Báo cáo khoa học: Fragile X-related protein FXR1 controls posttranscriptional suppression of lipopolysaccharide-induced tumour necrosis factor-a production by transforming growth factor-b1 doc

Fragile X-related protein FXR1 controls post-
transcriptional suppression of lipopolysaccharide-induced
tumour necrosis factor-a production by transforming
growth factor-b1
Tarnjit K. Khera
1
, Andrew D. Dick
1,2
and Lindsay B. Nicholson
1,2
1 Department of Cellular and Molecular Medicine, School of Medical Sciences, University of Bristol, UK
2 Department of Clinical Sciences South Bristol, Academic Unit of Ophthalmology, University of Bristol, UK
Introduction
Tumour necrosis factor-a (TNF-a) is a key mediator of
inflammation, during which it plays a crucial role in the
early phase of a host’s defence against infection [1,2]. It
is also produced during autoimmune inflammatory
diseases, where it contributes to tissue damage [3,4].
Septic shock is an extreme example of dysregulated
inflammation, in which TNF-a is expressed rapidly and
at high levels [5–8].
To limit the potentially devastating effects that can
follow the release of TNF-a, its expression is under
strict control. It is regulated at the level of transcription,
pre-mRNA processing, mRNA stability, translation,
Keywords
FXR1; macrophages; RNA-binding proteins;
TGF-b1; TNF-a
Correspondence
T. K. Khera, Department of Cellular and
Molecular Medicine, School of Medical

Sciences, University Walk,
Bristol, BS8 1TD, UK
Fax: +44 117 3312091
Tel: +44 117 3312012
E-mail:
Website: />air/
(Received 26 February 2010, revised 11
April 2010, accepted 20 April 2010)
doi:10.1111/j.1742-4658.2010.07692.x
Tumour necrosis factor-a (TNF-a) is a key mediator of inflammation in
host defence against infection and in autoimmune disease. Its production is
controlled post-transcriptionally by multiple RNA-binding proteins that
interact with the TNF-a AU-rich element and regulate its expression; one
of these is Fragile X mental retardation-related protein 1 (FXR1). The
anti-inflammatory cytokine transforming growth factor-b1 (TGF-b1),
which is involved in the homeostatic regulation of TNF-a, causes post-
transcriptional suppression of lipopolysaccharide (LPS)-induced TNF-a
production. We report here that this depends on FXR1. Using RAW 264.7
cells and bone marrow-derived macrophages (BMDMu) stimulated with
LPS and TGF-b1, we show that TGF-b1 inhibits TNF-a protein secretion,
whereas TNF-a mRNA expression remains unchanged. This response is
recapitulated by the 3¢-UTR of TNF-a, which is known to bind FXR1.
TGF-b1 induces FXR1 with a pattern of expression distinct from that of
tristetraprolin, T-cell intracellular antigen 1, or human antigen R. When
FXR1 is knocked down, TGF-b 1 is no longer able to inhibit LPS-induced
TNF-a protein production, and overexpression of FXR1 suppresses LPS-
induced TNF-a protein production. Targeting the p38 mitogen-activated
protein kinase pathway of LPS-treated cells with small molecule inhibitors
can induce FXR1 protein and mRNA expression. In summary, TGF-b1
opposes LPS-induced stabilization of TNF-a mRNA and reduces the

amount of TNF-a protein, through induction of expression of the mRNA-
binding protein FXR1.
Abbreviations
ARE, AU-rich element; BMDMu, bone marrow-derived macrophages; CMV, cytomegalovirus; FXR1, Fragile X mental retardation-related
protein 1; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; HuA, human antigen R; IL, interleukin; LPS, lipopolysaccharide; MAPK,
mitogen-activated protein kinase; Q-PCR, quantitative PCR; RFP, red fluorescent protein; siRNA, small interfering RNA; TGF-b1, transforming
growth factor-b1; TIA-1, T-cell intracellular antigen 1; TNF-a, tumour necrosis factor-a; TTP, tristetraprolin.
2754 FEBS Journal 277 (2010) 2754–2765 ª 2010 The Authors Journal compilation ª 2010 FEBS
and retention at the plasma membrane [9–13]. The
TNF-a mRNA 3¢-UTR contains AU-rich elements
(AREs). AREs, which are found in many cytokine,
inflammatory gene and oncogene mRNAs, are targets
for binding proteins that regulate mRNA stability [14].
Mice with targeted deletion of the TNF-a ARE show
spontaneous production of TNF-a and develop
chronic inflammatory arthritis and inflammatory bowel
disease [15]. Multiple RNA-binding proteins that inter-
act with the TNF-a ARE and regulate its expression
have been identified. These include tristetraprolin
(TTP), T-cell intracellular antigen 1 (TIA-1), TIA-1-
related protein, human antigen R (HuA), AU-rich
element binding factor 1, and Fragile X mental retar-
dation-related protein 1 (FXR1) [16–22]. FXR1 is a
homologue of the Fragile X mental retardation syn-
drome protein, and, together with Fragile X mental
retardation-related protein 2P, forms the Fragile X
mental retardation-related family of RNA-binding pro-
teins [23]. Targeted deletion of FXR1 produced a mouse
that died soon after birth, but macrophage cell lines
generated from these animals had enhanced TNF-a pro-

tein production as compared with wild-type macrophag-
es [21]. The expression of several other proinflammatory
proteins was also affected by FXR1 deficiency, but the
cytokines involved in the induction of FXR1 remain un-
characterized. The regulation by the anti-inflammatory
cytokine transforming growth factor-b1 (TGF-b1) of
the proinflammatory cytokine TNF-a via the induction
of FXR1 is the focus of this article.
TGF-b1, a member of the large transforming growth
factor-b superfamily [24,25], is an anti-inflammatory
cytokine that can regulate TNF-a. Loss of TGF-b1
is associated with chronic inflammation, indicating that
a failure to produce anti-inflammatory factors (i.e.
TGF-b1) or defective signalling by anti-inflammatory
cytokines can contribute to the pathogenesis of inflam-
matory autoimmune diseases [26,27]. Both recombinant
TGF-b1 protein and antibodies against TNF-a have
been shown to be protective against collagen type II
arthritis in mice, whereas recombinant TNF-a protein
or antibodies against TFG-b1 increased the severity
of this disease, emphasizing the opposing effects of
these cytokines in vivo [28]. Other studies have shown
that TGF-b1 can suppress TNF-a production during
infection, increasing the severity of disease [29–32].
In the present study, we show for the first time that
TGF-b1 regulates TNF-a post-transcriptionally via the
induction of FXR1 expression. TGF-b1 induces the
expression of this RNA-binding protein, which can
downregulate lipopolysaccharide (LPS)-induced TNF-a
protein production. Furthermore, inhibition of FXR1

