up to eight species of Fusarium fungi are found in
asparagus soil in Australia and New Zealand. Inside, F. oxysporum, F. equiseti, F.

solani, F. semitectum account for over 90%. But F. oxysporum, F. prolireatum, and F.
moliniforme are found in diseased asparagus fields in Australia and many other

countries 20. In 2006, Corpas-Hervias et al. investigated the properties of Fusarium

isolated from asparagus fields in Spain 21.
According to the first report of Fusarium proliferation as the cause of asparagus

root rot in Turkey in 2011, symptoms of root rot appeared in asparagus cultivated
areas for 3 to 8 months. Symptoms include decreased shoot tip yield and brown

damage, vascular discoloration, and root, rhizome, and stem rot. Based on
morphological data and PCR assays, the causative agent is F. proliferation 22.

Ana Borrego - Benjumea et al. (2013) had ninety-three Fusarium isolates,
obtained from plant and soil samples taken from commercial asparagus fields in
southwestern Ontario identified as F. oxysporum ( 65.5%), F. proliferation (18.3%), F.

solani (6.4%), F. acuminatum (6.4%), and F. redolens (3.2%) based on morphological

characteristics or cultural characteristics and PCR analysis with species-specific
primers23.

1.7.2 Research situation in Vietnam

In Vietnam, studies on diseases on asparagus are not universal, especially root
and stem rot, which has not yet been published on the causative agent. However, there

have been studies of root rot and the fungal agent Fusarium also causing disease in
other plant subjects.

In 2008, Nguyen Thi Sao carried out the studies Investigation farming techniques,
identification of the agent causation among asparagus blight (Asparagus Officinalis L.)

cultivated in Cu Chi district, Ho Chi Minh City. And it has identified the causative
agent of the fungus Phoma sp. cause. Fungi thrive in the rainy season and high

humidity conditions.
According to the results of the research studies on solutions to control root rot

disease on some specialty fruit trees in the Mekong Delta, the authors isolated and
10


Chapter 1. Literature review

identified the root rot pathogen. Research results showed that the root rot pathogen on

durian is Pythium vexans. Among 18 strains of fungi isolated from citrus trees with
root rot disease showed that there were eight lines of seriously pathogenic fungi

belonging to three groups of fungi Phytophthora, Fusarium, and Pythium. Involve,
two strains of fungi Phytophthora palmivora and Fusarium solani cause the most
damage in greenhouse conditions24.

Nguyen Minh Chi et al. described the morphological, taxonomic, and pathogenic
characteristics of the fungal strains of the genus Fusarium that cause orange root rot in
Quang Ninh province. The results of identification using the molecular marker: primer
pair ITS 1 and ITS4, which have identified the fungal root rot pathogens of Fusarium

proliferatum species. The fungus F. proliferatum is pathogenic in both leaf and seed 25.

In 2017, Nguyen Don Hieu et al. identified the fungus Fusarium spp. which
causes bark rot on rubber trees in Vietnam. Pathogens are isolated and preliminarily

identified based on morphological characteristics and then identified by molecular

techniques. ITS DNA regions of 15 fungal isolates were identified in the genus
Fusarium based on PCR multiplying the ITS sequence by ITS 1 and ITS 4 primers and
sequencing. In all 15 fungal isolates obtained from multiple clones of rubber clones in

different geographical regions, the 546 bp DNA fragment amplified 26.

11


Chapter 2. Content and methods

CHAPTER 2. CONTENTS AND METHODS
2.1 Place of administration

- Location: Department of Plant Molecular Biology, Nguyen Tat Thanh
University.

Duration: 5 months, starting from April 2020.

2.2 Contents

- Identification of morphological and cultural characteristics of the Asparagus
root and stem rot disease cultivated in Ninh Thuan province

-

Identification of molecular pathogen

-

Pathogenicity test

- Inquiry into the temperature and pH effects of the growth and development of

pathogens.
2.3 Research materials

Disease samples with typical symptoms of asparagus root and stem rot were

collected at Tuan Tu village, An Hai commune, Ninh Phuoc district, Ninh Thuan
province.
2.4 Methods

2.4.1 Sampling

The collected sample was a sample of asparagus stem and base with symptoms
of disease showing outward signs such as wrinkled stem, yellow fall, light reddish-

brown disease wound, oval shape. Disease samples were collected at Ninh Phuoc
district, Ninh Thuan province. The sample is then placed in a zip bag with name,
location, and time of collection.
2.4.2 Isolation and identification of the pathogen through morphological

characteristics

2.4.2.1 Method of isolation of infected asparagus stem and base sample
Steps for isolation from asparagus stem and base:

12


Chapter 2. Content and methods

1. Wipe the work area with 70% ethyl alcohol.
2. Dip instrument (forceps and knife or scalpel) in 70% ethyl alcohol and flame

dry.

