Tài liệu Báo cáo khoa học: Modulation of the enzymatic efficiency of ferredoxin-NADP(H) reductase by the amino acid volume around the catalytic site pptx

Modulation of the enzymatic efficiency of
ferredoxin-NADP(H) reductase by the amino acid
volume around the catalytic site
Matı
´
as A. Musumeci, Adria
´
n K. Arakaki, Daniela V. Rial, Daniela L. Catalano-Dupuy and
Eduardo A. Ceccarelli
Molecular Biology Division, Instituto de Biologı
´
a Molecular y Celular de Rosario (IBR), Facultad de Ciencias Bioquı
´
micas y Farmace
´
uticas,
Universidad Nacional de Rosario, Argentina
Ferredoxin (flavodoxin)-NADP(H) reductases (FNRs,
EC 1.18.1.2) are a widely distributed class of flavoen-
zymes that have non-covalently bound FAD cofactor
as a redox center. FNRs participate in a wide variety
of redox-based metabolic reactions, transferring elec-
trons between obligatory one- and two-electron carri-
ers and therefore functioning as a general electron
splitter. In non-phototrophic bacteria and eukaryotes,
the reaction is driven towards ferredoxin (Fd) reduc-
tion, providing reducing power for multiple metabolic
pathways, including steroid hydroxylation in mamma-
lian mitochondria, nitrite reduction and glutamate
synthesis in heterotrophic tissues of vascular plants,
radical propagation and scavenging in prokaryotes,

and hydrogen and nitrogen fixation in anaerobes (for
a review, see [1,2]). In plants, FNR participates in
photosynthetic electron transport, reducing Fd at the
level of photosystem I, and transferring electrons to
NADP
+
. This process ends with the formation of the
NADPH necessary for CO
2
fixation and other biosyn-
thetic pathways [2].
The three-dimensional structures of several FNRs
have been determined. They display similar structural
features, which have been defined as the prototype for
a large family of flavoenzymes [3–10]. Plant-type FNRs
can be classified into a plastidic class, characterized by
Keywords
catalytic efficiency; enzyme evolution;
ferredoxin; ferredoxin-NADP(H) reductase;
oxidoreductases
Correspondence
E. A. Ceccarelli, Molecular Biology Division,
Instituto de Biologı
´
a Molecular y Celular de
Rosario (IBR), CONICET, Facultad de
Ciencias Bioquı
´
micas y Farmace
´

uticas,
Universidad Nacional de Rosario, Suipacha
531, S2002LRK Rosario, Argentina
Fax: +54 341 4390465
Tel: +54 341 4351235
E-mail:
(Received 1 November 2007, revised 8
January 2008, accepted 16 January 2008)
doi:10.1111/j.1742-4658.2008.06298.x
Ferredoxin (flavodoxin)-NADP(H) reductases (FNRs) are ubiquitous
flavoenzymes that deliver NADPH or low-potential one-electron donors
(ferredoxin, flavodoxin, adrenodoxin) to redox-based metabolic reactions in
plastids, mitochondria and bacteria. Plastidic FNRs are quite efficient
reductases. In contrast, FNRs from organisms possessing a heterotrophic
metabolism or anoxygenic photosynthesis display turnover numbers 20- to
100-fold lower than those of their plastidic and cyanobacterial counterparts.
Several structural features of these enzymes have yet to be explained. The
residue Y308 in pea FNR is stacked nearly parallel to the re -face of the fla-
vin and is highly conserved amongst members of the family. By computing
the relative free energy for the lumiflavin–phenol pair at different angles
with the relative position found for Y308 in pea FNR, it can be concluded
that this amino acid is constrained against the isoalloxazine. This effect is
probably caused by amino acids C266 and L268, which face the other side
of this tyrosine. Simple and double FNR mutants of these amino acids were
obtained and characterized. It was observed that a decrease or increase in
the amino acid volume resulted in a decrease in the catalytic efficiency of
the enzyme without altering the protein structure. Our results provide exper-
imental evidence that the volume of these amino acids participates in the
fine-tuning of the catalytic efficiency of the enzyme.
Abbreviations

Fd, ferredoxin; Fld, flavodoxin; FNR, ferredoxin (flavodoxin)-NADP(H) reductase; IPTG, isopropyl thio-b-
D-galactoside.
1350 FEBS Journal 275 (2008) 1350–1366 ª 2008 The Authors Journal compilation ª 2008 FEBS
an extended FAD conformation and high catalytic
efficiency (turnover numbers in the range 100–
600 s
)1
), and a bacterial class displaying a folded
FAD molecule and very low turnover rates (2–27 s
)1
)
[2,11]. The K
m
values for NADP(H), Fd and flavo-
doxin (Fld) remain in the low micromolar range for
all reductases [2].
Two tyrosine residues interact with each side of the
isoalloxazine in plastidic FNRs. On the si-face of the
flavin, which is buried within the protein structure, a
tyrosine aromatic side-chain (Y89 in pea FNR) makes
angles between 54 and 64° with the isoalloxazine in a
conformation that is at the energy minimum (Fig. 1A)
[12]. This residue participates in an intricate network
of interactions that involve other amino acids and the
prosthetic group, contributing to the correct position-
ing of FAD and the substrate NADP
+
[12]. The other
tyrosine (Y308 in pea FNR) is conserved in all plant-
type plastidic FNRs stacked coplanar to the re-face of

the isoalloxazine moiety and interacts extensively with
it (Fig. 1A) ([1,2,13] and references therein). This tyro-
sine has been implicated in catalysis, modulation of
the FAD reduction potential, inter- and intra-protein
electron transfer processes [14–18] and determination
of the specificity and high catalytic efficiency [15,17–
19]. Using NMR techniques, it has been shown that
the maize FNR homolog Y314 is perturbed on
NADP
+
binding, as is the carboxyl terminal region of
the protein [20]. Recently, experimental evidence for
the mobility of the carboxyl terminal backbone region
of FNR and, mainly, Y308 has been provided [19],
indicating that this movement is essential for obtaining
an FNR enzyme with high catalytic efficiency.
During catalysis, the nicotinamide ring must move
to the re-face of the isoalloxazine moiety for electron
transfer to occur. Thus, Bruns and Karplus [3] have
proposed that the aromatic side-chain of the carboxyl
terminal tyrosine should be displaced to allow the sub-
strate to move into the correct position (named ‘in’
conformation). The interaction of the phenol ring of
Y308 with the isoalloxazine should be precisely
adjusted to facilitate the ‘in’ and ‘out’ conformations
of the NADP(H) nicotinamide. A strong interaction of
Y308 with the flavin would impede the ability of nico-
tinamide to go into the site; meanwhile, a slight inter-
action would favor the stacking of the nicotinamide
onto the isoalloxazine, thus decreasing the turnover

rate of the enzyme, as previously demonstrated with
mutant FNRs lacking this amino acid [15,17,21].
By computing ab initio molecular orbital calcula-
tions, the geometry of the tyrosine and flavin has been
analyzed. It is proposed that Y308 is constrained
against the isoalloxazine in a forced conformational
arrangement. This arrangement could be a consequence
of the influence of amino acids C266 and L268, which
face the other side of this tyrosine (see Fig. 1A), forcing
it to adopt a more planar orientation with respect to
the flavin. C266 is conserved between all FNRs and
FNR-like proteins. Homologous residues to L268 are
found in the reductases from plant leaves, plant roots,
cyanobacteria (blue–green algae) and all algal groups
(Chlorophyta, Rhodophyta and Glaucocystophyta).
AB
Fig. 1. Computer model showing the flavin and Y308 arrangement in FNR. (A) FAD cofactor, Y308 stacked on the re-face of the flavin and
amino acids C266, G267 and L268 flanking Y308, as found in pea FNR. (B) Computer graphic based on X-ray diffraction data for pea FNR
[21], with the 266–270 loop, FAD prosthetic group and the terminal Y308 shown in dark grey.
M. A. Musumeci et al. Enzyme efficiency modulated by amino acid volume
FEBS Journal 275 (2008) 1350–1366 ª 2008 The Authors Journal compilation ª 2008 FEBS 1351
Leu268 is replaced by a serine in the bacterial reducta-
ses of subclass I (Azotobacter vinelandii) and by an
asparagine in the bacterial reductases of subclass II
(Escherichia coli) [22]. The equivalent residues to L268
in other FNR-like enzymes are less conserved, being
proline, aspartic acid, serine or alanine.
Simple and double FNR mutants of amino acids
C266 and L268 were obtained and characterized. It
was observed that alteration of the amino acid volume

