Báo cáo khoa học: Long-term extracellular signal-related kinase activation following cadmium intoxication is negatively regulated by a protein kinase C-dependent pathway affecting cadmium transport ppt

Long-term extracellular signal-related kinase activation
following cadmium intoxication is negatively regulated
by a protein kinase C-dependent pathway affecting
cadmium transport
Patrick Martin, Kim E. Boulukos, Marie C. Poggi and Philippe Pognonec
CNRS FRE3094, Universite
´
de Nice Sophia Antipolis, France
Among the proteins known to play key roles in cell
physiology, extracellular signal-related kinase (ERK) is
one of the most widely studied. Originally character-
ized as a protein responding to mitogenic stimulation
by phosphorylation on tyrosine residues [1], ERK is a
downstream substrate of the proto-oncogene Raf [2].
ERK rapidly became identified as a central kinase
involved in signal transduction pathways [3]. ERK is
predominantly viewed as a kinase responsible for cell
growth [4] and ⁄ or protection against apoptosis [5].
Typical ERK activation is associated with strong and
rapid phosphorylation within minutes following stimu-
lation, and with a more modest but persistent activa-
tion that can last for up to a few hours [6]. More
recently, a new type of ERK activity has been reported
that surprisingly links ERK activation to cell death.
This novel function of ERK in cell death has been
observed in certain cell types and organs, including
Keywords
cadmium; extracellular signal-related kinase
(ERK); protein kinase C (PKC); sustained
activation; ZIP8
Correspondence

P. Pognonec, Transcriptional Regulation and
Differentiation, CNRS FRE3094, Universite
´
de Nice, Parc Valrose, 06108 Nice cedex 2,
France
Fax ⁄ Tel: +33 492 07 64 13
E-mail:
(Received 16 September 2008, revised 12
December 2008, accepted 12 January 2009)
doi:10.1111/j.1742-4658.2009.06899.x
Extracellular signal-related kinase (ERK) is a well-known kinase taking
part in a signal transduction cascade in response to extracellular stimuli.
ERK is generally viewed as a kinase that is rapidly and transiently phos-
phorylated following mitogenic stimulation. This activation results in ERK
phosphorylating further downstream targets, thus transmitting and ampli-
fying the original stimulus, and ultimately resulting in the onset of cellular
proliferation and ⁄ or protection against apoptosis. More recently, several
groups have identified a strikingly new type of ERK activation that results
in cell death. This activation is very different from conventional ERK acti-
vation, as it occurs several hours after the original stimulation, and results
in the sustained phosphorylation of ERK, which can be observed for up to
several days. One way of inducing this delayed ERK activation is by low-
dose cadmium treatment. We show here that sustained ERK activation
induced by cadmium in human kidney-derived cells is inhibited following
protein kinase C (PKC) activation, even when this activation occurs hours
before intoxication. Furthermore, PKC inhibition results in an enhanced
ERK activation in response to cadmium, even when inhibition is induced
hours before intoxication. PKCe appears to be the most implicated isotype
in this phenomenon. Finally, we present evidence suggesting that the ZIP8
transporter is involved in this process, as multiple small interfering RNAs

against ZIP8 have a protective effect against cadmium treatment. Our
results indicate that PKC activation negatively affects ZIP8 transporter
activity, thus protecting cells against cadmium poisoning.
Abbreviations
eGFP, enhanced green fluorescent protein; ERK, extracellular signal-related kinase; GFP, green fluorescent protein; P-ERK, phosphorylated
extracellular signal-related kinase; PKC, protein kinase C; PMA, 4b-phorbol 12-myristate 13-acetate; siRNA, small interfering RNA.
FEBS Journal 276 (2009) 1667–1679 ª 2009 The Authors Journal compilation ª 2009 FEBS 1667
neurons in various neurodegeneration models, brain
injury resulting from ischemia–reperfusion [7–9], and
myeloid leukemic cells following cisplatin chemother-
apy [10]. An elegant study relying on a Raf-estrogen
receptor (Raf–ER) chimera also demonstrated that
induced sustained ERK activation indeed results in
apoptosis in vitro [11]. The common point found in
ERK-associated cell death appears to be an unconven-
tional activation of ERK, which can remain phosphor-
ylated for up to several days. We recently identified
another way of activating ERK-induced cell death by
treating cells with cadmium [12]. Low concentrations of
cadmium result in a delayed but sustained phosphory-
lation of ERK that is ultimately accompanied by cell
death, suggesting that ERK functions differ depending
upon its kinetics of activation. Supporting this hypoth-
esis are earlier studies concerning proliferation versus
neuronal differentiation of PC12 cells [13,14], in which
the classic transient activation is linked to cell prolifera-
tion, whereas a more sustained activation (lasting for a
few hours) is the trademark of differentiation.
Rapid, transient activation is thus associated with
cell proliferation and protection against apoptosis,

whereas delayed, sustained activation is associated with
cell death. The difference in signaling events leading to
these two distinct patterns of ERK activation remains
largely unexplored. In this study, we began to address
the molecular differences involved in rapid, transient
activation versus sustained activation, following cad-
mium exposure. To explore this, we treated cultured
cells with low doses of cadmium in order to induce
long-term ERK activation, as previously reported [12].
We then compared this activation with that obtained
after treatment with both cadmium and phorbol ester,
a well-known activator of conventional and novel pro-
tein kinase Cs (PKCs) that induces transient ERK acti-
vation. We show that the delayed and sustained
cadmium-dependent ERK activation is strongly inhib-
ited by concomitant treatment or pretreatment of cells
with phorbol ester, and that this inhibition is associ-
ated with better cell survival. Furthermore, we found
that PKCe is the isotype predominantly associated
with the delayed ERK activation in HEK cells. Sur-
prisingly, we show that treatment of cells with a PKC
inhibitor results in an enhanced response of cells to
cadmium and increased phosphorylation of ERK.
Thus, the sustained ERK activation observed after
cadmium treatment is under the negative control of
PKC. We also show that this conventional PKC pro-
tective effect is probably due to a modification of the
ZIP8 cadmium transporter activity. Our results led us
to propose a model comparing the traditional quick
and transient ERK activation with the specifics of this

unconventional cadmium-dependent activation, taking
into account the involvement of the ZIP8 transporter
in this process, as demonstrated by the protective
effect of different ZIP8 small interfering RNAs (siR-
NAs) against cadmium intoxication.
Results
4b-Phorbol 12-myristate 13-acetate (PMA)
protects cells from cadmium toxicity and
inhibits delayed ERK activation
Cell death resulting from low-dose cadmium poisoning
is functionally linked to sustained ERK activation [12].
As ERK is known to be efficiently and transiently acti-
vated by PKC [15], we investigated the effects of the
phorbol ester PMA, a diacylglycerol analog that acti-
vates PKC isoforms, on the cell response to cadmium.
We found that PMA treatment paradoxically rendered
cells resistant to CdCl
2
(Fig. 1A), as cells were dramat-
ically protected from the toxic effects of cadmium.
This protective effect was readily seen 16–24 h after
0.5 and 1 lm exposure, when intoxicated cells became
rounded and started to detach from the plate, while
still metabolizing as seen by 3-(4,5-dimethylthiazol-2-
yl)-2,5-diphenyl-tetrazolium bromide analysis (data not
shown). In contrast, PMA-cotreated cells (MTT, data
not shown) remained phenotypically similar to control
cells, as presented here both visually (Fig. 1A) and
quantitatively (Fig. 1C). More than 90% of the cells
became rounded following 24 h of treatment with