production can abolish the suppression of TNF-a
protein production induced by TGF-b1. FXR1 there-
fore plays an important role in the negative regulation
of TNF-a.
Results
TGF-b1 inhibits LPS-induced TNF-a protein
production by a TNF-a mRNA expression-
independent mechanism
TGF-b1 is known to destabilize the mRNA of LPS-
induced chemokines and regulate the mRNA stability
of various other genes [33]. It was reported to inhibit
TNF-a protein production without concomitant altera-
tions in the levels of mRNA, although the mechanism
was unknown [34,35].
Bone marrow-derived macrophages (BMDMu) and
RAW 264.7 cells treated with LPS (100 pg ÆmL
)1
to
1 lgÆmL
)1
) for 4 h produced TNF-a protein in a dose-
dependent fashion, maximum production being
reached at 100 ngÆmL
)1
(Fig. S 1A,B). When TGF-b1
(10 ngÆmL
)1
) [35] was added to either BMDMu or
RAW 264.7 cells treated with LPS (100 ngÆmL
)1

) for
4 h, the level of TNF-a protein induced showed a
decrease (Fig. 1A,B). The response of the BMDMu
was comparable to that of the RAW 64.7 cells. Assess-
ment by intracytoplasmic staining and flow cytometry
gave results comparable to those obtained by measure-
ment of the TNF-a protein concentration by ELISA
(Fig. S1A–C).
To determine whether TGF-b1-dependent inhibition
of LPS-induced TNF-a protein production occurred at
the level of transcription, RAW 264.7 cells were stimu-
lated as above (Fig. 1C). LPS treatment for 4 h
increased TNF-a mRNA levels, as compared with the
nontreated or TGF-b1-treated controls, and the addi-
tion of TGF-b1 with LPS had no effect on the level of
TNF-a mRNA. Therefore, changes in TNF-a protein
production do not correlate with changes in TNF-a
mRNA expression, and, as expected, the control of
TNF-a induction is not solely transcriptional.
Addition of TGF-b1 induces the expression of
factors that target the TNF-a 3¢-UTR
Most cytokines contain an ARE in the 3¢-UTR of
their mRNA, which modulates stability [36]. To deter-
mine whether TGF-b1 induced the expression of
factors that targeted the TNF-a 3¢-UTR, the TNF-a
3¢-UTR was cloned into the pGL3 control vector
after the luciferase ORF (SV40–Luc–TNF-3¢-UTR;
Fig. 2A). RAW 264.7 cells were cotransfected with
SV40–Luc–TNF-3¢-UTR and a Renilla control, and
T. K. Khera et al. TGF inhibits LPS induction of TNF via FXR1

FEBS Journal 277 (2010) 2754–2765 ª 2010 The Authors Journal compilation ª 2010 FEBS 2755
treated with LPS and TGF-b1; untreated cells acted as
controls. In unstimulated cells, no luciferase protein
expression was seen. LPS treatment induced luciferase
expression (Fig. 2B), whereas the simultaneous addi-
tion of TGF-b 1 with LPS led to a reduction in lucifer-
ase activity from 100% to 43.5 ± 14.1% (P = 0.01).
In agreement with published data, these experiments
show that the TNF-a 3¢-UTR is sufficient to give LPS
the ability to stabilize mRNA [12], but they also dem-
onstrate that this process is regulated by TGF-b1.
Induction of FXR1 expression by TGF-b1 leads to
post-transcriptional downregulation of TNF-a
protein
Many RNA-binding proteins, such as TTP, TIA-1,
HuA, TIA-1-related protein, and FXR1, are known to
bind to the ARE in the 3¢-UTR of cytokines, including
TNF-a, and regulate translation. We therefore studied
the effect of TGF-b1 on RNA-binding proteins,
including the mRNA expression of HuA (Fig. 3A),
TIA-1 (Fig. 3B), and TTP (Fig. 3C). LPS induced an
increase in HuA expression and a decrease in TIA-1
expression, but TGF-b1 did not have an effect
on these mRNA levels. As the production of these
proteins was not induced by TGF-b1, they were not
likely candidates for mediating its effects. As expected
[37], LPS induced TTP mRNA expression, although,
unexpectedly, TGF-b1 decreased the LPS-induced
increase in TTP levels. TTP is a negative regulator
of TNF-a [38], so the reduction in its level in the pre-

sence of TGF-b1 is not consistent with a role in con-
trolling TNF-a protein production following TGF-b1
stimulation.
The patterns of FXR1 mRNA expression in
BMDMu (Fig. 3D) and RAW 264.7 cells (Fig. 3E)
Fig. 1. TGF-b1 can suppress LPS-induced
TNF-a protein production, without significant
changes in mRNA expression. BMDMu (A)
and RAW 264.7 cells (B) were treated with
100 ngÆmL
)1
LPS for 4 h. To some samples,
10 ngÆmL
)1
TGF-b1 was added at the same
time as LPS (TGF-b1 ⁄ LPS). TNF-a
production was quantified by flow cytometry
and ELISA. RAW 264.7 cells were treated
as above, and relative TNF-a mRNA
expression was quantified using Q-PCR and
normalized to GAPDH expression (C).
Nontreated cells were used as a control;
n = 3–4, *P < 0.05.
TGF inhibits LPS induction of TNF via FXR1 T. K. Khera et al.
2756 FEBS Journal 277 (2010) 2754–2765 ª 2010 The Authors Journal compilation ª 2010 FEBS
were different. LPS treatment did not alter the level of
FXR1 mRNA, but this was increased by TGF-b1
(P = 0.009), and this induction was augmented when
TGF-b1 and LPS were present together (P = 0.009) in
RAW 264.7 cells. TGF-b1 alone and TGF-b1 with