decreases the catalytic efficiency, suggesting that these
steric considerations may be a requirement for high
catalytic efficiency. The mutations did not produce a
significant perturbation of the overall protein structure
and did not affect the oxidase activity of the flavo-
enzyme. Our results suggest that these amino acids
participate in the fine-tuning of enzyme efficiency,
modulating the interaction of Y308 and ⁄ or the nicotin-
amide with the isoalloxazine. This type of modulation
of aromatic residue interactions could be a general
strategy occurring in enzyme structures.
Results
Ab initio molecular orbital calculations
The geometries of aromatic amino acids facing the re-
face of the flavin were determined using high-resolu-
tion plant-type FNR crystal structures. It was observed
that these tyrosines always interact in face-to-face posi-
tions (Fig. 1A; Table 1). The B ring of the flavin is
always involved in this interaction in a nearly parallel
position in which the angle formed with the tyrosine
phenol and isoalloxazine varies from 0° to 6° in all
high-efficiency plastidic FNRs and 15° for the ferre-
doxin-NADP(H) reductase from E. coli. To gain a
better understanding of this interaction, the geometric
preferences of the above-mentioned interaction were
analyzed using model molecules and ab initio mole-
cular orbital calculations with the restricted Hartree
Fock theory level and a 6-311 + G(d,p) basis set. A
simplified system was constructed containing lumiflavin
(7,8,10-trimethylisoalloxazine), which is an accepted

flavin model compound for calculations [23], and phe-
nol as the tyrosine R group. This system has been used
previously to analyze the geometry of the tyrosine
stacked on the si-face of the flavin in FNRs [12]. The
single point energies of the flavin–tyrosine system in
different conformations were calculated. The arrange-
ment of lumiflavin and phenol with the exact geometry
found between flavin and Y308 in the crystal structure
of pea FNR was used for the initial set-up. Then, dif-
ferent arrangements were generated in which the phe-
nol placed in this exact position was rotated around
the Cc–Cf axis in discrete steps, keeping the orienta-
tion of the phenol hydroxyl group and the distance
between the aromatic ring centroids constant (see
Fig. 2A). This allowed us to obtain arrangements of
the two molecules with angles (a) from )75° to 90°.
Figure 2B illustrates the differences in potential
energy values determined for arrangements of the phe-
nol–lumiflavin pair plotted against the angle a,as
depicted in Fig. 2A, at a centroid distance of 3.6 or
4.6 A
˚
. The value obtained for the natural geometry of
the carboxyl terminal tyrosine in pea FNR (5.8°) was
used as reference. These distances were chosen consid-
ering the tyrosine–flavin arrangement found in FNRs
and because energetically favorable, non-bonded, aro-
matic interactions occur in proteins at phenyl ring
centroid separations of > 3.4 and < 7 A
˚

[24].
A global energy minimum was theoretically detected
between 11° and 22° at a distance between centroids of
3.6 A
˚
. The angle found in E. coli FNR was the closest
to the minimum of the plot. In all plastidic FNRs, the
position of the tyrosine was near the minimum (repre-
sented in Fig. 2B with open circles and a number indi-
cating the enzyme). Any position that does not fall
within )10° to 37° notoriously decreases the stability of
the pair, increasing repulsion, probably as result of steric
constraints between the two aromatic rings. When the
total energy of the system was analyzed at a centroid–
centroid distance of 4.6 A
˚
, a minimum was observed at
40° and a shallow low-energy region was detected from
20° to 55°. Moreover, all differences in potential energy
values obtained for arrangements at 4.6 A
˚
between
angles from )20° to 85° were equal or lower than the
energy calculated for the observed arrangements found
in plastidic FNR enzymes in nature (Fig. 2B). All FNRs
Table 1. Angles and distances between the tyrosine interacting
with the re-face of the flavin and the isoalloxazine B ring obtained
from FNR crystal structures.
FNR source Type
Maximal

angle
(deg)
a
Centroid
distance
(A
˚
)
b
PDB
ID Reference
Paprika Plastidic 5.09 3.70 1sm4 [6]
Spinach Plastidic 0.01 3.65 1fnb [3]
Anabaena Plastidic 5.40 3.60 1que [4]
Pea Plastidic 5.80 3.65 1qg0 [21]
Maize Plastidic 1.60 3.65 1gaw [7]
Synechococcus
sp.
Plastidic 0.40 3.50 2b5o Unpublished
E. coli Bacterial 15.00 3.60 1fdr [10]
a
Angle formed between the tyrosine and the re-face of isoalloxa-
zine, measured as shown in Fig. 2A.
b
Distance (d ) from the center
of the phenol ring to the center of the proximal flavin ring, as
shown in Fig. 2A.
Enzyme efficiency modulated by amino acid volume M. A. Musumeci et al.
1352 FEBS Journal 275 (2008) 1350–1366 ª 2008 The Authors Journal compilation ª 2008 FEBS
displayed geometries for the re-face tyrosine phenol and

flavin falling near or into the minimum energy valley
with a centroid separation of about 3.6 A
˚
. However, if
the tyrosine were able to move away from the flavin, a
more stable arrangement was possible between both
aromatic rings, allowing them to gain up to approxi-
mately 5.8 kcalÆmol
)1
of stabilization energy, as calcu-
lated from Fig. 2B. Thus, it may be inferred that the
position of the re-face tyrosine in FNRs is not governed
by the energetic minimum of the pairwise flavin–phenol
interaction. By analyzing the crystal structure of pea
FNR, it was deduced that Y308 is constrained against
the isoalloxazine in an unfavorable conformational
arrangement by the influence of amino acids C266 and
L268. These residues face the other side of this tyrosine
and are members of a conserved loop (266CGLKG270)
that shapes part of the FNR catalytic site (see
Fig. 1A,B). They may force Y308 to adopt a more pla-
nar orientation with respect to the flavin. The overall
result is a less stable conformational arrangement.
Design and construction of C266, G267 and L268
single and double FNR mutants
Five single mutants of C266, G267 and L268 and a
double mutant of C266 and L268 were successfully
constructed and confirmed by DNA sequencing. The
design of the mutants was intended to preserve the
amino acid character and to modify only the relative

volume of their R groups.
The expression of the FNR mutants as soluble cyto-
solic proteins in E. coli was analyzed using SDS-PAGE
and western blot (not shown). The expression levels of
FNR mutants C266AL268A, C266A and L268V were
similar to those of recombinant wild-type FNR. These
recombinant enzymes were largely recovered in the sol-
uble fraction after the induction of protein expression
at 25 °C, disruption of E. coli cells and fractionation
by centrifugation. In contrast, replacement of either
G267 with a valine or C266 with a leucine or methio-
nine produced a notorious precipitation of the
expressed polypeptide. FNR mutants C266L and
C266M were successfully expressed at 15 °C during
16 h with 0.1 mm isopropyl thio-b-d-galactoside
(IPTG). Both C266L and C266M mutant enzymes
showed a higher FAD release rate [4.8 · 10
)2
and
2.6 · 10
)2
lmolÆFADÆh
)1
Æ(lmolÆFNR)
)1
, respectively]
than the wild-type enzyme [1.1 · 10
)5
lmolÆFADÆ
h

)1
Æ(lmolÆFNR)
)1
], as determined by measuring the
increase in FAD fluorescence [22] after incubating the
enzymes for 5 h at 25 °C. These observations suggest a
weaker FAD interaction with the apoprotein, and may
explain the difficulties in obtaining these enzymes in
soluble form during protein expression in E. coli.
Attempts to purify mutant enzyme G267V were unsuc-
cessful and no further analysis was possible.
All reductase variants were excised from the carrier
protein using thrombin protease and, after chromato-
graphy on nickel-nitrilotriacetic acid agarose, were
obtained in homogeneous form as judged by SDS-
PAGE (not shown).
FAD content and spectral properties
Analysis of the UV–visible absorption properties of
the different FNR mutants showed small changes,
AB
Fig. 2. Computed relative free energy calculations for the lumiflavin–phenol interaction. (A) Scheme of the coordinate system used to define
the relative positions of phenol and lumiflavin, as found for Y308 and flavin in pea FNR. a, Dihedral interplanar angle between rings (for clar-
ity, only three positions are shown); d, distance between ring centroids. (B) Relative free energy of the arrangement shown in (A) as a func-
tion of the stated a angles at fixed distances of 3.6 A
˚
(
, full line) and 4.6 A
˚
( , broken line). Open symbols indicate the observed values for
the different plastidic FNRs as follows: 1, paprika; 2, spinach; 3, Anabaena ; 4, pea; 5, maize; 6, Synechococcus sp.; 7, E. coli. Ab initio