3. Rinse the sample in water to remove soil and other debris.
4. Surface sterilise stem tissue by wiping the stem tissue with a soft paper (paper

tissue) dipped in 70% ethyl alcohol.

5. Aseptically cut small pieces (approximately 2x2 mm) from the margin of the
healthy and diseased tissue, and transfer them to a low - nutrient medium (water agar).

6. Incubate the plates at approximately 25 °C, ideally under lights.
7. Check plates each day, and when fungal colonies develop from the pieces of
plant tissue, transfer material from the margin to a PGA medium.
2.4.2.2 Method of inoculation from isolation plates

1. Examine the plates each day and assess the growth of fungal hyphae from the
cultures.
2.

Determine if there is more than one fungal species growing.

3.

Subculture when there is approximately 5 mm of hyphal from the plant tissue.

4. Cut out a small block agar (2x2 mm) from the margin of each colony and

transfer it to PGA medium.

Tracking criteria: monitoring parameters such as morphology, structure, spores
and colony color, and mycelium.
2.4.2.3 Examination of fungal spores under a compound microscope

The pathogen identified by the basic methods guided by Domsch (1972), Barnet
và Hunter (1998), and on indicators such as morphology, structure, spores, and color
27.28

Chemical: Lactophenol dye

Materials: fungal spores , PGA medium
Instrument: Slide, lamen

13


Chapter 2. Content and methods
Spores from a diseased plant or culture can be scraped off with a transfer needle
and transferred to the Lactophenol drop. Then proceed to observe the slide under a

microscope.
2.4.2 Pathogenicity test
The method of soil inoculation was conducted according to Burgess et al (2009)29.

1. Soak millet seed and rice hulls overnight in water in a refrigerator, to allow the
mixture to absorb water.
2.

Pour the water away

3.

Transfer approximately 150 mL of medium to a 250 mL conical flask

4.

Cover the opening of the flask with a layer of aluminium foil and autoclave

5.

Inoculate the flasks using mycelial plugs

6. Incubate at approximately 25 °C for 2 weeks under alternating light and dark
conditions to allow complete colonisation of the substrate.

7. Shake the flasks 2-3 days after inoculation to ensure an even distribution of the

pathogen throughout the substrate
Targets and monitoring methods:

- Symptoms of the disease
T^.

znzx _

Number of infected trees
,
X 100
Total number of trees surveyed

- Disease rate (%) =

Pathogenicity test and asparagus check for disease symptom appearance and
symptom description. After that, the disease sample again (performed same content 1)

and confirmed the pathogen. Examination and comparison the characteristics of the
re-isolated pathogenic fungi in colony shape, color, spores, mycelium with original

purebred fungi to accurately close the pathogen.
Plants used for the experiment are the seedlings purchased from a home garden

in Ninh Thuan. After buying the tree, take care of one more month to make sure the
tree does not get sick naturally. Healthy plants are used to inoculate the disease.

2.4.3 Determination of the pathogen by molecular identification

Materials: Mycelia cultured in content 1

14


Chapter 2. Content and methods
Primer sequence ITS 1, ITS4

Forward primer (ITS 1 -F)30: 5’- CTTGGTCATTTAGAGGAAGTAA - 3’
Reverse primer (ITS4)31: 5’ - TCCTCCGCTTATTGATATGC - 3’

2.4.3.1 Total DNA extraction
Total DNA was extracted using TopPUREK Plant DNA Extraction Kit (HI-122 -

ABT, Vietnam) according to the manufacturer's instructions, the following steps:
Step 1: Sample collection: Use 30 - 100 mg of plant tissue sample into 2 ml tube,

grind the sample with a glass rod and add liquid nitrogen to crush the sample

effectively.
Step 2: Sample resolution:

- Add 400 pl PLS 1 solution into 2 ml tube (containing sample to extract) and

vortex evenly
- Add 10 pl RNase, lighten vortex and incubate at 65 °C for 30 minutes until the
cell is completely dissolved

- Add 130 pl PLS 2, mix well and incubate for 5 minutes on stone or cabinet
4 °C

- After incubation, centrifuge at maximum speed (15000 rpm) for 5 minutes and
suck all floating fluids (about 450 pl) into 1.5 ml tube

Step 3: Attach DNA to the silica column:

- Give PBB 1.5 times the volume of aspirated fluid in step 2, stir evenly at room

temperature for 1 - 2 minutes
-

Transfer 600 pl floating fluid into silica column

-

Centrifugal 11000 rounds in 2 minutes

- Discard the filtrate, reuse the tube containing the solution and retain the silica

column
- Continue centrifugation again with the amount of remaining mixture (DNA will
now attach to the silica in the column)

15