1 lm CdCl
2
, whereas only 23% were affected in the
presence of PMA. When cadmium was applied in the
presence of PMA, and as expected from the pheno-
typic observation, the absolute number of cells also
remained higher than when cadmium was applied
alone (see legend to Fig. 1). To determine the level of
cell toxicity following the different cadmium treat-
ments used throughout this study, we measured the
loss of cell integrity under these different conditions.
As illustrated in Fig. 1C, 14% and 23% of the cells
lost their integrity following 24 h of exposure to 0.5
and 1 lm cadmium, respectively. This indicates that
only a small fraction of the rounded cells visible in
Fig. 1A lost their integrity. Under the highest cad-
mium concentration used later in this study (20 lm
cadmium for 4 h), 9% of the cells lost their integrity
after 4 h of exposure. This relatively moderate effect
after 4 h rapidly increased, as 52% of the cells became
affected after 8 h of exposure to 20 lm.
We next investigated whether the protective effect of
PMA could affect the ERK response to CdCl
2
.Aswe
previously showed that ERK activation following
Cd-induced ERK activation is inhibited by PKC P. Martin et al.
1668 FEBS Journal 276 (2009) 1667–1679 ª 2009 The Authors Journal compilation ª 2009 FEBS
cadmium treatment was clearly detected after 24 h
in HEK cells following exposure to 2 lm CdCl

2
[12],
all ERK activation experiments were performed under
these conditions. As depicted in Fig. 1D, PMA
resulted, as expected, in the conventional early activa-
tion of ERK as seen within 15 min by strong phos-
phorylation that progressively diminished over time to
be practically undetectable 24 h later. On the other
hand, CdCl
2
treatment resulted in the previously
reported delayed activation of ERK (24 h) [12]. Inter-
estingly, when both PMA and CdCl
2
were simulta-
neously applied to cells, early ERK activation
occurred normally, but delayed ERK activation was
strongly diminished. This suggests that PMA treatment
interferes with molecular mechanisms that participate in
sustained ERK activation following CdCl
2
treatment.
PKC isotypes implicated in cadmium-dependent
delayed ERK activation are distinct from those
responsible for ERK short-term activation
As PMA activates both conventional and novel PKCs,
we investigated which particular isozymes are involved
in the PMA protective effect reported here. Three
PKC isozymes are found in HEK cells: PKCa, PKCd
and PKCe. Using siRNA, we knocked down each of

these isotypes, and followed the activation of ERK in
response either to a 30 min PMA treatment or to 24 h
of exposure to 2 lm CdCl
2
. Two prevalidated siRNAs
were used for each isozyme, and gave similar results.
As seen in Fig. 2A, we observed that PKCa knock-
down had the most severe effect on the rapid and
transient ERK response to PMA, whereas PKCd and
PKCe knockdown had a less marked effect as com-
pared to a control experiment using a green fluorescent
protein (GFP) siRNA. This result is in good agree-
ment with a previous report [16], and demonstrates the
validity of the siRNA used in our study. In parallel,
we monitored the activation of PKC using a pan-PKC
antibody directed against the Ser657 hydrophobic site
found in the C-terminal part of PKCa, which detects
the three isotypes present in HEK cells, with an appar-
ent molecular mass in the 80 kDa range. The level of
activated PKC matched the level of phosphorylated
ERK (P-ERK) detected. Interestingly, we found that
in cells treated with CdCl
2
(Fig. 2B), PKCe had the
most dramatic effect on delayed ERK activation,
whereas PKCa and PKCd had more modest effects.
This indicates that the signal transduction cascade
leading to ERK activation following CdCl
2
exposure is

molecularly distinct from the one resulting in short-
term ERK activation, and that PKCe is the most
activated PKC isotype following cadmium exposure.
A
B
C
D
Fig. 1. PMA protects cells against cadmium toxicity and diminishes
cadmium-induced ERK activation. (A) Phenotypic observation of a
PMA protective effect against cadmium toxicity. HEK293 cells were
cultivated and treated with 0, 0.5 or 1 l
M CdCl
2
in the presence of
0 or 100 ngÆmL
)1
PMA. Pictures illustrating the phenotypic modifi-
cations of the cells were taken 24 h following treatment. (B) Deter-
mination of cadmium cytotoxicity on HEK293 cells. HEK293 cells
were treated for the indicated times with the indicated CdCl
2
con-
centrations. Loss of cell integrity was then measured as indicated
in Experimental procedures. The 100% value corresponds to the
measurement of loss of cell integrity following total lysis of the
cells with detergent. (C) Graphical representation of the phenotypic
modification of cells from the experiment depicted in (A). Rounded
cells after PMA treatment are indicated by gray bars, and black
bars represent rounded cells in the absence of PMA treatment.
NS, no significant difference (P > 0.05); ***highly significant

(P < 0.001). Plotted values are from at least 400 counted cells for
each condition, with error bars corresponding to the standard devia-
tion from three independent counts. As compared to control cells
(no PMA, no Cd) set to 100%, cell numbers in the different condi-
tions were: 0.5 l
M, 81%; 1 lM, 65%; PMA ⁄ 0 lM, 96%;
PMA ⁄ 0.5 l
M, 89%; PMA ⁄ 1 lM, 74%. (D) Western blot analysis of
total ERK and P-ERK. HEK293 cells were treated with either 2 l
M
CdCl
2
(Cd), 100 ngÆmL
)1
PMA (PMA) or both (PMA + Cd) for the
indicated times [0 min, 15 min (0.25), 2 h (2), 8 h (8) and 1 day
(24)]. Fifteen micrograms of protein lysates was loaded onto two
parallel gels, and the transferred proteins were analyzed for either
P-ERK or total ERK (ERK).
P. Martin et al. Cd-induced ERK activation is inhibited by PKC
FEBS Journal 276 (2009) 1667–1679 ª 2009 The Authors Journal compilation ª 2009 FEBS 1669
Cadmium treatment results in delayed PKC
activation
We found a delayed and sustained activation of ERK
following CdCl
2
treatment. As PKC is an upstream
kinase in the mitogen-activated protein kinase path-
way, we investigated the possibility that CdCl
2

treat-
ment could directly affect PKC activation. Lysates
from cells exposed to CdCl
2
, PMA or a combination
of both were analyzed by western blotting to investi-
gate the status of ERK and PKC activation. As indi-
cated in Fig. 2C, the PMA-induced PKC
phosphorylation became practically undetectable after
24 h [17], and strong activation of PKC was observed
24 h after CdCl
2
treatment. There is a clear correlation
between PKC activation and ERK activation. Interest-
ingly, at least two reports have already demonstrated
that 24 h of treatment with cadmium activates PKC
[18,19]. Our work confirms these observations, and
indicates that this activation is the likely cause for the
ERK cadmium-dependent delayed activation reported
earlier [12].
PMA-driven PKC activity inhibits
cadmium-dependent delayed ERK activation
To determine whether the PMA protective effect
requires PKC kinase function, we analyzed the effect
of GF 109203X, a specific, broad-spectrum PKC inhib-
itor [20], on the ERK response to cadmium.
GF 109203X is very effective in inhibiting the ERK
response, as 0.3 lm significantly reduced ERK activa-
tion following a 30 min exposure of cells to PMA,
whereas 3 lm totally inhibited ERK activation (data