molecular orbital calculations were performed as described in Materials and methods.
M. A. Musumeci et al. Enzyme efficiency modulated by amino acid volume
FEBS Journal 275 (2008) 1350–1366 ª 2008 The Authors Journal compilation ª 2008 FEBS 1353
indicating slight variations in the environment of the
flavin prosthetic group. All proteins displayed a typical
FNR spectrum with maxima at approximately 380 and
460 nm and shoulders at 430 and 470 nm. The absor-
bance maximum of the transition band of the wild-
type enzyme at 386 nm was shifted slightly to 381 nm
in the C266L, C266M and C266A mutants, but not in
the L268V mutant. At 459 nm, all changes were within
the detected error (Fig. 3A). These shifts may indicate
modification of the isoalloxazine environment,
although none of the amino acids that directly interact
with the flavin were modified. The FAD content of the
wild-type and mutant enzymes was determined by
release in the presence of 0.2% SDS [25]. FAD : poly-
peptide stoichiometry values of 0.85–0.99 were calcu-
lated for all mutants (not shown). Therefore, the
amino acid changes introduced do not prevent assem-
bly of the prosthetic group and do not impede the pro-
duction of a folded protein, although, as mentioned
above, they may affect the protein folding process.
CD spectra were recorded for wild-type and mutant
FNRs in an effort to assess the impact of the amino
acid changes on the structural integrity of the reducta-
ses. Wild-type and mutant FNRs had very similar
spectra, exhibiting a negative region from 204 to
240 nm, with a minimum similar for all proteins, and
a positive ellipticity at 202 nm (Fig. 3B). The near-UV

and visible CD spectra (Fig. 3C) of the proteins were
also very similar, showing the typical spectrum for
FNR [26], with positive ellipticity in the region of the
first flavin visible absorption band, and with a peak at
approximately 380 nm for the wild-type enzyme and
370 nm for the mutant proteins. This is consistent with
the alteration observed in the absorbance spectra of
the mutants. A less intense band of negative ellipticity
was observed in the region of the second flavin visible
band at 470 nm for the wild-type enzyme and mutant
proteins (Fig. 3C). In the near-UV region, all FNRs
exhibited very strong, sharp positive and negative sig-
nals at 271 and 286 nm, respectively. A similar strong
signal at 272 nm, observed in the CD spectrum of
E. coli Fld oxidoreductase, has been attributed to the
stacked interactions between FAD and one or more
aromatic residues [27]. The introduced mutations in
FNR did not alter the position of this near-UV band.
Some changes in intensity were observed in the FNR
mutants, indicating some perturbation of the symmetry
relationships between the isoalloxazine chromophore
Fig. 3. Absorbance and CD spectra of wild-type and mutant FNRs.
Absorbance (A) and CD (B, C) spectra of wild-type FNR (thick line),
L268V (thin line), C266AL268A (thick dotted line), C266A (thin dot-
ted line), C266L (thick broken line) and C266M (thin broken line).
For spectra at 200–250 nm (B), the optical path length was 0.2 cm
and the protein concentration of FNRs was 0.5 l
M. For spectra at
250–600 nm (C), the optical path length was 1 cm and the protein
concentration of FNRs was 5 l

M.
Enzyme efficiency modulated by amino acid volume M. A. Musumeci et al.
1354 FEBS Journal 275 (2008) 1350–1366 ª 2008 The Authors Journal compilation ª 2008 FEBS
and either the carboxyl terminal tyrosine side-chain or
the surrounding protein environment. Together, these
results clearly indicate that these mutations introduced
only local changes in the flavin microenvironment.
Interaction with substrates and steady-state
kinetics
The alterations in the flavin absorption spectrum and
the intrinsic FAD fluorescence were used as described
previously [19,25,28] to determine the binding con-
stants for the FNR–NADP
+
complexes. The differen-
tial spectral changes obtained by incubation of the
wild-type and mutant enzymes with NADP
+
are
shown in Fig. 4. NADP
+
binding to the L268V
mutant provoked spectral changes similar in shape and
intensity to that of the wild-type enzyme, with the
recognized maximum at 510 nm (Fig. 4). In contrast,
mutants C266L, C266AL268A, C266A and C266M
showed progressive changes in shape and maxima of
the differential spectra, indicating a modification in the
way in which the nucleotide interacts with the flavin
and ⁄ or its environment. Unexpectedly, dissociation

constants for NADP
+
were not significantly affected
in any of the mutants for either NADP
+
or Fd
(Tables 2 and 3, respectively). The only exception was
the double mutant, which showed an increase in the
K
d
value for the enzyme–NADP
+
complex. It has
been documented that the intensity of the FNR–
NADP
+
differential spectrum peak at about 510 nm
correlates with the nicotinamide interaction on the
re-face of the isoalloxazine [17,25,28,29]. It may be
inferred from the spectral data presented that the inter-
action of the NADP
+
nicotinamide with the flavin is
considerably disturbed, probably as a result of changes
introduced by the mutations in the environment of the
prosthetic group. As a result of the important changes
observed for each mutant in the differential spectra
elicited by NADP
+
, it was decided to use an alterna-

tive procedure to determine the affinity constant for
the nucleotide. The dissociation constants of the
FNR–NADP
+
(Table 2) and FNR–Fd (Table 3) com-
plexes were estimated by measuring flavin fluorescence
and flavoprotein fluorescence quenching, respectively,
after the addition of each substrate, as described in
Materials and methods. Similarly, the K
d
value of the
FNR–Fd complex was determined in the presence of
NADP
+
(Table 3). As shown in Table 2, values
obtained for the binding of NADP
+
are in good
agreement with those determined by differential spec-
troscopy. In our hands and using this methodology, a
significant decrease (7.6-fold) in the affinity of FNR
for Fd was detected when NADP
+
was added at a sat-
urating concentration, compared with the respective
affinity in the absence of substrate (Table 3). Interest-
ingly, in all cases, the mutations introduced diminished
or completely abolished the observed effect.
The catalytic properties of the different FNR
mutants were determined for two different enzymatic

reactions. The observed values for k
cat
and K
m
and
the calculated k
cat
⁄ K
m
value for NADPH and Fd are
summarized in Tables 2 and 3.
L268V FNR displayed k
cat
and K
m
values for the
diaphorase reaction in the region of 0.8 and 2.0 times
those observed for the wild-type enzyme. Similarly, the
decrease in Fd was about 0.7 times that observed with
the wild-type enzyme.
By contrast, mutations in C266 produced a more
dramatic effect on the catalytic properties of FNR.
Replacement of C266 with a methionine, which implies
a volume increase of 55.5 A
˚
3
, decreased the k
cat
value
by more than 99.8% and increased the K

m
value for
diaphorase activity three-fold. C266AL268A FNR, in
which substitutions produced an amino acid volume
decrease of 96.2 A
˚
3
, also showed a major disruption in
catalytic function, with a k
cat
reduction of more than
99% and a 20-fold increase in K
m
. The introduced
changes resulted in a 1300- and 2200-fold decrease in
the catalytic efficiency of C266M and C266AL268A,
respectively.
The correlation between the catalytic efficiency
changes caused by the mutations and the different
amino acid physicochemical properties was investi-
gated. All introduced mutations substituted a polar
Fig. 4. Interaction of wild-type and mutant FNRs with NADP
+
. Dif-
ferential spectra of the wild-type FNR (thick line), L268V (thin line),
C266AL268A (thick dotted line), C266A (thin dotted line), C266L
(thick broken line) and C266M (thin broken line) elicited by NADP
+
binding, as obtained from the mathematical subtraction of the
absorption spectra in the absence and presence of 0.3 m

M NADP
+
.
M. A. Musumeci et al. Enzyme efficiency modulated by amino acid volume
FEBS Journal 275 (2008) 1350–1366 ª 2008 The Authors Journal compilation ª 2008 FEBS 1355
neutral amino acid by non-polar residues without a
change in the net charge. The catalytic efficiencies of
the different enzymes were plotted as a function of the
absolute change of hydropathy according to Kyte and
Doolittle [30] (Fig. 5A), the octanol–water partition
coefficient (log P) [31] and volume [32]. No correla-
tions were found with changes in hydropathy (Fig. 5A)
and log P (Fig. 5B). In contrast, the absolute change
in volume correlated with the decrease in catalytic effi-
ciency (Fig. 5C). An alteration (increase or decrease)
in volume of the amino acid at position 266 induced a
decrease in catalytic efficiency of the enzyme. Mutants
with higher volume changes in this residue were more
affected. The value for the reduction in catalytic effi-
ciency previously obtained by replacement of spinach
FNR C272 (homolog to pea FNR C266) with a serine
[28] was included (open symbols in Fig. 5A–C and
white bar in Fig. 5D).
Mutations in C266 that decreased the amino acid
volume resulted in a moderate increase in catalytic effi-
ciency for the activity of cytochrome c reductase.
These results originate from the higher relative
decrease in K
m
than k

cat,
with respect to the corre-
sponding values observed in the wild-type enzyme, and
consequently inferences from the calculated changes in
catalytic efficiency may not be appropriate [33].
The accumulated data reviewed by Mattevi et al.
[34] indicate that the rate-limiting step in the oxygen
reactivity of flavoproteins is the first electron transfer
step from the two-electron-reduced flavin to mole-
cular oxygen. In this context, the oxidase activity of
the wild-type and mutant FNRs was investigated at
Table 2. Kinetic parameters for the diaphorase reaction of the wild-type (WT) and mutant FNRs, and dissociation constants for the different
FNR–NADP
+
complexes. Potassium ferricyanide reduction was measured using the diaphorase assay of Zanetti [68] in 50 mM Tris ⁄ HCl
(pH 8.0).
FNR form DV
a
(A
˚
3
)
K
m
(NADPH)
(l
M) k
cat
(s
)1