LPS also induced FXR1 protein production in this sys-
tem (Fig. 3F). As expected, two different isoforms of
FXR1 were visualized by western blotting with anti-
body against FXR1 following the addition of TGF-b1
and TGF-b1 ⁄ LPS [39,40].
The pattern of FXR1 induction suggests that it
could play a role in regulating TNF-a protein expres-
sion in cells treated with TGF-b1. To test this directly,
FXR1 was inhibited with small interfering RNA
(siRNA) (Fig. 4A). FXR1 siRNA inhibited FXR1
mRNA expression by 74% as compared with a control
siRNA. Inhibition of FXR1 protein production
was assessed by using RAW 264.7 cells treated with
TGF-b1 for 1 h (Fig. 4Ba) and RAW 264.7 cells
stably transfected with FXR1 under a cytomegalovirus
(CMV) promoter (FXR1-OE cells; Fig. 4Bb). In both
the RAW 264.7 cells treated with TGF-b1 and the
FXR1-OE cells, siRNA 1 led to the greatest inhibition
of FXR1 protein production, so siRNA 1 was used for
all experiments. In the control siRNA-transfected cells,
LPS induced TNF-a protein production, and the addi-
tion of TGF-b1 suppressed TNF-a protein production
by 63%. When FXR1 was inhibited, TGF-b1 was no
longer able to suppress LPS-induced TNF-a protein
production (Fig. 4C). These findings show that TGF-
b1-induced inhibition of TNF-a protein production is
reversed when FXR1 is inhibited.
Overexpression of FXR1 can suppress
LPS-induced TNF-a protein production
To determine whether FXR1 overexpression is suffi-

cient to oppose the effects of LPS on TNF-a secretion
from RAW 264.7 cells, the FXR1-OE cells were com-
pared with control cells transfected with red fluores-
cent protein (RFP) under a CMV promoter (RFP-OE
cells). Increased expression of FXR1 protein in these
cell lines could be detected by western blot (Fig. 5A)
and by quantitative PCR (Q-PCR) (Fig. 5B), and
FXR1 mRNA expression was 5.5-fold higher in
FXR1-OE cells than in RFP-OE cells. TNF-a protein
from these cells treated with LPS for 4 h was quanti-
fied. At all concentrations of LPS, TNF-a protein
production was suppressed in FXR1-OE cells as com-
pared with controls (Fig. 5C). This effect was rela-
tively greater at lower LPS concentrations, and shows
directly that overexpression of FXR1 can suppress
TNF-a protein production. However, the effects of
consistent inhibition were partially reversed by increas-
ing the stimulus driving TNF-a protein production.
This could be because higher amounts of LPS lead to
increased TNF-a protein production as measured by
ELISA and intracellular staining (Fig. S1A–C).
Inhibition of p38 mitogen-activated protein
kinase (MAPK) can induce FXR1 production in
LPS-treated cells
LPS is known to activate the p38 MAPK pathway,
which is important, for example, in the stabilization of
chemokine mRNA. TGF-b1 opposes LPS-induced
chemokine stabilization by inhibiting p38 MAPK [33].
To determine whether this signalling pathway was
involved in FXR1 induction, SB203580, a cell-perme-

able p38 MAPK inhibitor, was used. RAW 264.7 cells
were treated with LPS (100 ngÆmL
)1
) and 0–10 lm
SB203580 for 4 h, and FXR1 protein (Fig. 6A) and
mRNA (Fig. 6B) were quantified. This treatment led
to substantial upregulation of FXR1 protein produc-
tion as well as an increase in mRNA levels. Further
experiments showed that the MAPKAP kinase 2 inhib-
itor also induced FXR1 mRNA expression (Fig. 2C).
These inhibitors were also tested with BMDMu trea-
ted with LPS. A negative control inhibitor (SB202474)
did not lead to expression of FXR1 mRNA, whereas
the MAPKAP kinase 2 inhibitor and SB203580 both
induced FXR1 mRNA expression (Fig. 6D). These
A
B
Fig. 2. TGF-b1 can inhibit LPS-induced protein production via the
3¢-UTR of TNF-a. (A) Schematic representation of the SV40–Luc–
TNF-3¢-UTR plasmid used. (B) The SV40–Luc–TNF-3¢-UTR plasmid
was cotransfected into RAW 264.7 cells with Renilla, also on a con-
stitutive promoter. After 24 h, the cells were treated with
100 ngÆmL
)1
LPS, with addition of 10 ngÆmL
)1
TGF-b1 alone or at
the same time as LPS. Luciferase expression was normalized using
Renilla. Cells treated with LPS alone were set at 100% luciferase
expression and the nontreated cells at 0% luciferase expression;

n =3,*P < 0.05.
T. K. Khera et al. TGF inhibits LPS induction of TNF via FXR1
FEBS Journal 277 (2010) 2754–2765 ª 2010 The Authors Journal compilation ª 2010 FEBS 2757
results show that, in LPS-treated cells, inhibition of
p38 MAPK leads to FXR1 induction at the protein
and mRNA levels, a pattern consistent with the known
signalling properties of TGF-b1.
Discussion
Regulation of TNF-a plays a central role in autoim-
mune disease [41–44], and therapy targeting TNF-a is
effective in patients with inflammatory disorders such
as uveitis and rheumatoid arthritis [45–49]. However,
this treatment has significant side effects, and better
understanding of its control may lead to more selective
therapies. Here, we investigated the homeostatic regu-
lation of TNF-a by the anti-inflammatory cytokine
TGF-b1 and demonstrated that FXR1, an mRNA-
binding protein, plays an essential role in this process.
Building on previous work showing that TGF-b1 can
inhibit LPS-induced TNF-a and chemokine production
[33,35], we confirmed that this occurs post-transcrip-
tionally. We then showed that the TNF 3 ¢-UTR is a
target for factors induced by TGF-b1 that counteract
the LPS-induced increased stability of TNF-a mRNA.
One of these factors is FXR1, which, unlike other
mRNA-binding proteins known to modulate TNF-a,
is induced by TGF-b1 but not by LPS. The specific
role of FXR1 in this process was shown by inhibition
by siRNA on the one hand, and stable overexpression
of FXR1 on the other. These results are consistent

with the phenotype of macrophages derived from
FXR1
) ⁄ )
mice [21]. The reporter assay showed more
suppression than quantification of TNF-a protein by
ELISA or intracellular staining. The most likely reason
for this is that only the effects of the TNF-a mRNA
3¢-UTR are being taken into account. Although the
luciferase data show that TGF-b1 can suppress LPS-
induced TNF-a production post-transcriptionally,
it does not provide information about whether
this occurs via mRNA instability and a decrease in
the half-life of TNF-a mRNA or via translational
suppression.
TGF-b1 inhibits the action of LPS, in part, by inter-
fering with p38 MAPK-dependent stabilization of mul-
tiple mRNAs [33]. This has downstream effects on a
number of genes, including those for TNF-a [50],
interleukin (IL)-3 [51], and IL-8 [52]. Inhibiting p38
A
CD
B
EF
Fig. 3. TGF-b1 can induce FXR1 mRNA and
protein expression. RAW 264.7 cells were
treated with 100 ngÆmL
)1
LPS and
10 ngÆmL
)1