not shown). Surprisingly, the GF 109203X effect on
delayed ERK activation following cadmium exposure
was a mirror image of its effect on ERK activation fol-
lowing PMA treatment: increasing concentrations of
GF 109203X resulted in a specific and dose-dependent
increase in ERK activation, which was already detect-
able at 0.3 lm and was maximal at 3 lm, whereas
10 lm GF 109203X treatment in the absence of cad-
mium did not result in any ERK activation (Fig. 3A).
GF 109203X concentrations in the low micromolar
range are known to be specific for PKC [20]. Further-
more, we found that the effect of GF 109203X on the
cell response to cadmium dominated that of PMA, as
cotreatment with PMA, GF 109203X and cadmium
gave results similar to those obtained with
GF 109203X and cadmium (Fig. 4 and data not
shown), as expected from the GF 109203X mode of
action on the catalytic site of PKC [20]. Finally, we
found that when GF 109203X was applied up to 24 h
before cadmium (Fig. 3B, ‘)24’), ERK activation was
also stronger than in the absence of the inhibitor,
whereas the addition of the inhibitor 4 h after cad-
mium treatment no longer resulted in strong ERK
activation. Taken together, these results suggest an
inhibitory role for PKC activation in delayed ERK
activation, as blocking of PKC activity resulted in
increased ERK activation in response to cadmium,
A
B
C

Fig. 2. PKCe is the predominant PKC isotype associated with
cadmium response in HEK cells, in contrast to phorbol ester activa-
tion. Western blot analysis of total ERK, P-ERK and activated PKCs.
HEK293 cells transfected 48 h earlier with siRNA against PKCa ,
PKCb, PKCe or GFP were treated either with (A) 100 ngÆmL
)1
phor-
bol ester for 30 min (+) or nothing ()), or with (B) 2 l
M CdCl
2
for
24 h, 2 l
M CdCl
2
and 100 ngÆmL
)1
PMA for 24 h, or nothing.
Fifteen micrograms of protein lysates was loaded onto two parallel
gels, and the transferred proteins were analyzed for either P-ERK
and phosphorylated PKC (P-PKC), or total ERK (ERK). (C) Delayed
PKC activation in response to cadmium treatment. Cells treated
with either 2 l
M CdCl
2
for 24 h, 100 ngÆmL
)1
phorbol ester for 24 h
or 30 min, or nothing. After lysis, 15 lg of total protein was loaded
onto two parallel gels, and the transferred proteins were analyzed
for either P-ERK and activated PKC (P-PKC) or total ERK (ERK).

Cd-induced ERK activation is inhibited by PKC P. Martin et al.
1670 FEBS Journal 276 (2009) 1667–1679 ª 2009 The Authors Journal compilation ª 2009 FEBS
whereas activating of PKC resulted in reduced ERK
activation in response to cadmium.
PKC initiates a hit-and-run process resulting in
cell protection against cadmium toxicity
As GF 109203X enhanced ERK activation even when
applied several hours before cadmium, we investigated
whether PMA could also inhibit ERK activation
when applied several hours before cadmium. Cells
were pretreated with PMA for 8 h, and then exposed
to cadmium for 24 h. This resulted in strongly
reduced activation of ERK as compared to treatment
with cadmium alone, as shown in Fig. 3C (compare
‘Cd’ to ‘PMA then Cd’). This inhibition was similar,
if not stronger, than that observed when PMA and
cadmium were applied simultaneously (Fig. 3C, ‘PMA
and Cd’). This suggests that transient PKC activation
following PMA addition can occur at least 8 h before
cadmium addition, without affecting PMA inhibitory
potential when CdCl
2
is finally added several hours
later.
Although the above experiment clearly demonstrates
that PKC activation can occur 8 h before cadmium
addition and still inhibit delayed ERK activation, we
wanted to determine whether PKC downregulation,
known to occur following PMA treatment [21], partici-
pates in the ERK response to cadmium. To answer

this question, we needed to perform a 16 h PMA pre-
treatment of cells, which is known to completely
downregulate PKC [21]. However, our 2 lm cadmium
condition required a 24 h delay before ERK activation
could be detected, which could be long enough for
PKC to regain its steady-state level after these com-
bined 40 h. In order to stay within a time frame in
which PKC is completely downregulated, we used a
higher cadmium concentration. In the presence of
20 lm cadmium, faster intracellular cadmium accumu-
lation resulted in faster ERK activation, which was
already strong after 4 h (Fig. 3D, left-hand panel),
whereas cytotoxicity remained low (9%; Fig. 1B).
When this higher-concentration cadmium treatment
was performed after a 16 h PMA pretreatment, the
remaining PMA-driven ERK activation seen after 16 h
was still easily detectable (Fig. 3D, ‘0’ in the right-
hand panel), but remained unaffected by the 4 h 20 lm
cadmium treatment. These results indicate that the
strong inhibition of the ERK response to cadmium
observed with an 8 h pretreatment with PMA was also
present when PMA was applied up to 16 h before cad-
mium, even with a 10-fold higher cadmium exposure.
As, at this time, PKC was completely downregulated,
as seen by the total absence of immediate ERK activa-
tion following a second treatment with PMA (data not
shown), the PMA-driven inhibition of the ERK
delayed response to cadmium is likely to reflect a PKC
‘hit-and-run’ effect, whose consequences will protect
cells from subsequent cadmium treatment. This is con-

firmed by GF 109203X, which enhanced the ERK
response to cadmium, even when the inhibitor was
applied up to 24 h before cadmium. In the PKC
siRNA experiment presented in Fig. 2, we nevertheless
observed inhibition of ERK activation following
A

BC
D
Fig. 3. Pharmacological inhibition of PKC enhances delayed and
sustained ERK phosphorylation, whereas PMA pretreatment
reduces the ERK response to cadmium. (A) Western blot analysis
of P-ERK and total ERK (ERK) in HEK293 cells, following a 24 h
treatment with 2 l
M CdCl
2
(Cd, +) in the presence of the indicated
GF 109203X concentrations (GFX, l
M). Fifteen micrograms of pro-
tein lysate was loaded onto two parallel gels, and the transferred
proteins were analyzed for either P-ERK or total ERK. (B) Western
blot analysis of P-ERK and total ERK in HEK293 cells in the pres-
ence (+) or absence ())of2l
M CdCl
2
, and treated or not treated
with 5 l
M GF 109203X 24 h before ()24), simultaneously (0) or 4 h
(+4) after cadmium addition. (C) Western blot analysis of P-ERK
and total ERK in HEK293 cells following no treatment (Ø), 24 h in

the presence of 2 l
M CdCl
2
(Cd), pretreatment with 100 ngÆmL
)1
PMA for 8 h followed by 2 lM CdCl
2
for 24 h (PMA then Cd), or
treatment with 100 ngÆmL
)1
PMA and 2 lM CdCl
2
for 24 h (PMA
and Cd). Fifteen micrograms of protein lysate was loaded on two
parallel gels, and the transferred proteins were analyzed for either
P-ERK or total ERK. (D) Western blot analysis of P-ERK and total
ERK in HEK293 cells following treatment for 0 min, 15 min (0.25),
30 min (0.5), 1, 2 and 4 h with 20 l
M CdCl
2
(20 lM Cd) or with
100 ngÆmL
)1
PMA (PMA 16 h then Cd).
P. Martin et al. Cd-induced ERK activation is inhibited by PKC
FEBS Journal 276 (2009) 1667–1679 ª 2009 The Authors Journal compilation ª 2009 FEBS 1671
cadmium–PMA cotreatment, despite the substantial
knockdown of the different active PKC isozymes. It is
likely that the remaining fractions of phosphorylated
PKC detected were sufficient to drive the hit-and-run