)
k
cat
⁄ K
m
(lM
)1
Æs
)1
)
DDG
MUT ⁄ WT
b
(kcalÆmol
)1
)
K
d
(NADP
+
)
c
(lM)
K
d
(NADP
+
)
d
(lM)

WT 0 15 ± 2 374 ± 22 25 ± 5 0.00 41 ± 2 38 ± 5
C266A )21.5 193 ± 32 39 ± 2 0.20 ± 0.04 2.86 22 ± 2 31 ± 5
L268V )25.0 31 ± 1 308 ± 15 9.97 ± 0.50 0.54 37 ± 2 31 ± 4
C266AL268A )96.2 299 ± 42 3.5 ± 0.5 0.011 ± 0.003 4.58 87 ± 6 120 ± 8
C266L 53.2 16 ± 2 2.32 ± 0.04 0.14 ± 0.01 3.07 29 ± 4 18 ± 1
C266M 55.5 44 ± 5 0.82 ± 0.04 0.018 ± 0.002 4.28 31 ± 2 18 ± 2
a
Volume change of the R amino acid groups introduced by the mutations was determined following the standard radii and volumes calcu-
lated by Tsai et al. [32].
b
DDG
MUT ⁄ WT
indicates the energy barrier introduced by the mutations to the catalytic efficiency of FNR calculated
by the following equation: DDG
MUT ⁄ WT
= )RT ln(k
cat
⁄ K
m
)
MUT
⁄ (k
cat
⁄ K
m
)
WT
.
c
Determined by differential spectra using  15 lM flavoproteins

in 50 m
M Tris ⁄ HCl (pH 8.0) at 25 °C. Absorbance differences (DA at 510 nm for the wild-type and L268V mutant FNRs, and at 390 nm for
the C266A, C266AL268A, C266L and C266M mutant FNRs) were measured and plotted against increasing NADP
+
concentration. The data
were fitted to a theoretical equation for a 1 : 1 complex.
d
Determined by fluorescence spectroscopy using oxidized flavoproteins at 8.5 lM
in 50 mM Tris ⁄ HCl (pH 8.0) at 25 °C, as described in Materials and methods.
Table 3. Kinetic parameters for cytochrome c reductase of the wild-type (WT) and mutant FNRs, and dissociation constants for the com-
plexes of the different FNR forms with Fd. Cytochrome c reduction was followed at 550 nm (e
550
=19mM
)1
Æcm
)1
) as described in Materials
and methods. ND, not determined.
FNR form
DV
a
(A
˚
3
)
K
m
(Fd)
(l
M)

k
cat
(s
)1
)
k
cat
⁄ K
m
(lM
)1
Æs
)1
)
K
d
for the FNR–Fd complex (lM)
In the presence
of NADP
+
(K
dP
)
b
In the absence
of NADP
+
(K
dA
)

b
K
dP
⁄ K
dA
WT 0 2.2 ± 0.4 1.62 ± 0.14 0.73 ± 0.19 5.16 ± 0.25 0.68 ± 0.02 7.6
C266A –21.5 0.20 ± 0.03 0.74 ± 0.03 3.70 ± 0.70 2.78 ± 0.20 1.02 ± 0.13 2.8
L268V –25.0 4.6 ± 0.8 1.08 ± 0.08 0.23 ± 0.05 2.80 ± 0.30 2.69 ± 0.10 1.0
C266AL268A –96.2 0.004 ± 0.001 0.016 ± 0.0009 4.00 ± 1.22 2.74 ± 0.24 2.20 ± 0.26 1.3
C266L 53.2 ND ND ND 2.86 ± 0.22 2.88 ± 0.19 1
C266M 55.5 ND ND ND 3.53 ± 0.39 2.77 ± 0.15 1.3
a
Volume change of the R amino acid groups introduced by mutations was determined following the standard radii and volumes calculated
by Tsai et al. [32].
b
Determined by fluorescence spectroscopy using oxidized flavoproteins at 3 lM in 50 mM Tris ⁄ HCl (pH 8.0) at 25 °Cin
the absence or presence of 0.3 m
M NADP
+
, as described in Materials and methods.
Enzyme efficiency modulated by amino acid volume M. A. Musumeci et al.
1356 FEBS Journal 275 (2008) 1350–1366 ª 2008 The Authors Journal compilation ª 2008 FEBS
saturating NADPH concentration. As shown in
Table 4, wild-type and mutant enzymes displayed simi-
lar oxidase activities, indicating that no changes are
evident in this process on mutation of the FNR resi-
dues under study.
Thermal analysis of protein unfolding for
wild-type and mutant FNRs
Thermal denaturation determined by CD was used to

measure the stability of the FNR mutants. Based on
measurements over a range of temperatures (shown in
Fig. 6), parameters such as the midpoint of the unfold-
ing transition melting point (T
m
) were calculated, and
are shown in Table 5. Curves were also analyzed on
the basis of the two-state model [35], and the corre-
sponding DS
m
values (entropy change at T
m
) were
calculated from the slopes of DG versus T at midpoint
temperatures [35]. All replacements led to less stable
enzymes compared with wild-type FNR. However,
mutations that introduced reductions in amino acid
volume caused slight to moderate changes in stability
with respect to the wild-type enzyme (– 0.76 to
)0.94 kcalÆmol
)1
). Using the foldx algorithm [36], the
C266A
L268A
L268V C266A C272S WT C266L C266M
–25.0
–21.5
–16.3
0.0
53.2

55.5
–96.2
ΔV (Å
3
)
FNRs
ΔV (Å
3
) (absolute value)
1
ΔHydropathy (absolute value)
ΔlogP (absolute value)
0 20 40 60 80 100
0.01
0.1
10
100
0234
0.01
0.1
1
10
100
0.0 0.1 0.2 0.3 0.4 0.5
k
cat
/K
m

(%)

k
cat
/K
m

(%)
1
AB
CD
Fig. 5. Catalytic efficiencies of wild-type and mutant FNRs plotted as a function of different amino acid physicochemical properties. The cat-
alytic efficiencies of wild-type and mutant FNRs from Table 2 (percentage of the wild-type enzyme) are plotted as a function of the absolute
changes in hydropathy [30] (A), octanol–water partition coefficient [31] (B), volume [32] (C) and volume change in C266 (filled bars) and L268
(hatched bar) mutants (D). The FNR mutant C272S from spinach showed a k
cat
⁄ K
m
value five-fold lower than that of the wild-type reductase
(0.40 versus 14.28 l
M
)1
Æs
–l
) [28], and is represented by an open symbol in (A), (B) and (C) and a white bar in (D). Substitution of C with S
introduces a volume change of )16.3 A
˚
3
.
Table 4. Oxidase activity of the wild-type (WT) and mutant FNRs.
Oxidase activity was followed by NADPH oxidation, as described in
Materials and methods.

FNR form DV (A
˚
3
) Oxidase activity (s
)1
)
WT 0 0.10 ± 0.01
C266A )21.5 0.09 ± 0.01
L268V )25 0.09 ± 0.01
C266AL268A )96.2 0.08 ± 0.009
C266L 53.2 0.11 ± 0.01
C266M 55.5 0.14 ± 0.01
M. A. Musumeci et al. Enzyme efficiency modulated by amino acid volume
FEBS Journal 275 (2008) 1350–1366 ª 2008 The Authors Journal compilation ª 2008 FEBS 1357
direct effect of mutations that replace native amino
acids with alanine on the overall stability of the pro-
tein was evaluated. A theoretical DDG value of
)1.02 kcalÆmol
)1
was obtained for the C266A mutant,
in complete agreement with our experimental results.
When the amino acid mutation induced a volume
increase, important destabilizations were experimen-
tally observed. C266L and C266M exhibited lower
DDG values: )8.50 and )6.80 kcalÆmol
)1
, respectively.
These outcomes indicate that although little influence
is exerted by residue substitutions on the destabiliza-
tion of the secondary and tertiary structure (see Fig. 3)

there is a considerable difference in thermal energy
change between the wild-type enzyme and mutants
with replacements that increase volume.
Discussion
The role of the aromatic residue interacting with the
re-face of the flavin in FNR-like enzymes has been
analyzed, and a variety of functions have been pro-
posed [14,16,18,19,37,38]. In previous publications,
mechanistic evidence has been presented that the inter-
action of the nicotinamide of substrate NADP
+
with
the isoalloxazine is modulated by the terminal tyrosine
(Y308 in pea FNR) [15,17,18]. During binding of
NADP
+
, the terminal tyrosine should be removed
from its resting place to allow the nicotinamide to
move into a productive position [21]. This exchange
between Y308 and the NADP
+
nicotinamide has been
experimentally indicated as the enzyme rate-limiting
step [18]. Evidence has recently been presented that the
mobility of the carboxyl terminal region is essential for
obtaining high catalytic rates [19]. Ab initio calcula-
tions and mutagenesis studies were performed on the
FNR enzyme with the aim of obtaining a better under-
standing of the structural and functional role of this
tyrosine and the interacting amino acids C266, G267