, TGF-b1 alone or in combination,
for 4 h. The relative expression of mRNA
was then quantified by Q-PCR, and
represented as a fold increase as compared
with nontreated control cells. GAPDH was
used to normalize the results; *P < 0.05; (A)
HuA, n = 3; (B) TIA-1, n = 3; and (C) TTP,
n = 4. FXR1 mRNA expression was
quantified in BMDMu (D), n = 3, and
RAW 264.7 cells (E), n = 5. FXR1 protein
expression was detected by western blot
using RAW 264.7 cells (F).
TGF inhibits LPS induction of TNF via FXR1 T. K. Khera et al.
2758 FEBS Journal 277 (2010) 2754–2765 ª 2010 The Authors Journal compilation ª 2010 FEBS
MAPK signalling with specific inhibitors in both a
macrophage cell line and primary macrophages treated
with LPS led to an increase in FXR1 expression simi-
lar to that seen in cells treated with TGF-b1, indicat-
ing that this pathway plays a role in the control of
FXR1.
It is also notable that TGF-b1 did not change the
expression of HuA and TIA-1, although it did lead to a
significant reduction in TTP mRNA expression, either
on its own or in combination with LPS (Fig. 3C), in
contrast to previously published data showing that
TGF-b1 can increase TTP expression in a T-cell line
and a human monocytic cell line [53]. The reduction of
TTP expression by TGF-b1 is difficult to explain, but
A
C

B
Fig. 5. Overexpression of FXR1 suppresses LPS-induced TNF-a
protein production. RAW 264.7 cells were transfected with the
RFP-OE or FXR1-OE plasmid and cultured in the presence of G418
for 4 weeks. FXR1 protein was detected by western blot (A), and
FXR1 mRNA expression was quantified using Q-PCR and normal-
ized using GAPDH; n =3, *P < 0.05 (B). RFP-OE and FXR1-OE
cells were cultured with or without 100–1 ngÆmL
)1
LPS for 4 h in
the presence of GolgiPlug. Intracellular analysis of TNF-a was
carried out by flow cytometry (C); n = 3–4, *P < 0.05.
a) RAW 264.7 cells
b) FXR1-OE cells
None
Control
siRNA 1
siRNA 2
siRNA 3
FXR1
Actin
FXR1
Actin
B
A
1.2
1
0.8
0.6
0.4

0.2
0
FXRI mRNA
Control siRNA
125
100
75
50
25
0
Control
TNF-α (%)
siRNA
*
*
TGF-β1/LPS
LPS
C
Fig. 4. FXR1 is necessary for TGF-b1-mediated suppression of
LPS-induced TNF-a production. RAW 264.7 cells were transfected
with 50 n
M control siRNA or siRNA targeting FXR1 for 24 h (A).
TGF-b1, 10 ngÆ mL
)1
, was added 1 h prior to quantification of FXR1
mRNA expression by Q-PCR to induce FXR1 expression. The
results were normalized using GAPDH; n =3,*P < 0.05. FXR1 pro-
tein was also detected by western blot (Ba), using three siRNAs
that target FXR1. FXR1-OE cells were transfected with siRNA as
described, and, after 24 h, FXR1 protein was detected by western

blot (Bb). RAW 264.7 cells were transfected with siRNA, and, after
24 h, 100 ngÆmL
)1
LPS was added plus 10 ngÆmL
)1
TGF-b1 for 4 h
in the presence of GolgiPlug (C). Intracellular TNF-a was quantified
by flow cytometry; n =3,*P > 0.05.
T. K. Khera et al. TGF inhibits LPS induction of TNF via FXR1
FEBS Journal 277 (2010) 2754–2765 ª 2010 The Authors Journal compilation ª 2010 FEBS 2759
is worthy of further investigation, as TTP is a negative
regulator of TNF-a. On the other hand, TGF-b1, but
not LPS alone, significantly increased FXR1 expres-
sion, whereas LPS in combination with TGF-b1 fur-
ther increased FXR1 expression. FXR1 is known to
bind to the TNF-a mRNA ARE and suppress transla-
tion [21]. Other mRNA-binding proteins, such as TTP,
are known to be controlled by phosphorylation by p38
MAPK ⁄ MK2. There is evidence suggesting that phos-
phorylation of another member of the FXR1 family,
Fragile X mental retardation protein, on Ser 144 may
be important in translational repression [54], but the
effects of phosphorylation of FXR1 are unknown. In
this article, we have shown that inhibition of the p38
MAPK pathway can upregulate FXR1, but the mecha-
nism for this remains unknown and is under investiga-
tion. It is also possible that other anti-inflammatory
cytokines may also upregulate FXR1, leading to post-
transcriptional regulation of TNF-a and possibly other
proinflammatory cytokines. This remains an area for

further investigation. FXR1 is intimately involved in
mRNA regulation, but there are other mechanisms in
which it may play a role. It will be important to deter-
mine whether the reported association of FXR1 with
the RNA-induced silencing complex protein AGO2 is
critical to its action [39,55,56]. This work shows the
induction of FXR1 by the regulatory cytokine TGF-
b1. We have focused on the downstream effects of
FXR1 on TNF-a, but it is likely that other cytokines
will also be regulated by the same mechanisms. In
other experiments, IL-6 has been reported to be a tar-
get for FXR1 [21], and investigation of further poten-
tial targets is ongoing.
Little is known about FXR1 in human disease, in
which it has not been extensively investigated,
although it has been identified as an autoantigen in
systemic sclerosis [57]. We also have scant information
on the significance that the different isoforms of FXR1
have in terms of function. Although these have been
characterized carefully at the molecular level [40], their
patterns of expression in inflammatory disease remain
to be investigated. TNF-a overproduction has been
shown to be an important driving force in many auto-
immune diseases, including rheumatoid arthritis [58],
uveitis [59], multiple sclerosis [60,61], and inflamma-
tory bowel disease [62]. Blockade of TNF-a in autoim-
mune disease has been successfully introduced into the
clinic for some of these conditions. In many instances,
however, these treatments have been associated with
impaired host defence against infections [63–65].

Understanding the role that FXR1 plays in the control
of TNF-a by TGF-b1 could allow the development of
therapies that complement the blockade of TNF-a,to
give full efficacy while reducing unwanted side effects.
The study of RNA-binding proteins is therefore essen-
tial for the understanding of intracellular regulatory
pathways and molecular mechanisms of pathology.
Experimental procedures
BMDMu
C57BL ⁄ 6 Ly.5.2 congenic mice were obtained from Charles
River Laboratories (Margate, UK), and were reared under
specific pathogen-free conditions. The mice were maintained
in accordance with the Home Office Regulations for
A
C
B
D
Fig. 6. Inhibition of the p38 MAPK pathway
can induce FXR1 protein production in
LPS-treated macrophages. RAW 264.7 cells
were cultured with 100 ngÆmL
)1
LPS for 4 h
plus SB203580. FXR1 protein was detected
by western blot (A), and relative FXR1
mRNA expression was quantified by Q-PCR
(B). The results were normalized using
GAPDH; n =3,*P < 0.05. RAW 264.7 cells
were also cultured with 100 ngÆmL
)1