protective effect reported here.
In other words, whereas PMA treatment, which acti-
vates PKC, protects cells from cadmium-induced cell
death and diminishes ERK activation, GF 109203X
treatment, which completely inhibits PKC activity,
results in an increased response of ERK to cadmium
treatment. This rules out the possibility that the PMA-
mediated downregulation of PKC could be responsible
for the inhibition of the sustained ERK activation,
and suggests that a hit-and-run process initiated by
PKC activation is involved. This is reinforced by the
observation that the siRNA against PKCe, which was
quite effective in diminishing the level of activated
ERK after 24 h in the presence of cadmium (Fig. 2),
did not significantly protect cells from cadmium toxic-
ity, unless PMA was applied (data not shown).
Pharmaceutical inhibition of PKC renders cells
hypersensitive to cadmium treatment
As we have previously linked the cellular response to
cadmium with sustained ERK activation, we wanted
to determine the effect of GF 109203X on the mor-
phology of cells exposed to cadmium. This is illus-
trated in Fig. 4A, where the phenotypic response of
cells to cadmium was even more dramatic in the pres-
ence of GF 109203X, whereas GF 109203X alone did
not result in any significant morphological modifica-
tion of the cells. Quantification of this experiment indi-
cated that whereas a 24 h cadmium treatment left 12%
of the cells still adhering to the culture dishes, cotreat-
ment with cadmium and GF 109203X resulted in

A
B
Fig. 4. Inhibition of PKC sensitizes cells to cadmium. (A) Phenotypic observation of increased cellular sensibility to cadmium after PKC inhibi-
tion. HEK293 cells were cultivated in DMEM and 10% fetal bovine serum (Ø), in the presence of: 2.5 l
M GF 109203X (GFX); 2 lM CdCl
2
(Cd), 2 lM CdCl
2
and 2.5 l M GF 109203X (Cd GFX); 100 ngÆmL
)1
PMA (PMA); 2 lM CdCl
2
and 100 ngÆmL
)1
PMA (Cd P); 2 lM CdCl
2
and
100 ngÆmL
)1
PMA, and 2.5 lM GF 109203X (Cd P GFX). Pictures illustrating the phenotypic modifications of the cells were taken 24 h after
treatment. As compared to control cells (Ø) set to 100%, cell numbers in the different conditions were: Cd, 52%; Cd GFX, 47%; GFX, 82%;
PMA, 94%; Cd PMA, 63%, Cd PMA GFX, 44%. (B) Graphic representation of phenotypic modifications of the cells from the experiment
depicted in (A). Percentages of rounded cells are represented by black bars. Plotted values are from at least 300 counted cells from each
condition, with error bars corresponding to standard deviation from three different counts. ***Difference highly significant (P < 0.001).
Legends are as in (A).
Cd-induced ERK activation is inhibited by PKC P. Martin et al.
1672 FEBS Journal 276 (2009) 1667–1679 ª 2009 The Authors Journal compilation ª 2009 FEBS
virtually all of the cells floating. The PMA protective
effect was also substantially reduced in the presence of
GF 109203X, as over 85% of the cells were rounded

when treated with cadmium, PMA and GF 109203X,
whereas only 25% of the cells were rounded in the
presence of cadmium and PMA (Fig. 4B). This indi-
cates that PKC inhibition by GF 109203X is dominant
over PMA activation, as predicted by the GF 109203X
target on PKC, which is distinct from the PMA-inter-
acting domain [20]. This confirms that PKC is indeed
the central actor in the observation reported here.
PMA downregulation of delayed ERK activation
is not dependent upon protein synthesis
As transient PKC activation up to 16 h before cad-
mium treatment inhibited delayed ERK activation, we
investigated the possibility that protein synthesis could
be required in the follow-up of this hit-and-run pro-
cess. To this end, we concomitantly treated cells with
cadmium and emetine, a protein synthesis inhibitor.
As seen in Fig. 5B, short-term ERK activation in
response to a 15 min PMA treatment alone was, as
expected, unaffected by emetine. However, in the
presence of emetine, ERK activation in response to a
24 h cadmium treatment was substantially blunted as
compared to cadmium alone (Fig. 5A), as it was in the
presence of PMA. Interestingly, when PMA and eme-
tine were added together, the overall ERK activation
in response to cadmium was further decreased as com-
pared to the effect of each individually. The emetine
effect is thus likely to represent the natural degrada-
tion of a protein involved in the cellular response to
cadmium, whereas PMA treatment is still able to inhi-
bit delayed ERK activation, but only through the

remainder of the factor whose neosynthesis is blocked
by emetine. This strongly suggests that the PKC hit-
and-run action is technically independent of protein
neosynthesis, but acts through a relatively unstable
protein.
Taken together, these results suggest that whereas
PMA, which mimics diacylglycerol in activating PKC,
protects cells from cadmium exposure and limits the
associated activation of ERK, GF 109203X has the
opposite effect. As the protective effect of PMA was
also observed when it was applied hours before cad-
mium addition, we reasoned that PKC activity could
participate in a process that results in the modification
of a pre-existing protein, leading to protection from
cadmium toxicity.
PKC activation results in a decrease in
intracellular cadmium accumulation
To determine whether PMA could directly limit cad-
mium entry into cells, we measured cadmium accumu-
lation using a radioactive tracer in the presence or the
absence of PMA. A reduction of cadmium entry was
indeed observed, as in the presence of PMA, the inter-
nal cadmium concentration was reduced by approxi-
mately 30% (Fig. 6A). No significant cadmium release
from cells was detected, either in the presence or in the
absence of PMA (data not shown). To determine
whether this reduction in cadmium accumulation
caused by PMA could be sufficient to explain the
protective effect observed, we incubated cells with a
higher concentration of cadmium in the medium

(3 lm) in the presence of PMA, and measured
cadmium accumulation. Despite the higher extracel-
lular concentration of cadmium, we still obtained a
27.5 ± 7.7% reduction in the intracellular cadmium
accumulation as compared to what we observed after
incubation in 2 lm cadmium alone (Fig. 6B). We then
compared ERK activation under these two conditions,
and again found a strong correlation between a reduc-
tion in cadmium entry and ERK phosphorylation
(Fig. 6B, insert). Total ERK was unchanged (data not
shown). This indicates that modulation of cadmium
A
B
Fig. 5. Blocking protein synthesis negatively affects ERK sustained
activation in response to cadmium treatment, but does not affect
PMA inhibitory effect. (A) Western blot analysis of P-ERK and total
ERK (ERK) in HEK293 cells, following a 24 h treatment with 2 l
M
CdCl
2
(Cd, +) in the presence of 10 lM emetine (Em, +) and
100 ngÆmL
)1
PMA (PMA, +). Fifteen micrograms of protein lysate
was loaded onto two parallel gels, and the transferred proteins
were analyzed for either P-ERK or total ERK. (B) Western blot anal-
ysis of P-ERK and total ERK in HEK293 cells, after a 10 min 10 l
M
emetine treatment (Em, +), followed by a 15 min treatment with
100 ngÆmL