and L268. The data support the hypothesis that the
aromatic interaction between the flavin, Y308 and the
nicotinamide of NADP
+
is precisely tuned by selecting
amino acids that face the other side of the tyrosine
phenol ring. The specific volumes of the above-men-
tioned residues condition the arrangement of Y308
and the nicotinamide of NADP
+
in the catalytic site.
Non-covalent aromatic interactions are essential to
protein–ligand recognition [39]. Furthermore, they are
widespread in biomolecules, clusters, organic ⁄ biomo-
lecular crystals and, more recently, in the building of
nanomaterials [40]. In proteins, the rings of trypto-
phan, tyrosine, phenylalanine and histidine participate
either in the interaction with hydrogen donors (p–H
interaction) or binding with other aromatic rings (p–p
interactions) [41]. The latter interactions are observed
in a great variety of geometries. The edge–face geome-
try is commonly found between aromatic residues in
proteins. Other two-stacked orientations are also estab-
lished, including one in which the interacting rings are
offset and stacked near-planar, and arrangements of
face-to-face stacked aromatic rings [42].
By analyzing the crystal structure of FNRs, it was
found that the inter-ring orientational angles between
the re-face aromatic ring and flavins were quite con-
stant and always positioned at a limiting distance of

3.6 A
˚
. Our ab initio calculations indicated that Y308 in
pea FNR adopts a conformation close to minimum
Table 5. Thermodynamic parameters derived from the thermally
induced unfolding curves of wild-type (WT) and mutant FNRs. The
data of Fig. 6 were analyzed assuming a two-state approximation
as described previously [67].
FNR form DV
a
(A
˚
3
) T
m
(
0
C)
DS
m
(kcalÆmol
)1
Ædeg
)1
)
DDG
(kcalÆmol
)1
)
WT 0 64.7 ± 0.2 0.61 ± 0.04

C266A )21.5 63.2 ± 0.3 0.71 ± 0.03 )0.94
L268V )25.0 63.5 ± 0.1 )0.40 ± 0.01 )0.76
C266AL268A )96.2 63.5 ± 0.1 0.69 ± 0.01 )0.77
C266L 53.2 50.8 ± 0.1 0.38 ± 0.01 )8.50
C266M 55.5 53.6 ± 0.2 0.43 ± 0.02 )6.80
a
Volume change of the R amino acid groups introduced by the
mutations was determined following the standard radii and vol-
umes calculated by Tsai et al. [32].
Fig. 6. Thermal unfolding of wild-type and mutant FNRs monitored
by CD. CD melting curves were recorded at 280 nm, using a pro-
tein concentration of 3 l
M in 50 mM potassium phosphate (pH 8.0),
whilst the temperature of the sample was increased at a uniform
rate of 1 °CÆmin
)1
(from 25 to 80 °C). Wild-type FNR (thick line),
L268V (thin line), C266AL268A (thick dotted line), C266A (thin dot-
ted line), C266L (thick broken line) and C266M (thin broken line) are
shown.
Enzyme efficiency modulated by amino acid volume M. A. Musumeci et al.
1358 FEBS Journal 275 (2008) 1350–1366 ª 2008 The Authors Journal compilation ª 2008 FEBS
energy for a distance of 3.6 A
˚
. However, when calcula-
tions were performed with aromatic rings stacked at
4.6 A
˚
, a lower energy minimum was obtained. These
results suggest that, if more freedom were available for

the arrangement, the aromatic ring of the tyrosine
would adopt a T-shaped geometry, with increased
stabilization of the pair. In all plastidic FNRs, Y308
homologs are close to the calculated minimum at
3.6 A
˚
, supporting the theoretical data obtained. More-
over, it may be inferred from these observations that
the orientation of Y308 with respect to the flavin is
mainly governed by the aromatic interaction without
involvement of attractive forces from the other side of
tyrosine. The relative stability of planar and T-shaped
aromatic interactions has been studied extensively, but
consolidated conclusions are still being debated. The
accumulated evidence indicates that the T-shaped
structure is likely to be more stable than the planar
stacked structure, as calculated for model systems [42].
Tyrosines have been found to interact with flavins in a
myriad of arrangements, including, for example, spa-
tial T-shaped arrangements [12,34], planar parallel and
displaced stacks [1,2,13,43,44] and even near-90°
T-shaped orientation [45], demonstrating that the sur-
rounding environment can condition these arrange-
ments. It has been observed previously that Y89 in pea
FNR, which faces the si-face of the flavin in a
T-shaped geometry of 54°, is close to the global energy
minimum [12]. Similar conclusions have been found
for the phenol side-chain of the si-face tyrosine of sev-
eral FNR family flavoproteins ([12,46] and references
therein). Our calculations also indicate that the tyro-

sine–flavin bacterial arrangement in E. coli FNR is
1.24 kcalÆmol
)1
more stable than that observed for the
same pair in plastidic pea FNR (open circle numbered
4 in Fig. 2). Thus, tyrosine displacement for nicotin-
amide binding should be easier in pea FNR than in
the bacterial enzyme. As this movement was postulated
to be the rate-limiting step for catalysis [18], the differ-
ences in stability may account for the distinct turnover
numbers that are 20- to 100-fold lower for bacterial
enzymes than their plastidic and cyanobacterial coun-
terparts.
Our mutants enabled the observed results to be
interpreted in terms of protein structure, thermody-
namics and function. The C266 mutants are of particu-
lar interest because this residue has functional
homologs in all FNR-like structures. Moreover, the
cysteine and glycine at this position are part of one of
the consensus sequences that define the structural fam-
ily [1,11]. As anticipated, the final tertiary structure of
the mutants, with the exception of G267V, was rela-
tively unchanged, as shown by the fact that mutations
in FNR did not alter the near-UV band of the
CD spectra. A small perturbation of isoalloxazine was
detected by CD and UV–visible spectrophotometry.
Flavin electronic transitions in the 300–600 nm region
originate from p–p transitions [26]. Thus, changes in
the CD spectra are expected to occur on modification
of the interaction of Y308 with the flavin. Our mutants

displayed variations at 370–380 nm, correlating with
the changes observed in that region of the UV–visible
spectra. Mutations may induce either a change in the
interaction strength between the flavin and Y308 or a
displacement of the ‘in’ and ‘out’ equilibrium of the
Y308 phenol ring [15,17,21], which could not be
detected by crystal structure analysis.
Alteration of the flavin environment was more
noticeable when the differential spectra elicited by
NADP
+
binding were analyzed. These changes were
closely related to the magnitude of the changes intro-
duced with respect to the wild-type enzyme. Substitu-
tion of C266 with the bulky methionine completely
reverted the shape of the differential spectrum of the
wild-type enzyme with NADP
+
, producing a profile
quite similar to that already obtained for the wild-type
FNR from Anabaena variabilis when the nucleotide is
bound [47]. The absence of the characteristic band at
510 nm for the flavin–nicotinamide interaction has
been explained by the observation that the C-terminal
tyrosine in this enzyme has a reduced degree of ‘out’
conformations relative to other plastidic FNRs. Conse-
quently, our observations may account for a reduced
interaction of the nicotinamide with the flavin in the
C266M mutant. Moreover, spectral changes on
NADP

+
binding to L268V are coincident with the dif-
ferential spectra previously obtained for the Anabaena
variabilis FNR mutant L263A [47]. The K
d
values
obtained for NADP
+
binding to the mutants were
only slightly modified, with the exception of the double
mutant. It can be concluded that the interactions with
the adenine and phosphate regions of NADP
+
are
conserved, and that the observed alteration is probably
the result of a change in the position or extent of inter-
action between the flavin and the nicotinamide.
Kinetic analysis of the mutants indicates that the
cysteine sulfhydryl group is by no means essential for
catalysis, as documented previously [28]. Replacement
of C266 by any aliphatic residue produced enzymes
that, even when notoriously affected in catalysis, were
still active. When the cysteine was substituted with a
methionine, providing a sulfur atom in a nearby posi-
tion, a functional enzyme was also obtained. Sulfur–
flavin interactions have been proposed and analyzed
by computational studies and experimental means
[48,49]. These studies have indicated the existence of
M. A. Musumeci et al. Enzyme efficiency modulated by amino acid volume
FEBS Journal 275 (2008) 1350–1366 ª 2008 The Authors Journal compilation ª 2008 FEBS 1359