LPS
for 4 h plus either the negative control
inhibitor SB202474 or the MAPKAP kinase 2
inhibitor, and this was followed by FXR1
mRNA quantification by Q-PCR; n = 3 (C).
BMDMu were cultured with 100 ng Æ mL
)1
LPS for 4 h plus either the negative control
inhibitor SB202474, SB203580, or the
MAPKAP kinase 2 inhibitor, and this was
followed by FXR1 mRNA quantification by
Q-PCR; n = 3 (D).
TGF inhibits LPS induction of TNF via FXR1 T. K. Khera et al.
2760 FEBS Journal 277 (2010) 2754–2765 ª 2010 The Authors Journal compilation ª 2010 FEBS
Animal Experimentation, UK. Bone marrow cells were
obtained by flushing the femurs of mice, and the cells were
cultured as previously described [66] in hydrophobic Teflon
bags in DMEM containing 10% heat-inactivated fetal
bovine serum, 5% normal horse serum, and the superna-
tant of macrophage colony-stimulating factor-secreting
L929 fibroblasts at a final concentration of 15% (v ⁄ v) for
8 days at 37 °C in the presence of 5% CO
2
.
RAW 264.7 cell culture
The RAW 264.7 murine cell line was cultured in DMEM
supplemented with 10% fetal bovine serum, 10 UÆmL
)1
penicillin, 10 lgÆmL
)1

streptomycin, and 2 mml-glutamine
(all from Invitrogen, Paisley, UK). Cells were maintained at
37 °C in the presence of 5% CO
2
.
Inhibitors
SB203580 was purchased from Promega. The negative con-
trol inhibitor SB2025880 and MAPKAP kinase 2 (Hsp25)
inhibitor were purchased from Calbiochem (Nottingham,
UK).
Stable cell lines
RAW 264.7 cells were electroporated at 300 V and 960 l F
with plasmids containing RFP or FXR1 on the CMV pro-
moter (Cambridge Biosciences, Cambridge, UK). After
24 h, 500 lgÆmL
)1
G418 (Sigma Aldrich, Dorset, UK) was
added to the medium [67], and cells were used after 4 weeks
of culture.
Flow cytometry
Cells were seeded in macrophage serum-free medium (Invi-
trogen, Paisley, UK). The cells were treated with TGF-b1
(R&D Systems, Abingdon, UK) or LPS (Sigma Aldrich,
Dorset, UK) at the concentrations stated for 4 h in the
presence of 1 lgÆmL
)1
GolgiPlug (BD Bioscience, Oxford,
UK). The cells were washed in buffer containing a balanced
salt solution with 0.1% BSA and 0.08% azide (Media Ser-
vices, University of Bristol, UK), and fixed using Cyto-

fix ⁄ Cytoperm according to the manufacturer’s instructions
(BD Pharmingen, Oxford, UK). The cells were stained with
rat anti-mouse TNF-a-APC Ig, IgG1 isotype (clone MP6-
XT22; BD Pharmingen, Oxford, UK). Analysis was carried
out using a FACS Canto II and FACS diva 5.0.2 software
(BD Biosciences, San Jose, CA, USA). The data are shown
as percentage change, using the geometric mean values,
with control, nontreated cells set at 0%, and cells treated
with only LPS set at 100%.
ELISA
Cells were seeded in macrophage serum-free medium and
treated with TGF-b1 or LPS at the concentrations stated
for 4 h. TNF-a in the supernatant was measured by ELISA
according to the manufacturer’s protocol (R&D Systems,
Abingdon, UK).
Q-PCR
Alterations in mRNA expression were examined by Q-PCR,
using Power SYBR Green PCR Master Mix (Applied
Biosystems, Warrington, UK), performed using specific
oligonucleotide primers (Table 1, from Sigma Genosys,
Dorset, UK) and StepOnePlus (Applied Biosystems, War-
rington, UK). Glyceraldehyde-3-phosphate dehydrogenase
(GAPDH) was used as a control to normalize the results.
Luciferase assay
The 3¢-UTR of TNF-a was cloned using the following prim-
ers: forward, 5¢-CCCGACTACGTGCTCCTCAC-3¢; and
reverse, 5¢-TTTATTTCTCTCAATGACCCGT-3¢ (Sigma
Table 1. Primers: names and sequences of primers used for Q-PCR. The sequences from the database RT ( />rtprimerdb/) were used.
Name Sequence (5¢–3¢) RT database
GAPDH Forward: TTCACCACCATGGAGAAGGC

Reverse: GGCATGGACTGTGGTCATGA
RTPrimerDB 2920
FXR1 Forward: ATAATTGGCAACCAGAACGCCAGG
Reverse: CCACATGGCTCTTGGTCATTTGCT
–
TNF-a Forward: CATCTTCTCAAAATTCGAGTGACAA
Reverse: TGGGAGTAGACAAGGTACAACCC
RTPrimerDB 147
TTP Forward: TGCAATAACCCATTTCCCTGGTGC
Reverse: TAGGAACGGATCCACCCAAACACT
–
TIA-1 Forward: TTGTCAGCACACAGCGTTCACAAG
Reverse: AGGCTGCTTTGATGTCTTCGGTTG
–
HuA Forward: ACTGCAGGGATGACATTGGGAGAA
Reverse: AAGCTTTGCAGATTCAACCTCGCC
–
T. K. Khera et al. TGF inhibits LPS induction of TNF via FXR1
FEBS Journal 277 (2010) 2754–2765 ª 2010 The Authors Journal compilation ª 2010 FEBS 2761
Genosys, Dorset, UK). The PCR product was purified using
the QIAquick PCR purification kit (Qiagen, Crawley, UK)
and inserted into the XbaI site in the pGL3 control vector
(Promega, Southampton, UK). The plasmid was amplified
in Top10 Escherichia coli (Invitrogen, Paisley, UK) and
purified using the HiSpeed Plasmid Midikit (Qiagen). A
Renilla plasmid (pRL–TK–renilla; Promega) was used as a
control. RAW 264.7 cells were seeded to a density of
1.5 · 10
6
cells per well in a six-well plate on the day before

transfection, in DMEM containing l-glutamine only. On the
day of transfection, the cells were washed in Optimem med-
ium (Invitrogen). The plasmids were prepared for transfec-
tion [per well, in a 1.5 mL tube: 20 lL of Optimem, 5 lgof
each plasmid, and 6 lL of Lipofectamine LTX (Invitrogen)
and incubated at room temperature for 30 min. This mixture
was then added slowly to cells in 1 mL of Optimem. The
cytokines were added on the next day, and luciferase activity
was measured.
Western blot
FXR1 protein was examined by western blot analysis, using
standard methodologies with a polyclonal antibody against
FXR1 raised in goats (ab51970; Abcam, Cambridge, UK).
An polyclonal antibody against actin, also raised in goats,
was used as a control (Santa Cruz Biotechnology, Heidel-
berg, Germany). Briefly, cells were scraped off into NaCl ⁄ P
i
before resuspension of the pellet in cell lysis buffer (Cell
Signaling Technology, Hitchin, UK). The protein was pre-
pared in SDS sample buffer, and boiled for 5 min prior to
loading onto 10% SDS ⁄ PAGE gels. After electrophoresis,
the separated proteins were transferred to a nitrocellulose
membrane (Amersham Pharmacia, Biotech UK Ltd, Little
Chalfont, UK). The membrane was blocked with NaCl ⁄
Tris containing 5% BSA for 1 h, and then incubated with
the primary antibody overnight at 4 °C. The blots were
subsequently washed in NaCl ⁄ Tris-Tween, and then incu-
bated with an appropriate horseradish peroxidase-conju-
gated secondary antibody (Santa Cruz Biotechnology).
Proteins were visualized by enhanced chemiluminescence