)1
PMA (PMA, +). Fifteen micrograms of protein lysate
was loaded onto two parallel gels, and the transferred proteins
were analyzed for either P-ERK or total ERK.
P. Martin et al. Cd-induced ERK activation is inhibited by PKC
FEBS Journal 276 (2009) 1667–1679 ª 2009 The Authors Journal compilation ª 2009 FEBS 1673
entry following PMA treatment is likely to be the main
reason for the protective effect of PMA reported here.
ZIP8 transporter knockdown protects cells from
cadmium toxicity
In parallel, and because we found that emetine also
limited ERK activation by cadmium, we investigated
the net effect of protein synthesis on cadmium entry
into cells. As shown in Fig. 6C, the presence of eme-
tine resulted in a close to 50% decrease in cadmium
accumulation after a 24 h treatment. This decrease in
cadmium accumulation is very likely to be the direct
result of the cadmium transporter(s) turnover. Mathe-
matical calculation, based on the comparison of cad-
mium entry measurements in the presence or in the
absence of protein synthesis inhibitor, allowed us to
determine that the half-life of this cadmium trans-
porter would be 11.5 ± 1.5 h (see Experimental proce-
dures). ZIP8 has recently been reported to be the
major cadmium transporter in cells [22], and its char-
acteristics are in perfect agreement with our previously
reported observations concerning cadmium entry into
HEK cells [23]. Our mathematical calculation is also in
excellent agreement with preliminary data from the
Nebert laboratory (D. W. Nebert, Department of

Environmental Health, University of Cincinnati, USA,
personal communication), which estimates the ZIP8
half-life to be 12 ± 2 h. In order to investigate
whether ZIP8 could actually be responsible for
cadmium entry, we transfected HEK cells with an
enhanced GFP (eGFP) bicistronic vector (PRIG [24])
expressing or not expressing (control) the ZIP8 trans-
porter (ZIP8). Cells that were actually transfected were
unambiguously traced by fluoromicroscopy (Fig. 7A).
We observed that after 48 h of exposure to 120 nm
CdCl
2
, cells remained unaffected, as expected for such
a low dose of cadmium, whereas cells expressing exog-
enous ZIP8 transporters were all rounded and dis-
played very weak GFP signals, reflecting the enhanced
toxic effect of this very low cadmium concentration,
owing to the increased number of ZIP8 transporters in
these transfected cells. CdCl
2
at 120 nm was used in
this experiment, because titration experiments indi-
cated that it is the lowest cadmium concentration
resulting in the complete phenotypic change in cells
transfected with the ZIP8 expression vector (data not
shown). This demonstrates that ZIP8 is indeed able to
transport cadmium into cells. In order to investigate
the actual contribution of endogenous ZIP8 to cad-
mium entry into cells, we performed ZIP8 knockdown
by siRNA transfection. Our ZIP8 siRNA mix was first

validated on cells transiently expressing a bicistronic
RNA encoding ZIP8 on the first cistron, followed by
GFP on the second. The ZIP8 siRNA mix substan-
tially knocked down the GFP signal, indicating that
these siRNAs do result in the bicistronic RNA degra-
dation (data not shown). As shown in Fig. 7B, cells
cotransfected with a GFP marker and the ZIP8 siRNA
and exposed to 2 lm CdCl
2
were markedly protected
from cadmium intoxication as compared to cells
transfected with control eGFP siRNA, or no siRNA.
AB C
Fig. 6. Quantification of cadmium accumulation in cells. (A) Comparison of intracellular cadmium accumulation from medium containing
2 l
M CdCl
2
between control cells (Ø) and 100 ngÆmL
)1
PMA-treated cells (PMA). Control cells are set as 100%. (B) Comparison of intracellu-
lar cadmium accumulation between 2 l
M CdCl
2
-treated cells and 3 lM CdCl
2
+ 100 ngÆmL
)1
PMA-treated cells. Cells treated with 2 lM
CdCl
2

are set as 100%. Upper part: corresponding western blot showing P-ERK activation status. (C) Comparison of intracellular cadmium
accumulation from medium containing 2 l
M CdCl
2
between control cells (Ø), 100 ngÆmL
)1
-PMA treated cells (PMA), 10 lM emetine-treated
cells (Em), and 100 ngÆmL
)1
PMA + 10 lM emetine-treated cells (PMA + Em). Control cells are set as 100%. Cells were incubated for 24 h,
lysed, and counted as described in Experimental procedures. **Significant difference (P < 0.01), ***highly significant difference (P < 0.001).
Cd-induced ERK activation is inhibited by PKC P. Martin et al.
1674 FEBS Journal 276 (2009) 1667–1679 ª 2009 The Authors Journal compilation ª 2009 FEBS
siRNA knockdown commonly leaves a small propor-
tion of the protein of interest in the cells. We are thus
confident that our results demonstrate that ZIP8 par-
ticipates in the entry of cadmium into HEK cells.
Cadmium accumulation in cells concomitantly trea-
ted with PMA and emetine was also investigated. As
shown in Fig. 6C, we found that these effects were
additive, as presented in Fig. 5 for the inhibition of
ERK activation. Whereas emetine resulted in close to
a 50% decrease in cadmium accumulation, a simulta-
neous PMA treatment was still able to reduce cad-
mium accumulation by an additional 30%. The
simplest explanation is that PMA has a direct negative
effect on cadmium transporter function. Thus, inde-
pendent of the quantity of transporter present in the
cell, PMA treatment would always result in a 30%
decrease in cadmium accumulation as compared to

conditions devoid of PMA, which is in good agree-
ment with our results of Fig. 5, suggesting that the
PKC hit-and-run effect is independent of protein neo-
synthesis.
To summarize, we show here that PMA-driven PKC
activation inhibits sustained ERK phosphorylation
observed after cadmium exposure, and protects cells
from cadmium toxicity. Conversely, blockage of
PKC activation enhances cadmium toxicity and ERK
activation. This PKC effect stems from a protein
neosynthesis-independent hit-and-run phenomenon that
ultimately results in decreased intracellular accumula-
tion of cadmium. Finally, ZIP8 knockdown by siRNA
substantially reduces cadmium toxicity, demonstrating
the pivotal role of ZIP8 in cadmium intoxication.
Taken together, these results suggest that a PKC-driven
modification of ZIP8 decreases its transporter activity,
thus reducing sustained ERK activation and conse-
quently affecting cell response to cadmium poisoning.
Discussion
Investigation of the molecular basis of cadmium toxic-
ity during the last decade has resulted in the character-
ization of multiple pathways involved in this poisoning
[25]. This reflects the large panel of targets affected by
cadmium. Kinases such as P38, ERK and Jun N-ter-
minal kinase have been shown to play a role in this
cadmium poisoning. However, differences in experi-
mental conditions, such as high cadmium concentra-
tions applied for short periods versus low doses for
extended periods, have resulted in data that are some-

times hard to reconcile [26,27]. Other cellular mecha-
nisms are also affected by cadmium. The homeostasis
of metals that are essential for diverse biological func-
tions, such as calcium, zinc and iron, is disturbed by
cadmium [28]. Similarly, oxidative mechanisms are also
perturbed by cadmium [29]. The experiments presented
in this article, based on exposure to low cadmium con-
centrations, are comparable to chronic intoxications.
Our results link the sustained activation of ERK
following low-dose cadmium treatments to PKC func-
tion, and ultimately to the activity of the ZIP8 zinc
transporter. Previous work has indicated that cadmium
substitutes for zinc in the regulatory domain of PKC,
A
B
Fig. 7. ZIP8 transports cadmium into cells and plays a role in
cadmium toxicity. (A) HEK cells were transfected with either an
eGFP-expressing control vector (Control), or a bicistronic vector
expressing ZIP8 and eGFP. Twenty-four hours after transfection,
cells were exposed to 0.12 l
M CdCl
2
(0.12 lM Cd) or regular med-
ium (No Cd). Cells were observed by epifluorescence 48 h later,
and pictures were taken using the same exposure time for all
conditions. Only cells expressing ZIP8 and exposed to a very low
cadmium concentration died, as visualized by their weak GFP signal
and their rounded phenotype. As compared to control transfected
cell number, set to 100%, cell numbers in the different conditions
were: ZIP8, 92%; 0.12 l