an interaction of sulfur with the electron-deficient
pyrimidine moiety of the flavin ring system. In the case
of Fld from Clostridium beijerinckii, a methionine is
located 3.9 A
˚
from the flavin. A methionine to alanine
mutation of this enzyme reduced the flavin binding
energy by 0.5 kcalÆmol
)1
[50]. In pea FNR, the sulfhy-
dryl group of C266 is 6.17 A
˚
from the closest point of
the isoalloxazine ring, suggesting that no sulfur–aro-
matic orbital or inductive effects will be produced. The
observed effects cannot be produced by direct interac-
tion between the cysteine and isoalloxazine, unless a
rearrangement of the cysteine occurs during movement
of the terminal tyrosine, placing its R group closer to
the flavin ring. At present, there is no experimental
data to sustain this latter hypothesis.
Mutations in C266 produced a significant decrease
in k
cat
⁄ K
m
. Effects on the K
m
values were observed
when C266 was substituted with alanine, resulting in a

volume decrease. Interestingly, the double mutant
C266AL268A, in which both amino acid replacements
reduced the amino acid volume, displayed a greater
change in K
m
. A correlation was observed between the
volume change introduced by the mutation in position
266 and the decrease in enzyme catalytic efficiency.
Remarkably, the value for the catalytic efficiency pre-
viously obtained by replacement of the homologous
residue in spinach FNR (C272) with a serine [28] fits
perfectly on our graph, and follows the trend of the
other mutants. Our theoretical calculations indicate
that a more stable arrangement of the flavin and tyro-
sine would provide up to approximately 5.8 kcalÆmol
)1
of stabilization energy. This value is in good agreement
with the energy barrier introduced by the mutations to
the catalytic efficiency of FNR, as shown in Table 2.
Data from the L268V mutant also support our
hypothesis, although the change in k
cat
was smaller
than that observed for enzymes mutated at position
266. L268V FNR shows a catalytic efficiency of about
40% with respect to that of the wild-type enzyme. Sim-
ilar observations have been made previously by mutat-
ing the equivalent residue L263 in Anabaena FNR. In
the latter case, L263A (change in volume, )74.7 A
˚

3
)
and L263P (change in volume, )36.9 A
˚
3
) showed a
catalytic efficiency decrease of 29.6% and 6.7% with
respect to the wild-type Anabaena enzyme, respectively
[47]. The 268 position seems to be less restrictive with
respect to volume alteration in concordance with its
more exposed location, as observed in the crystal
structure of pea FNR [21]. As shown in Table 4, the
oxidase activity of the mutants was not affected to the
same extent as the other enzymatic activities. Mattevi
et al. [34] have suggested that the rate-limiting step in
the oxygen reaction with flavins is the first electron
transfer step from the reduced flavin, and that changes
in residues neighboring the flavin can result in dra-
matic alterations of the reactivity towards oxygen. The
reaction with flavins is quite complex and still not
completely understood. However, following the analy-
sis of Mattevi et al. [34], it can be inferred that the
amino acid changes introduced in FNR in this study
did not modify the thermodynamic driving force of the
reaction of the enzyme with oxygen, suggesting that
substitutions may not induce significant changes in the
redox potential of the flavin.
Our results may explain certain functions of these
amino acids that have not been completely uncovered.
Significant destabilization of the folded protein was

observed only when C266 was mutated with an amino
acid that induced an important volume increase, but
not when substituted with smaller amino acids. L268V
is only 0.76 kcalÆmol
)1
less stable than wild-type FNR.
Thus, C266 has not been evolutionarily selected to
merely stabilize the protein structure. The importance
of amino acid volume in relation to non-synonymous
substitutions in proteins was envisaged several years
ago [51]. When globin sequences were analyzed, it was
observed that the total sequence volume in conserved
proteins was quite constant, with variations of 2–3%
[52]. The variation in amino acid volume per internal
position is in the region of 13% and up to 21% in sur-
face residues [52]. Recently, it has been observed that
the probabilities of compensatory mutations that
involve small changes in amino acid volumes are
higher [53]. These observations may be taken to sup-
port the intuitive idea that small changes may produce
a lesser effect on protein structure, consistent with that
observed in the protein stability of our mutants. There-
fore, these conclusions strengthen our hypothesis that
the catalytic efficiencies of the recombinant enzymes
used in our study were related to the volume of the
mutated amino acids. It has been proposed that, in
Anabaena FNR, the 261–265 loop (which is equivalent
to the 266–270 region in pea FNR, see Fig. 1) is
involved in determining coenzyme specificity [47]. A
triple mutant of amino acids T155G ⁄ A160T ⁄ L263P

produced a marked retraction of the above-mentioned
loop, resulting in a decrease in catalytic efficiency and
a relaxation of enzyme specificity. Our data are consis-
tent with this observation, and may also be taken as
an indication that a volume reduction in this region
conditions the positioning of substrate and nicotin-
amide binding. There is no simple explanation for the
unexpected increase in catalytic efficiency for cyto-
chrome c reductase activity in C266 mutants that
introduced a decrease in amino acid volume. It is evi-
dent that the mutations decreased both K
m
and k
cat
,
Enzyme efficiency modulated by amino acid volume M. A. Musumeci et al.
1360 FEBS Journal 275 (2008) 1350–1366 ª 2008 The Authors Journal compilation ª 2008 FEBS
the effect on the Michaelis constant being higher than
that on the activity of the enzyme. Although the ulti-
mate catalytic mechanism of Fd reduction by FNR is
not known, it has been suggested that electron transfer
from the two-electron substrate NADPH to Fd pro-
ceeds in an ordered pathway, in which the observed
K
m
value results from the sum of the K
m
values for the
successive interaction of the two one-electron Fd sub-
strates. These values may change independently to give

the final observed result. At present, there are no
experimental data to clarify this issue.
Another scenario should also be considered. C266
participates in a hydrogen bond net that includes the
essential amino acids S90 and E306 and the B side of
the nicotinamide C4 atom, when NADP
+
is bound in
a productive position [21]. These residues are primarily
involved in nicotinamide binding rather than being
directly involved in the hydride transfer reaction [21].
Our results, together with the amino acid arrangement
observed in the catalytic site, indicate that C266 may
constrain the nicotinamide and or the terminal tyrosine
against the flavin. It has been described that the bind-
ing of NADH to lactate dehydrogenase conditions the
nicotinamide glycosidic bond torsion angle, altering the
distribution of conformations, and thus promoting
the catalytic reaction [54]. Residues C266 and L268
may influence the conformational freedom of the sub-
strate, favoring a reactive conformation. In other
enzymes, the role of pressing the nicotinamide against
the flavin may be carried out by other residues. For
example, in bacterial reductases from Azotobacter vine-
landii [9] and Rhodobacter capsulatus [8], which belong
to subclass I [1], the interacting amino acid facing the
re-side of the flavin is a conserved alanine. Similarly, in
human glutathione reductase [55,56] and thioredoxin
reductase [45] a tyrosine residue, which changes from a
T-shaped aromatic interaction to a planar position,

forces the productive complex by pressing the nicotin-
amide against the flavin. Some FNR superfamily mem-
bers, such as cytochrome b5 [57] and nitrate reductase
[58], do not have aromatic residues interacting with the
re-face of the flavin. In these structures, it has been
proposed that the glycine-rich loop that blocks the nic-
otinamide binding site undergoes a considerable rear-
rangement to allow for productive substrate binding.
Consistently, although an equivalent cysteine is found
in this reductase, mutations resulting in small volume
changes at this residue are accepted. The cyto-
chrome b5 mutant, in which the cysteine is replaced
with a serine, is completely active and, when an alanine
is introduced, the mutant obtained displays only a five-
fold decrease in k
cat
, indicating that replacement of this
residue in this enzyme is more permissible [59].
Another interesting outcome of our study is the fact
that, in all cases, the mutations introduced diminished
or completely abolished the FNR negative cooperativi-
ty between NADP
+
and Fd. It is well known that the
affinity of FNR for oxidized Fd decreases by more
than 10-fold on addition of NADP
+
[60]. Considering
that molecular modeling indicates that neither
NADP