(Amersham, Little Chalfont, UK), according to the manu-
facturer’s instructions.
siRNA
Cells were plated in a six-well plate at a density of
1 · 10
6
cells per well overnight in DMEM containing 2 mm
l-glutamine only. On the following day, the cells were
washed with Optimem and transfected using Lipofectamine
RNAiMax (Invitrogen) with 50 nm control siRNA
(BLOCK-iT Alexa Fluor Red Fluorescent Control; Invitro-
gen) or FXR1 siRNA (Invitrogen) for 24 h. The following
FXR1 siRNA sequences were used: siRNA 1, 5¢-GGG
CCC UAA UUA CAC CUC CGG UUA U-3¢; siRNA 2,
5¢-GCA AUC CAU ACA GCU UAC UUG AUA A-3¢;and
siRNA 3, 5¢-GAA GUU GAU GCU UAU GUC CAG
AAA U-3¢.
Statistical analysis
Results are expressed as mean ± standard error of the
mean. The Mann–Whitney U-test, two-tailed, was used to
determine significance.
Acknowledgements
The flow cytometric analysis was carried out with
assistance from Dr A. Herman and Mr T. Curry, Flow
Cytometry Facility, Cellular and Molecular Medicine,
Bristol University. The authors would like to thank
Professor N. Perkins, University of Bristol, for review-
ing the manuscript. Mr O. Whitton assisted with the
preparation for publication of this manuscript. This
work was supported by grants from the National Eye

Research Centre (NERC) and the James Tudor Foun-
dation, and a Royal College of Pathologists ⁄ Jean
Shanks Foundation Pilot Award.
References
1 Vassalli P (1992) The pathophysiology of tumor necro-
sis factors. Annu Rev Immunol 10, 411–452.
2 Beutler B, Greenwald D, Hulmes JD, Chang M, Pan
YC, Mathison J, Ulevitch R & Cerami A (1985)
Identity of tumour necrosis factor and the macrophage-
secreted factor cachectin. Nature 316, 552–554.
3 Tincani A, Andreoli L, Bazzani C, Bosiso D & Sozzani S
(2007) Inflammatory molecules: a target for treatment of
systemic autoimmune diseases. Autoimmun Rev 7, 1–7.
4 Clark IA (2007) How TNF was recognized as a key
mechanism of disease. Cytokine Growth Factor Rev 18,
335–343.
5 Waage A, Halstensen A & Espevik T (1987) Associa-
tion between tumour necrosis factor in serum and fatal
outcome in patients with meningococcal disease. Lancet
1, 355–357.
6 Tracey KJ, Beutler B, Lowry SF, Merryweather J,
Wolpe S, Milsark IW, Hariri RJ, Fahey TJ 3rd,
Zentella A, Albert JD et al. (1986) Shock and tissue
injury induced by recombinant human cachectin.
Science 234, 470–474.
7 Parrillo JE (1993) Pathogenetic mechanisms of septic
shock. N Engl J Med 328, 1471–1477.
8 Cohen J (2002) The immunopathogenesis of sepsis.
Nature 420, 885–891.
9 Weil D, Brosset S & Dautry F (1990) RNA processing

is a limiting step for murine tumor necrosis factor beta
expression in response to interleukin-2. Mol Cell Biol
10, 5865–5875.
TGF inhibits LPS induction of TNF via FXR1 T. K. Khera et al.
2762 FEBS Journal 277 (2010) 2754–2765 ª 2010 The Authors Journal compilation ª 2010 FEBS
10 Moreira AL, Sampaio EP, Zmuidzinas A, Frindt P,
Smith KA & Kaplan G (1993) Thalidomide exerts its
inhibitory action on tumor necrosis factor alpha by
enhancing mRNA degradation. J Exp Med 177, 1675–
1680.
11 Han J, Huez G & Beutler B (1991) Interactive effects of
the tumor necrosis factor promoter and 3¢-untranslated
regions. J Immunol 146, 1843–1848.
12 Han J, Brown T & Beutler B (1990) Endotoxin-respon-
sive sequences control cachectin ⁄ tumor necrosis factor
biosynthesis at the translational level. J Exp Med 171,
465–475.
13 Biragyn A & Nedospasov SA (1995) Lipopolysaccha-
ride-induced expression of TNF-alpha gene in
the macrophage cell line ANA-1 is regulated at the
level of transcription processivity. J Immunol 155,
674–683.
14 Asirvatham AJ, Gregorie CJ, Hu Z, Magner WJ &
Tomasi TB (2008) MicroRNA targets in immune genes
and the Dicer ⁄ Argonaute and ARE machinery compo-
nents. Mol Immunol 45, 1995–2006.
15 Kontoyiannis D, Pasparakis M, Pizarro TT, Cominelli
F & Kollias G (1999) Impaired on ⁄ off regulation of
TNF biosynthesis in mice lacking TNF AU-rich ele-
ments: implications for joint and gut-associated immun-

opathologies. Immunity 10, 387–398.
16 Zhang W, Wagner BJ, Ehrenman K, Schaefer AW,
DeMaria CT, Crater D, DeHaven K, Long L &
Brewer G (1993) Purification, characterization, and
cDNA cloning of an AU-rich element RNA-binding
protein, AUF1. Mol Cell Biol 13, 7652–7665.
17 Vasudevan S, Tong Y & Steitz JA (2008) Cell-cycle
control of microRNA-mediated translation regulation.
Cell Cycle 7, 1545–1549.
18 Piecyk M, Wax S, Beck AR, Kedersha N, Gupta M,
Maritim B, Chen S, Gueydan C, Kruys V, Streuli M,
et al. (2000) TIA-1 is a translational silencer that selec-
tively regulates the expression of TNF-alpha. EMBO J
19, 4154–4163.
19 Lai WS, Carballo E, Strum JR, Kennington EA, Phil-
lips RS & Blackshear PJ (1999) Evidence that triste-
traprolin binds to AU-rich elements and promotes the
deadenylation and destabilization of tumor necrosis fac-
tor alpha mRNA. Mol Cell Biol 19, 4311–4323.
20 Gueydan C, Droogmans L, Chalon P, Huez G, Caput
D & Kruys V (1999) Identification of TIAR as a pro-
tein binding to the translational regulatory AU-rich
element of tumor necrosis factor alpha mRNA. J Biol
Chem 274, 2322–2326.
21 Garnon J, Lachance C, Di Marco S, Hel Z, Marion D,
Ruiz MC, Newkirk MM, Khandjian EW & Radzioch
D (2005) Fragile X-related protein FXR1P regulates
proinflammatory cytokine tumor necrosis factor expres-
sion at the post-transcriptional level. J Biol Chem 280,
5750–5763.