M, 107%; ZIP8 + 0.12 lM, 28% (and all
cells were rounded and weakly fluorescent). (B) Endogenous ZIP8
is involved in cadmium entry into cells. Cells were transfected with
an eGFP-expressing plasmid together with no siRNA, an siRNA
directed against eGFP (eGFP siRNA), or an siRNA mix directed
against ZIP8. After 24 h in the presence of 2 l
M CdCl
2
, cells were
dying in both eGFP siRNA and no siRNA conditions, whereas viable
cells were still present in the well containing the ZIP8 siRNA mix.
Exposure time was kept constant for all conditions. As compared
to ZIP8 siRNA mix-transfected cells, set to 100%, cell numbers in
the different conditions were: eGFP siRNA, 47% (practically all cells
were rounded and not fluorescent); no siRNA, 39% (practically all
cells were rounded and weakly fluorescent).
P. Martin et al. Cd-induced ERK activation is inhibited by PKC
FEBS Journal 276 (2009) 1667–1679 ª 2009 The Authors Journal compilation ª 2009 FEBS 1675
resulting in its activation [30,31]. Furthermore, Cd
2+
,
which is structurally similar to Ca
2+
, may also substi-
tute for calcium in the activation of PKC isoforms.
Calcium levels are highly and rapidly modulated in
cells, but those of cadmium are not, its levels remain-
ing stable. We previously demonstrated that extracellu-
lar calcium cannot compete with cadmium for entry
into cells [23]. We showed here that PKC isoforms are

indeed subjected to sustained activation following a
24 h cadmium treatment, leading to the delayed ERK
activation reported earlier [12]. As PMA pretreatment
results in the rapid activation ⁄ downregulation of PKC
and reduces ZIP8 activity, a cadmium effect on PKC
is no longer possible, resulting in the protective effect
reported here. In the absence of early PKC activa-
tion ⁄ downregulation, ZIP8 is fully active, and unim-
paired cadmium entry into the cell results in the
progressive displacement of calcium, leading to delayed
PKC activation, which itself results in sustained ERK
activation, and ultimately cell death. Delayed PKC
activation will also diminish ZIP8 activity, but as the
cells have already been exposed to cadmium, they will
nevertheless undergo cell death, as cadmium does not
exit intact cells. Further analysis will be required to
unveil the molecular mechanisms involved in the cad-
mium-dependent delayed PKC activation reported
here.
The results presented here led us to propose an inte-
grative model, which is depicted in Fig. 8. Two types
of ERK activation are shown. On the right side of the
scheme is the early and transient ERK response to
the phorbol ester PMA that is efficiently abrogated
by the specific broad-spectrum PKC inhibitor GF
109203X. This corresponds to the conventional mito-
gen-activated protein kinase cascade observed, for
example, following growth factor stimulation. On the
left side of the scheme is the unconventional and sus-
tained ERK activation, like the one observed following

low-dose cadmium treatment. We show here that: (a)
this long-term activation relies on a molecular process
under the negative control of PKC, as pharmacological
inhibition of PKC results in enhanced ERK activation,
whereas a transient PKC activator results in reduced
ERK activation; and (b) this PKC negative control
does not rely on protein neosynthesis, since even
though emetine treatment diminishes ERK activation
following cadmium exposure, the remaining activation
is still under the negative control of PKC.
The negative control of PKC on sustained ERK
activation in response to cadmium is confirmed by
PKC inhibitor treatment. Indeed, GF 109203X actu-
ally enhances ERK activation following cadmium
treatment in a dose-dependent manner, whereas PKC
activation by PMA diminishes this activation. Interest-
ingly, among the three predominant PKC isotypes
found in HEK cells (PKCa, PKCd and PKCe), siRNA
knockdown of PKCe is the most effective in diminish-
ing sustained ERK activation following cadmium
treatment, whereas, as already known, siRNA knock-
down of PKCa is the most effective in diminishing
classic ERK activation by PMA. The observation that
PKC siRNAs do not increase ERK activation in
response to cadmium as GF 109203X does is likely to
reflect the fraction of PKC still present and functional
within the cells, whereas GF 109203X completely
blocks all PKC function.
In this article we present evidence suggesting that
the protective effect of PMA is probably due to mod-

ulation of the activity of the recently identified cad-
mium transporter ZIP8. We calculated the half-life of
the factor targeted by PMA to be 11.5 ± 1.5 h,
which is in perfect agreement with the 12 ± 2 h
found for ZIP8 in the Nebert laboratory (D. W.
Nebert, Department of Environmental Health, Uni-
versity of Cincinnati, USA, personal communication).
We also demonstrate that ZIP8 exogenous expression
is capable of enhancing cadmium toxicity, whereas
ZIP8 knockdown results in a diminution of cadmium
toxicity. PKC has already been shown to be able to
affect different transporters, either by directly modify-
ing their activities [32,33] or by affecting their stabil-
ity [34]. In silico analysis of the ZIP8 structure reveals
that there are three putative sites that could be phos-
phorylated by PKC (94-SSK-96; 361-STR-363; 424-
TGR-426). It will be of interest to determine whether
these sites are actually phosphorylated in response to
PKC activation, and whether their modification
affects ZIP8 function.
Fig. 8. Scheme depicting the different pathways involved in the
control of sustained ERK activation. Cd, CdCl2 stimulation; PMA,
PMA treatment; GFX, GF 109203X treatment; Em, emetine; ZIP8,
ZIP8 transporter. Arrows with a minus sign indicate a repression
effect, and arrows with a plus sign represent an activation process.
The dashed line represents an indirect process.
Cd-induced ERK activation is inhibited by PKC P. Martin et al.
1676 FEBS Journal 276 (2009) 1667–1679 ª 2009 The Authors Journal compilation ª 2009 FEBS
Experimental procedures
Cell culture

HEK cells were grown in DMEM complemented with
10% fetal bovine serum, in water-saturated 5% CO
2
37 °C
incubators.
Cell treatments
CdCl
2
was purchased from Sigma (Saint-Quentin Tallavier,
France), and solubilized in de-ionized water. PMA and
GF 109203X were purchased from Sigma, and prepared in
DMSO.
Internal cadmium concentration measurements
Cells were seeded in quadruplicate in 24-well plates at
subconfluent density and treated with different compounds
as indicated in the text. Cadmium was traced using 2 lm
109
Cd at 31.6 lCiÆlmol
)1
for 24 h at 37 °Cin5%CO
2
.
After incubation, floating and adherent cells were pooled,
washed three times with 20 mm Hepes, (pH 7), 150 mm
NaCl, and 5 mm EGTA, and lysed in the same buffer
supplemented with 0.2 m NaOH. Aliquots of these lysates
were counted in scintillation liquid. Measured accumulated
radioactivity after 24 h of culture was, at most, 7% of the
initial counts present in the culture medium. The protein
content of each sample was determined using a Biorad