+
nor the residues C266, G267 and L268 are
adjacent to the Fd binding site [2], it may be concluded
that a conformational change involving distant regions
of the protein may occur on NADP
+
binding. As
mentioned previously, Hermoso et al. [5] proposed that
the loop including C266, G267 and L268 suffers a
structural rearrangement on NADP
+
binding. Taken
together, it is suggested that this conformational
change in protein structure may allow enzyme negative
co-operativity to occur between substrates, with C266
being the key residue for initiating this process.
Materials and methods
Ab initio molecular orbital force field calculations
and amino acid physicochemical properties
The original FAD and tyrosine arrangements were based
on X-ray diffraction data for the pea enzyme [21]. Angles
and distances were calculated using hyperchem version
6.01 (HyperCube Inc., Gainesville, FL, USA) and gopen-
mol version 3.00, written by Leif Laaksonen and available
at .fi/gopenmol/. The effect of alanine substi-
tutions was estimated using foldx software [36]. Figures
were built using pymol, available at rce-
forge.net/. Ab initio molecular theory calculations were car-
ried out at the Restricted Hartree Fock theory level with pc
gamess V7.0 accessible at />gamess/index.html using a 6-311 + G(d,p) basis set. The

volume change of the R amino acid groups introduced by
mutations was calculated following the standard radii and
volumes calculated by Tsai et al. [32], assuming a reduced
state of the cysteine. Amino acid hydropathy was taken
from [30]. The raw octanol–water partition coefficients [31]
were scaled as follows: scaled parameters = (raw parame-
ters + 2.061) ⁄ 4.484.
Plasmid construction, protein expression and
purification
Wild-type and mutant pea FNRs were overexpressed in
E. coli as reported previously using vector pET205 [22].
This vector expresses a Trx–HisÆtag–FNR fusion protein
that contains a thrombin recognition site between the HisÆ
tag and the mature FNR.
Pea FNR variants L268V, C266A, C266AL268A and
G267V were obtained by the megaprimer method [61].
M. A. Musumeci et al. Enzyme efficiency modulated by amino acid volume
FEBS Journal 275 (2008) 1350–1366 ª 2008 The Authors Journal compilation ª 2008 FEBS 1361
Briefly, the coding sequence for mature FNR was amplified
using oligonucleotides FNRL268V (5¢-ACTTTTGTCTA
CATGTGTGGAGTGAAAGGAATGG-3¢), FNRC266A
(5¢-ACTTTTGTCTACATGGCTGGACTGAAAGGAAT
GG-3¢), FNRC266AL268A (5¢-ACTTTTGTCTACATGGC
TGGAGCGAAAGGAATGG-3¢) or FNRG267V (5¢-ACTT
TTGTCTACATGTGTGTACTGAAAGGAATGG-3¢) and
FNRlw (5¢-TCAAGACCCGTTTAGAGG-3¢) as primers
and plasmid pET205 as template. After amplification, the
product (532 bp) and the oligonucleotide FNRup (5¢-TCTT
CTGGTCTGGTGCCACGCGGTTCTAT-3¢) were used as
primers in the second PCR. The amplified product was

digested with NheI and EcoRI enzymes and the resulting
fragment was ligated into pET205 vector digested with the
same enzymes. FNR mutants C266L and C266M were
obtained using the overlap extension PCR method [62].
In this case, the coding sequence for mature FNR was
amplified using oligonucleotides FNRC266L (5¢-GACAA
CACTTTTGTCTACATGTTGGGACTGAAAGG-3¢)or
FNRC266M (5¢-GACAACACTTTTGTCTACATGATGG
GACTGAAAGG-3¢) and FNRlw1 (5¢-GTAATCTATCTA
CAGAATACAGGAGGGTGATA-3¢) as primers and plas-
mid pCV105 [63] as template. In addition, oligonucleotides
FNRup1 (5¢-AACAAGTTCAAACCTAAGGAACCATA
CG-3¢) and FNRC266Llw (5¢-CCTTTCAGTCCCAACA
TGTAGACAAAAGTGTTGTC-3¢) or FNRC266Mlw
(5¢ -C CTTTCAGTCC
CATCATGTAGACAAAAGTGTTG
TC-3¢) were used as primers in a second PCR. After ampli-
fication, the products were used as template in a third PCR
with oligonucleotides FNRup1 and FNRlw1 as primers.
The amplified product was digested with ClaI and NheI
enzymes and the resulting fragment was ligated into
pCV105 vector [63] digested with the same enzymes.
Finally, this plasmid was digested with NheI and EcoRI
enzymes and the fragment of 880 bp obtained was ligated
into pET205 vector digested with the same enzymes. In the
primer sequences, the bold letters indicate a silent mutation
that generates an AccI recognition site which was used for
mutant screening. The italic letters indicate mutations that
produce the amino acid variants. Finally, all constructions
were verified by DNA sequencing.

Expression of the different FNR variants was performed
as follows: wild-type and C266A, L268V and C266AL268A
mutant FNRs were expressed in E. coli cells induced with
0.25 mm IPTG at 25 °C for 4 h; mutants C266L and
C266M were expressed in cells induced with 0.10 mm IPTG
at 15 °C for 16 h. After induction, cells were collected and
recombinant enzymes were purified from the cell extracts
by affinity chromatography using nickel-nitrilotriacetic acid
agarose (QIAGEN, Valencia, CA, USA). Proteins were
eluted with 100 mm imidazole and then dialyzed against
50 mm Tris ⁄ HCl (pH 8.0), 150 mm NaCl. The fusion pro-
tein was digested with thrombin and the Trx–HisÆtag was
removed by another nickel-nitrilotriacetic acid affinity chro-
matographic procedure.
Recombinant pea Fd was obtained via expression in
E. coli using vector pET28-Fd [22]. Fd purification was per-
formed essentially as described previously [64].
The purity of all protein preparations was confirmed by
SDS-PAGE [65], and protein concentrations were deter-
mined by UV–visible spectrophotometry.
FAD release from the purified wild-type, C266L and
C266M FNRs was measured by fluorescence as the percent-
age emission at 526 nm relative to that of free FAD at the
same concentration [22]. In all cases, immediately before
the measurements, the samples were filtered through a G25
Sephadex (Sigma, St Louis, MO, USA) spin column equili-
brated with 50 mm Tris ⁄ HCl (pH 8.0), 150 mm NaCl. The
FNR samples (4.2 lm) were excited at 456 nm and FAD
fluorescence emission was measured at 526 nm at 25 °C
during 5 h.

Spectral analyses
Absorption spectra were recorded on a Shimadzu (Kyoto,
Japan) UV-2450 spectrophotometer. CD spectra were
obtained using a JASCO (Tokyo, Japan) J-810 spectropola-
rimeter at 25 °C. The spectra were recorded on solutions
having protein concentrations of 5.0 lm for the near-UV
and visible regions (250–600 nm) and 0.5 l m for the far-
UV region (200–250 nm). Samples were filtered through a
G25 Sephadex spin column equilibrated with 50 mm potas-
sium phosphate (pH 8.0) before measurements. Extinction
coefficients of the FNR forms were determined by releasing
FAD from the protein by treatment with 0.2% (w ⁄ v) SDS
and quantifying the flavin spectrophotometrically [25].
Determination of dissociation constants of the
FNR–NADP
+
complex
The K
d
values of the complexes between different FNR
variants and NADP
+
were determined either by difference
absorption spectroscopy, essentially as described previously
[19], or by fluorescence spectroscopy monitoring FAD fluo-
rescence [22,66]. Fluorescence spectra were monitored using
a Varian (Palo Alto, CA, USA) Cary Eclipse fluorescence
spectrophotometer interfaced with a personal computer.
For difference absorption spectroscopy,  15 lm flavopro-
tein in 50 mm Tris ⁄ HCl (pH 8.0) was titrated at 25 °C with

NADP
+
. After each addition, the absorbance spectrum
(200–600 nm) was monitored. Then, the difference spectra
were calculated and the absorbance differences at the stated
wavelength were plotted against the NADP
+
concentration.
The data were fitted to a theoretical equation for a 1 : 1
complex. In all cases, samples had been previously filtered
through a desalting column equilibrated with 50 mm
Tris ⁄ HCl (pH 8.0).
To determine the K
d
values of the complexes between dif-
ferent FNR variants and Fd, solutions containing 3 lm
Enzyme efficiency modulated by amino acid volume M. A. Musumeci et al.
1362 FEBS Journal 275 (2008) 1350–1366 ª 2008 The Authors Journal compilation ª 2008 FEBS
flavoprotein in 50 mm Tris ⁄ HCl (pH 8.0) were titrated with
Fd. After each addition, flavoprotein fluorescence quench-
ing at 340 nm (excitation at 270 nm) was registered. The K
d
values were estimated by fitting the fluorescence data to a
theoretical equation for a 1 : 1 complex. The K
d
determina-
tions for FNR–Fd were performed either in the absence or
presence of 0.3 mm NADP
+
.