22 Dean JL, Wait R, Mahtani KR, Sully G, Clark AR &
Saklatvala J (2001) The 3¢ untranslated region of tumor
necrosis factor alpha mRNA is a target of the mRNA-
stabilizing factor HuR. Mol Cell Biol 21, 721–730.
23 Bardoni B, Schenck A & Mandel JL (2001) The Frag-
ile X mental retardation protein. Brain Res Bull 56,
375–382.
24 Miyazono K (2000) Positive and negative regulation of
TGF-beta signaling. J Cell Sci 113, 1101–1109.
25 Dijke PT & Hill CS (2004) New insights into
TGF-b-Smad signalling. Trends Biochem Sci 29,
265–273.
26 Monteleone G, Kumberova A, Croft NM, McKenzie
C, Steer HW & MacDonald TT (2001) Blocking Smad7
restores TGF-beta1 signaling in chronic inflammatory
bowel disease. J Clin Invest 108, 601–609.
27 MacDonald TT (1999) Effector and regulatory lym-
phoid cells and cytokines in mucosal sites. Curr Top
Microbiol Immunol 236, 113–135.
28 Thorbecke GJ, Shah R, Leu CH, Kuruvilla AP, Hardi-
son AM & Palladino MA (1992) Involvement of endog-
enous tumor necrosis factor alpha and transforming
growth factor beta during induction of collagen type II
arthritis in mice. Proc Natl Acad Sci USA 89, 7375–
7379.
29 Mendez-Samperio P, Hernandez-Garay M & Nunez
Vazquez A (1998) Inhibition of Mycobacterium
bovis BCG-induced tumor necrosis factor alpha
secretion in human cells by transforming growth factor
beta. Clin Diagn Lab Immunol 5, 588–591.

30 Dlugovitzky D, Bay ML, Rateni L, Urizar L, Rondelli
CF, Largacha C, Farroni MA, Molteni O & Bottaso
OA (1999) In vitro synthesis of interferon-gamma, inter-
leukin-4, transforming growth factor-beta and interleu-
kin-1 beta by peripheral blood mononuclear cells from
tuberculosis patients: relationship with the severity of
pulmonary involvement. Scand J Immunol 49, 210–217.
31 D’Andrea A, Ma X, Aste-Amezaga M, Paganin C &
Trinchieri G (1995) Stimulatory and inhibitory effects
of interleukin (IL)-4 and IL-13 on the production of
cytokines by human peripheral blood mononuclear
cells: priming for IL-12 and tumor necrosis factor alpha
production. J Exp Med 181, 537–546.
32 Chantry D, Turner M, Abney E & Feldmann M
(1989) Modulation of cytokine production by
transforming growth factor-beta. J Immunol 142,
4295–4300.
33 Dai Y, Datta S, Novotny M & Hamilton TA (2003)
TGFbeta inhibits LPS-induced chemokine mRNA
stabilization. Blood 102, 1178–1185.
34 Hausmann EH, Hao SY, Pace JL & Parmely MJ (1994)
Transforming growth factor beta 1 and gamma
interferon provide opposing signals to lipopolysaccha-
ride-activated mouse macrophages. Infect Immun 62,
3625–3632.
T. K. Khera et al. TGF inhibits LPS induction of TNF via FXR1
FEBS Journal 277 (2010) 2754–2765 ª 2010 The Authors Journal compilation ª 2010 FEBS 2763
35 Bogdan C, Paik J, Vodovotz Y & Nathan C (1992)
Contrasting mechanisms for suppression of macrophage
cytokine release by transforming growth factor-beta and

interleukin-10. J Biol Chem 267 , 23301–23308.
36 Grzybowska EA, Wilczynska A & Siedlecki JA (2001)
Regulatory functions of 3¢UTRs. Biochem Biophys Res
Commun 288, 291–295.
37 Fairhurst A-M, Connolly J, Hintz K, Goulding N,
Rassias A, Yeager M, Rigby W & Wallace P (2003)
Regulation and localization of endogenous human
tristetraprolin. Arthritis Res Ther 5, R214–R225.
38 Carballo E, Lai WS & Blackshear PJ (1998) Feedback
inhibition of macrophage tumor necrosis factor-alpha
production by tristetraprolin. Science 281, 1001–
1005.
39 Vasudevan S & Steitz JA (2007) AU-rich-element-medi-
ated upregulation of translation by FXR1 and Argona-
ute 2. Cell 128, 1105–1118.
40 Kirkpatrick LL, McIlwain KA & Nelson DL (1999)
Alternative splicing in the murine and human FXR1
genes. Genomics 59, 193–202.
41 Sivalingam SP, Thumboo J, Vasoo S, Thio ST, Tse C
& Fong KY (2007) In vivo pro- and anti-inflammatory
cytokines in normal and patients with rheumatoid
arthritis. Ann Acad Med Singapore 36, 96–99.
42 Miossec P, Naviliat M, Dupuy d’Angeac A, Sany J &
Banchereau J (1990) Low levels of interleukin-4 and
high levels of transforming growth factor beta in
rheumatoid synovitis. Arthritis Rheum 33, 1180–1187.
43 Katsikis PD, Chu CQ, Brennan FM, Maini RN &
Feldmann M (1994) Immunoregulatory role of interleu-
kin 10 in rheumatoid arthritis. J Exp Med 179,
1517–1527.