DC assay (Biorad, Marnes-La-Coquette, France), and
counts were standardized relative to the amount of protein
of each experimental condition.
Cell toxicity quantification
The release of adenylate kinase from damaged cells was
used as a marker of cellular toxicity. Adenylate kinase
activity was measured from aliquots of culture media, using
a bioluminescent assay, the Toxilight Bioassay, developed
by Lonza (Levallois-Perret, France). As a reference for
100% lysis, control cells were lysed in 25 mm Tris (pH 7.5),
10% glycerol, and 1% Triton X-100.
Half-life calculation of the transporter
This was calculated by kinetic measurement of cadmium
accumulation in cells cultivated in the presence of cad-
mium. We assumed that cadmium entry is proportional to
the number of transporters and that, in the presence of
emetine, this number decreases following the relationship
R = R
o
exp()ln 2 · t ⁄ T), where R
o
is the number of
transporters before emetine addition, t is the length of the
incubation, and T is the half-life of the transporter.
When no emetine is added, the amount of cadmium
entering the cell is Q = R
o
· t. When emetine is added, it
is Q
E

= R
o
· T ⁄ ln 2 · (1)exp(ln 2 · t ⁄ T)). After 24 h,
approximatively half (53 ± 2%) of the amount of
cadmium found in cells grown in the presence of cadmium
is present in cells grown in the presence of emetine and
cadmium. Thus, Q =2· Q
E
, and R
o
· t =2R
o
· T ⁄ ln
2 · (1)exp()ln 2 · t ⁄ T)), with t = 24. We obtain
12 · ln 2 ⁄ T =1)exp(ln 2 · 24 ⁄ T). This equation results in
a final value of T = 11.5 ± 1.5 h, when taking into
account the error margin of intracellular cadmium accumu-
lation measurements. The inhibitory effect of 10 lm
emetine on protein synthesis was validated under our condi-
tions by the absence of GFP expression in cells transfected
with peGFP-N1; control transfections with peGFP-N1
alone gave a strong GFP signal 24 h post-transfection.
Protein concentration assay
The Biorad DC Protein assay was used as recommended by
the manufacturer for microplate assays. Briefly, 20 lLof
the cell lysate was mixed with 20 lL of reagent (A + S),
and 160 lL of reagent B was then added. Absorbance was
measured at 750 nm, and compared to the absorbance of
dilutions of a protein standard to determine the protein
concentration. Each sample was measured in duplicate, and

the concentration determination was considered valid if the
variation between duplicates was < 10%.
Western blot analyses
Cells present in the culture supernatants were collected by
centrifugation (500 g , 5 min), and added to adherent cells
that were scraped off culture dishes. Lysis was performed
in 60 mm Tris ⁄ HCl (pH 6.8), 10% glycerol and 2% SDS,
and sonication was used to disrupt genomic DNA. Protein
concentrations were determined by BioRad assays. Equiva-
lent amounts of proteins were loaded onto SDS ⁄ PAGE
gels, separated by electrophoresis, and transferred to
poly(vinylidene difluoride) membranes. When both P-ERK
and total ERK were analyzed, two gels were run and pro-
cessed in parallel, rather than stripping and reusing the
same membrane. Indeed, we observed that chemilumines-
cence detection is associated with the appearance of a stable
precipitate that interferes with the detection of the same
antigen (ERK in this case) with a second antibody, even
after stripping. Membranes were blocked in 5% nonfat dry
milk in NaCl ⁄ Tris, and antibodies were incubated at the
following concentrations: ERK (Sigma M5670) rabbit poly-
clonal antibodies, 1 : 20 000; phospho-ERK (Sigma
M8159) mouse monoclonal antibodies, 1 : 10 000; and
phospho-PKC (Cell Signalling #9371, Danvers, MA, USA)
rabbit polyclonal antibodies, 1 : 1000. Secondary antibodies
(DAKO, Trappes, France) were used at 1 : 4000 final dilu-
tion. Signals were revealed by chemiluminescence.
P. Martin et al. Cd-induced ERK activation is inhibited by PKC
FEBS Journal 276 (2009) 1667–1679 ª 2009 The Authors Journal compilation ª 2009 FEBS 1677
Plasmid constructs, siRNA and DNA transfection

pPRIG ZIP8 (Asu2–Ava3) was constructed by cloning the
AsuII–AvaIII fragment containing the entire human ZIP8
coding sequence from pOTB7 ZIP8, obtained from Gene
Service Ltd (Cambridge, UK) (clone 4650026), into the
pPRIG vector [24] digested with ClaI–Sse8387I. pEGFP-
N1 and pDSRed-N1 are from Clontech (Mountain View,
CA, USA). siRNA sequences are: ZIP8 #1, accuaaagca
uuaccugccaucaau; ZIP8 #2, ccgauuucaccuucuucaugauuca;
ZIP8 #3, ggauuccugucagugacgauuauua; eGFPsi, gcaagcuga
cccugaaguucau; PKCa #1, ccaucggauuguucuuucuucauaa;
PKCa #2, gccuccauuugauggugaagaugaa; PKCd #1, ccacu
acaucaagaaccaugaguuu; and PKCd #2, ccauccacaagaaaugc
aucgacaa. PKCe #1, PKCe #2 and PKC siRNAs are the
‘validated Stealth RNAi duo pak’ from Invitrogen (Cergy
Pontoise, France). Only one of each pair is presented in
Fig. 2. Both gave similar results. HEK cells were transfected
at 50% confluency with the calcium phosphate coprecipi-
tation method, as described previously [35], using 4 lgof
plasmid DNA per 60 mm dish, and when used, 150 ng of
siRNA. Six hours after transfection, cells were passaged
to multiwell plates. After 24 h (ZIP8si) or 48 h (PKCsi),
cells were treated as described.
Statistical analysis
Results were analyzed for statistical significance using a
one-way anova parametric test and Turkey pairwise com-
parisons. P-values are indicated on the figures.
Acknowledgements
We are indebted to D. W. Nebert (Department of
Environmental Health, University of Cincinnati, USA)
for exchanging unpublished data with us, and

W. Koch (The Beatson Institute for Cancer Research,
Glasgow, UK) and P. J. Parker (London Research
Institute, London, UK) for their advice on PKC. We
also thank the anonymous referee who pointed out the
possible role of cadmium in a sustained PKC activa-
tion. This work was supported by funding from
CNRS.
References
1 Cooper JA & Hunter T (1985) Major substrate for
growth factor-activated protein-tyrosine kinases is a
low-abundance protein. Mol Cell Biol 5, 3304–3309.
2 Wellbrock C, Karasarides M & Marais R (2004) The
RAF proteins take centre stage. Nat Rev Mol Cell Biol
5, 875–885.
3 Thomas G (1992) MAP kinase by any other name
smells just as sweet. Cell 68, 3–6.
4 Chambard J, Lefloch R, Pouysse
´
gur J & Lenormand P
(2007) ERK implication in cell cycle regulation. Biochim
Biophys Acta 1773, 1299–1310.
5 Ballif BA & Blenis J (2001) Molecular mechanisms
mediating mammalian mitogen-activated protein kinase
(MAPK) kinase (MEK)-MAPK cell survival signals.
Cell Growth Differ 12, 397–408.
6 Roovers K & Assoian RK (2000) Integrating the MAP
kinase signal into the G1 phase cell cycle machinery.
BioEssays 22, 818–826.
7 Cheung ECC & Slack RS (2004) Emerging role for
ERK as a key regulator of neuronal apoptosis.