44 Bucht A, Larsson P, Weisbrot L, Thorne C, Pisa P,
Smedegard G, Keystone EC & Gronberg A (1996)
Expression of interferon-gamma (IFN-gamma), IL-10,
IL-12 and transforming growth factor-beta (TGF-
beta) mRNA in synovial fluid cells from patients in
the early and late phases of rheumatoid arthritis
(RA). Clin Exp Immunol 103, 357–367.
45 Robertson M, Liversidge J, Forrester JV & Dick AD
(2003) Neutralizing tumor necrosis factor-alpha activity
suppresses activation of infiltrating macrophages in
experimental autoimmune uveoretinitis. Invest Ophthal-
mol Vis Sci 44, 3034–3041.
46 Shakoor N, Michalska M, Harris CA & Block JA
(2002) Drug-induced systemic lupus erythematosus asso-
ciated with etanercept therapy. Lancet 359, 579–580.
47 Criscione LG & St Clair EW (2002) Tumor necrosis
factor-alpha antagonists for the treatment of rheumatic
diseases. Curr Opin Rheumatol 14, 204–211.
48 Dick AD, McMenamin PG, Korner H, Scallon BJ,
Ghrayeb J, Forrester JV & Sedgwick JD (1996)
Inhibition of tumor necrosis factor activity minimizes
target organ damage in experimental autoimmune
uveoretinitis despite quantitatively normal activated
T cell traffic to the retina. Eur J Immunol 26, 1018–
1025.
49 Greiner K, Murphy CC, Willermain F, Duncan L,
Plskova J, Hale G, Isaacs JD, Forrester JV & Dick AD
(2004) Anti-TNFalpha therapy modulates the pheno-
type of peripheral blood CD4 + T cells in patients
with posterior segment intraocular inflammation. Invest

Ophthalmol Vis Sci 45, 170–176.
50 Brook M, Sully G, Clark AR & Saklatvala J (2000)
Regulation of tumour necrosis factor alpha mRNA
stability by the mitogen-activated protein kinase p38
signalling cascade. FEBS Lett 483, 57–61.
51 Ming XF, Stoecklin G, Lu M, Looser R & Moroni C
(2001) Parallel and independent regulation of interleu-
kin-3 mRNA turnover by phosphatidylinositol 3-kinase
and p38 mitogen-activated protein kinase. Mol Cell Biol
21
, 5778–5789.
52 Holtmann H, Winzen R, Holland P, Eickemeier S,
Hoffmann E, Wallach D, Malinin NL, Cooper JA,
Resch K & Kracht M (1999) Induction of interleukin-8
synthesis integrates effects on transcription and mRNA
degradation from at least three different cytokine- or
stress-activated signal transduction pathways. Mol Cell
Biol 19, 6742–6753.
53 Ogawa K, Chen F, Kim Y-J & Chen Y (2003) Tran-
scriptional regulation of tristetraprolin by transforming
growth factor-b in human T cells. J Biol Chem 278,
30373–30381.
54 Ceman S, O’Donnell WT, Reed M, Patton S, Pohl J &
Warren ST (2003) Phosphorylation influences the trans-
lation state of FMRP-associated polyribosomes. Hum
Mol Genet 12, 3295–3305.
55 Jin P, Zarnescu DC, Ceman S, Nakamoto M, Mowrey
J, Jongens TA, Nelson DL, Moses K & Warren ST
(2004) Biochemical and genetic interaction between the
fragile X mental retardation protein and the microRNA

pathway. Nat Neurosci 7, 113–117.
56 Caudy AA, Myers M, Hannon GJ & Hammond SM
(2002) Fragile X-related protein and VIG associate with
the RNA interference machinery. Genes Dev 16, 2491–
2496.
57 Bolivar J, Guelman S, Iglesias C, Ortiz M & Valdivia
MM (1998) The fragile-X-related gene FXR1 is a
human autoantigen processed during apoptosis. J Biol
Chem 273, 17122–17127.
58 Tetta C, Camussi G, Modena V, Di Vittorio C &
Baglioni C (1990) Tumour necrosis factor in serum and
synovial fluid of patients with active and severe rheuma-
toid arthritis. Ann Rheum Dis 49, 665–667.
59 Santos Lacomba M, Marcos Martin C, Gallardo Gal-
era JM, Gomez Vidal MA, Collantes Estevez E, Ra-
mirez Chamond R & Omar M (2001) Aqueous humor
and serum tumor necrosis factor-alpha in clinical uve-
itis. Ophthalmic Res 33, 251–255.
TGF inhibits LPS induction of TNF via FXR1 T. K. Khera et al.
2764 FEBS Journal 277 (2010) 2754–2765 ª 2010 The Authors Journal compilation ª 2010 FEBS
60 Horwitz DA (2006) Transforming growth factor-beta:
taking control of T cells’ life and death. Immunity 25,
399–401.
61 Hofman FM, Hinton DR, Johnson K & Merrill JE
(1989) Tumor necrosis factor identified in multiple
sclerosis brain. J Exp Med 170, 607–612.
62 Van Deventer SJ (1997) Tumour necrosis factor and
Crohn’s disease. Gut 40, 443–448.
63 Nancy RS, Sharon KG, Jong-Hoon L, Evelyne TE &
Braun MM (2003) Listeria monocytogenes infection as

a complication of treatment with tumor necrosis
factor alpha-neutralizing agents. Arthritis Rheum 48,
319–324.
64 Keane J, Gershon S, Wise RP, Mirabile-Levens E,
Kasznica J, Schwieterman WD, Siegel JN & Braun
MM (2001) Tuberculosis associated with infliximab, a
tumor necrosis factor alpha-neutralizing agent. N Engl
J Med 345, 1098–1104.
65 Lee J-H, Slifman NR, Gershon SK, Edwards ET,
Schwieterman WD, Siegel JN, Wise RP, Brown SL,
Udall JN Jr. & Braun MM (2002) Life-threatening his-
toplasmosis complicating immunotherapy with tumor
necrosis factor alpha antagonists infliximab and etaner-
cept. Arthritis Rheum 46, 2565–2570.
66 Munder M, Eichmann K & Modolell M (1998) Alterna-
tive metabolic states in murine macrophages reflected
by the nitric oxide synthase ⁄ arginase balance: competi-
tive regulation by CD4 + T cells correlates with
Th1 ⁄ Th2 phenotype. J Immunol 160, 5347–5354.
67 Gough PJ, Garden S & Greaves DR (2001) The use of
human CD68 transcriptional regulatory sequences to
direct high-level expression of class A scavenger recep-
tor in macrophages in vitro and in vivo. Immunology
103, 351–361.
Supporting information
The following supplementary material is available:
Fig. S1. Dose-dependent induction of TNF-a expres-
sion by LPS.
This supplementary material can be found in the
online version of this article.

Please note: Wiley-Blackwell is not responsible for
the content or functionality of any supplementary
material supplied by the authors. Any queries (other
than missing material) should be directed to the corre-
sponding author for the article.
T. K. Khera et al. TGF inhibits LPS induction of TNF via FXR1
FEBS Journal 277 (2010) 2754–2765 ª 2010 The Authors Journal compilation ª 2010 FEBS 2765