Sci STKE 2004, PE45, www.stke.org/cgi/content/full/
sigtrans;2004/251/pe45.
8 Colucci-D’Amato L, Perrone-Capano C & di Porzio U
(2003) Chronic activation of ERK and neurodegenera-
tive diseases. BioEssays 25, 1085–1095.
9 Namura S, Iihara K, Takami S, Nagata I, Kikuchi H
et al. (2001) Intravenous administration of MEK inhibi-
tor U0126 affords brain protection against forebrain
ischemia and focal cerebral ischemia. Proc Natl Acad
Sci USA 98, 11569–11574.
10 Amra
´
n D, Sancho P, Ferna
´
ndez C, Esteban D, Ramos
AM, de Blas E, Go
´
mez M, Palacios MA & Aller P
(2005) Pharmacological inhibitors of extracellular
signal-regulated protein kinases attenuate the apoptotic
action of cisplatin in human myeloid leukemia cells
via glutathione-independent reduction in intracellular
drug accumulation. Biochim Biophys Acta 1743, 269–
279.
11 Cagnol S, Van Obberghen-Schilling E & Chambard J
(2006) Prolonged activation of ERK1,2 induces FADD-
independent caspase 8 activation and cell death. Apop-
tosis 11, 337–346.
12 Martin P, Poggi MC, Chambard JC, Boulukos KE &
Pognonec P (2006) Low dose cadmium poisoning

results in sustained ERK phosphorylation and caspase
activation. Biochem Biophys Res Commun 350, 803–807.
13 Marshall CJ (1995) Specificity of receptor tyrosine
kinase signaling: transient versus sustained extracellular
signal-regulated kinase activation. Cell 80, 179–185.
14 Santos SDM, Verveer PJ & Bastiaens PIH (2007)
Growth factor-induced MAPK network topology
shapes Erk response determining PC-12 cell fate. Nat
Cell Biol 9, 324–330.
15 Adams PD & Parker PJ (1991) TPA-induced activation
of MAP kinase. FEBS Lett 290, 77–82.
16 Scho
¨
nwasser DC, Marais RM, Marshall CJ & Parker
PJ (1998) Activation of the mitogen-activated protein
kinase ⁄ extracellular signal-regulated kinase pathway
by conventional, novel, and atypical protein kinase C
isotypes. Mol Cell Biol 18, 790–798.
17 Liu WS & Heckman CA (1998) The sevenfold way of
PKC regulation. Cell Signal 10, 529–542.
Cd-induced ERK activation is inhibited by PKC P. Martin et al.
1678 FEBS Journal 276 (2009) 1667–1679 ª 2009 The Authors Journal compilation ª 2009 FEBS
18 Bagchi D, Bagchi M, Tang L & Stohs SJ (1997) Com-
parative in vitro and in vivo protein kinase C activation
by selected pesticides and transition metal salts. Toxicol
Lett 91, 31–37.
19 Long GJ (1997) The effect of cadmium on cytosolic free
calcium, protein kinase C, and collagen synthesis in rat
osteosarcoma (ROS 17 ⁄ 2.8) cells. Toxicol Appl Pharma-
col 143, 189–195.

20 Toullec D, Pianetti P, Coste H, Bellevergue P, Grand-
Perret T et al. (1991) The bisindolylmaleimide
GF 109203X is a potent and selective inhibitor of
protein kinase C. J Biol Chem 266, 15771–15781.
21 Chida K, Kato N & Kuroki T (1986) Down regulation
of phorbol diester receptors by proteolytic degradation
of protein kinase C in a cultured cell line of fetal rat
skin keratinocytes. J Biol Chem 261, 13013–13018.
22 He L, Girijashanker K, Dalton TP, Reed J, Li H et al.
(2006) ZIP8, member of the solute-carrier-39 (SLC39)
metal-transporter family: characterization of transporter
properties. Mol Pharmacol 70, 171–180.
23 Martin P, Fareh M, Poggi MC, Boulukos KE & Pogno-
nec P (2006) Manganese is highly effective in protecting
cells from cadmium intoxication. Biochem Biophys Res
Commun 351, 294–299.
24 Martin P, Albagli O, Poggi MC, Boulukos KE & Pog-
nonec P (2006) Development of a new bicistronic retro-
viral vector with strong IRES activity. BMC Biotechnol
6, 4, doi: 10.1186/1472-6750-6-4.
25 Bertin G & Averbeck D (2006) Cadmium: cellular
effects, modifications of biomolecules, modulation of
DNA repair and genotoxic consequences (a review).
Biochimie 88, 1549–1559.
26 Chuang SM, Wang IC & Yang JL (2000) Roles of
JNK, p38 and ERK mitogen-activated protein kinases
in the growth inhibition and apoptosis induced by
cadmium. Carcinogenesis 21, 1423–1432.
27 Iryo Y, Matsuoka M, Wispriyono B, Sugiura T & Igisu
H (2000) Involvement of the extracellular signal-regu-

lated protein kinase (ERK) pathway in the induction of
apoptosis by cadmium chloride in CCRF-CEM cells.
Biochem Pharmacol 60, 1875–1882.
28 Martelli A, Rousselet E, Dycke C, Bouron A &
Moulis J (2006) Cadmium toxicity in animal cells by
interference with essential metals. Biochimie 88, 1807–
1814.
29 Stohs SJ & Bagchi D (1995) Oxidative mechanisms in
the toxicity of metal ions. Free Radic Biol Med 18, 321–
336.
30 Beyersmann D, Block C & Malviya AN (1994) Effects
of cadmium on nuclear protein kinase C. Environ
Health Perspect 102(Suppl. 3), 177–180.
31 Block C, Freyermuth S, Beyersmann D & Malviya AN
(1992) Role of cadmium in activating nuclear protein
kinase C and the enzyme binding to nuclear protein.
J Biol Chem 267, 19824–19828.
32 Ciarimboli G, Koepsell H, Iordanova M, Gorboulev V,
Du
¨
rner B et al. (2005) Individual PKC-phosphorylation
sites in organic cation transporter 1 determine substrate
selectivity and transport regulation. J Am Soc Nephrol
16, 1562–1570.
33 Krotova KY, Zharikov SI & Block ER (2003) Classical
isoforms of PKC as regulators of CAT-1 transporter
activity in pulmonary artery endothelial cells. Am J
Physiol Lung Cell Mol Physiol 284, L1037–L1044.
34 Vayro S & Silverman M (1999) PKC regulates turnover
rate of rabbit intestinal Na+-glucose transporter

expressed in COS-7 cells. Am J Physiol
276, C1053–
C1060.
35 Carlotti F, Zaldumbide A, Martin P, Boulukos KE,
Hoeben RC et al. (2005) Development of an inducible
suicide gene system based on human caspase 8. Cancer
Gene Ther 12, 627–639.
P. Martin et al. Cd-induced ERK activation is inhibited by PKC
FEBS Journal 276 (2009) 1667–1679 ª 2009 The Authors Journal compilation ª 2009 FEBS 1679