Thermal unfolding transitions
Protein stock solutions were diluted to a final concentration
of 3 lm in 50 mm potassium phosphate (pH 8.0). The CD
signal was registered by excitation at 280 nm whilst the
temperature of the sample was increased at a uniform rate
of 1 °CÆmin
)1
(from 25 to 80 °C). Thermal unfolding transi-
tions were analyzed assuming a two-state approximation in
which only the native and unfolded states are significantly
populated. T
m
, DS
m
and DDG values were determined as
described previously [67].
Enzymatic assays
FNR-dependent diaphorase and cytochrome c reductase
activities were determined using published methods [68].
The cytochrome c reductase activity of FNR was assayed
in a reaction medium (1 mL) containing 50 mm Tris ⁄ HCl
(pH 8.0), 0.3 mm NADP
+
,3mm glucose-6-phosphate, 1 U
of glucose-6-phosphate dehydrogenase, 50 lm cytochrome c
and 5 lm Fd. After the addition of  15–100 nm FNR, the
reaction was monitored spectrophotometrically by follow-
ing cytochrome c reduction at 550 nm (e
550
=19mm

)1
Æ
cm
)1
). NADPH oxidase activity was measured in
Tris ⁄ HCl (pH 8.0) containing 0.15 mm NADPH and
150 mm NaCl. The reaction was followed by the decrease
in absorbance at 340 nm due to NADPH oxidation after
the addition of 370 nm of enzyme. The higher concentra-
tion of enzyme was necessary because of the low NADPH
oxidase activity of FNR. All kinetic experiments were per-
formed at 30 °C. In all cases, precautions were taken to
ensure linearity of the enzyme activity determinations and,
when appropriate, saturation of the Michaelis–Menten
plots was verified.
Determination of parameters
All experimental data were fitted to theoretical curves using
sigmaplot (Systat Software Inc., Point Richmond, CA,
USA).
Acknowledgements
This study was supported by grants from Consejo
Nacional de Investigaciones Cientı
´
ficas y Te
´
cnicas
(CONICET, Argentina) and Agencia de Promocio
´
n
Cientı

´
fica y Tecnolo
´
gica (ANPCyT, Argentina). EAC
is a staff member of CONICET. MAM and DLCD
are fellows of the same institution.
References
1 Ceccarelli EA, Arakaki AK, Cortez N & Carrillo N
(2004) Functional plasticity and catalytic efficiency in
plant and bacterial ferredoxin-NADP(H) reductases.
Biochim Biophys Acta 1698, 155–165.
2 Carrillo N & Ceccarelli EA (2003) Open questions in
ferredoxin-NADP
+
reductase catalytic mechanism. Eur
J Biochem 270, 1900–1915.
3 Bruns CM & Karplus PA (1995) Refined crystal struc-
ture of spinach ferredoxin reductase at 1.7 A
˚
resolution:
oxidized, reduced and 2¢-phospho-5¢ -AMP bound states.
J Mol Biol 247, 125–145.
4 Serre L, Vellieux FM, Medina M, Gomez-Moreno C,
Fontecilla-Camps JC & Frey M (1996) X-ray structure
of the ferredoxin:NADP
+
reductase from the cyanobac-
terium Anabaena PCC 7119 at 1.8 A
˚
resolution, and

crystallographic studies of NADP
+
binding at 2.25 A
˚
resolution. J Mol Biol 263, 20–39.
5 Hermoso JA, Mayoral T, Faro M, Gomez-Moreno C,
Sanz-Aparicio J & Medina M (2002) Mechanism of
coenzyme recognition and binding revealed by crystal
structure analysis of ferredoxin-NADP
+
reductase com-
plexed with NADP
+
. J Mol Biol 319, 1133–1142.
6 Dorowski A, Hofmann A, Steegborn C, Boicu M &
Huber R (2000) Crystal structure of paprika ferredoxin-
NADP
+
reductase – implications for the electron trans-
fer pathway. J Biol Chem 276, 9253–9263.
7 Kurisu G, Kusunoki M, Katoh E, Yamazaki T, Teshi-
ma K, Onda Y, Kimata-Ariga Y & Hase T (2001)
Structure of the electron transfer complex between fer-
redoxin and ferredoxin-NADP(+) reductase. Nat Struct
Biol 8, 117–121.
8 Nogues I, Perez-Dorado I, Frago S, Bittel C, Mayhew
SG, Gomez-Moreno C, Hermoso JA, Medina M, Cor-
tez N & Carrillo N (2005) The ferredoxin-NADP(H)
reductase from Rhodobacter capsulatus: molecular struc-
ture and catalytic mechanism. Biochemistry 44, 11730–

11740.
9 Sridhar PG, Kresge N, Muhlberg AB, Shaw A, Jung
YS, Burgess BK & Stout CD (1998) The crystal struc-
ture of NADPH:ferredoxin reductase from Azotobacter
vinelandii. Protein Sci 7, 2541–2549.
10 Ingelman M, Bianchi V & Eklund H (1997) The three-
dimensional structure of flavodoxin reductase from Esc-
herichia coli at 1.7 A
˚
resolution. J Mol Biol 268, 147–157.
11 Arakaki AK, Ceccarelli EA & Carrillo N (1997) Plant-
type ferredoxin-NADP
+
reductases: a basal structural
framework and a multiplicity of functions. FASEB J
11, 133–140.
M. A. Musumeci et al. Enzyme efficiency modulated by amino acid volume
FEBS Journal 275 (2008) 1350–1366 ª 2008 The Authors Journal compilation ª 2008 FEBS 1363
12 Arakaki AK, Orellano EG, Calcaterra NB, Ottado J &
Ceccarelli EA (2001) Involvement of the flavin
si-face tyrosine on the structure and function of
ferredoxin-NADP
+
reductases. J Biol Chem 276,
44419–44426.
13 Karplus PA & Bruns CM (1994) Structure–function
relations for ferredoxin reductase. J Bioenerg Biomembr
26, 89–99.
14 Calcaterra NB, Pico GA, Orellano EG, Ottado J, Car-
rillo N & Ceccarelli EA (1995) Contribution of the

FAD binding site residue tyrosine 308 to the stability of
pea ferredoxin-NADP
+
oxidoreductase. Biochemistry
34, 12842–12848.
15 Nogues I, Tejero J, Hurley JK, Paladini D, Frago S,
Tollin G, Mayhew SG, Gomez-Moreno C, Ceccarelli
EA, Carrillo N et al. (2004) Role of the C-terminal
tyrosine of ferredoxin-nicotinamide adenine dinucleotide
phosphate reductase in the electron transfer processes
with its protein partners ferredoxin and flavodoxin.
Biochemistry 43, 6127–6137.
16 Orellano EG, Calcaterra NB, Carrillo N & Ceccarelli
EA (1993) Probing the role of the carboxyl-terminal
region of ferredoxin-NADP
+
reductase by site-directed
mutagenesis and deletion analysis. J Biol Chem 268,
19267–19273.
17 Piubelli L, Aliverti A, Arakaki AK, Carrillo N, Ceccar-
elli EA, Karplus PA & Zanetti G (2000) Competition
between C-terminal tyrosine and nicotinamide modu-
lates pyridine nucleotide affinity and specificity in plant
ferredoxin-NADP
+
reductase. J Biol Chem 275, 10472–
10476.
18 Tejero J, Perez-Dorado I, Maya C, Martinez-Julvez M,
Sanz-Aparicio J, Gomez-Moreno C, Hermoso JA &
Medina M (2005) C-terminal tyrosine of ferredoxin-

NADP(+) reductase in hydride transfer processes with
NAD(P)
+
⁄ H. Biochemistry 44, 13477–13490.
19 Catalano-Dupuy DL, Orecchia M, Rial DV & Ceccarel-
li EA (2006) Reduction of the pea ferredoxin-NADP(H)
reductase catalytic efficiency by the structuring of a car-
boxyl-terminal artificial metal binding site. Biochemistry
45, 13899–13909.
20 Maeda M, Lee YH, Ikegami T, Tamura K, Hoshino
M, Yamazaki T, Nakayama M, Hase T & Goto Y
(2005) Identification of the N- and C-terminal substrate
binding segments of ferredoxin-NADP
+
reductase by
NMR. Biochemistry 44, 10644–10653.
21 Deng Z, Aliverti A, Zanetti G, Arakaki AK, Ottado J,
Orellano EG, Calcaterra NB, Ceccarelli EA, Carrillo N
& Karplus PA (1999) A productive NADP
+
binding
mode of ferredoxin-NADP
+
reductase revealed by pro-
tein engineering and crystallographic studies. Nat Struct
Biol 6, 847–853.
22 Catalano Dupuy DL, Rial DV & Ceccarelli EA (2004)
Inhibition of pea ferredoxin-NADP(H) reductase by
Zn-ferrocyanide. Eur J Biochem 271, 4582–4593.
23 Zheng YJ & Ornstein RL (1996) A theoretical study of

the structures of flavin in different oxidation and pro-
tonation states. J Am Chem Soc 118, 9402–9408.
24 McGaughey GB, Gagne M & Rappe AK (1998) pi-
Stacking interactions. Alive and well in proteins. J Biol
Chem 273, 15458–15463.
25 Aliverti A, Bruns CM, Pandini VE, Karplus PA,
Vanoni MA, Curti B & Zanetti G (1995) Involvement
of serine 96 in the catalytic mechanism of ferredoxin-
NADP
+
reductase: structure–function relationship as
studied by site-directed mutagenesis and X-ray crystal-
lography. Biochemistry 34, 8371–8379.
26 Edmondson DE & Tollin G (1971) Circular dichroism
studies of the flavin chromophore and of the relation
between redox properties and flavin environment in
oxidases and dehydrogenases. Biochemistry 10, 113–
124.
27 Leadbeater C, McIver L, Campopiano DJ, Webster SP,
Baxter RL, Kelly SM, Price NC, Lysek DA, Noble
MA, Chapman SK et al. (2000) Probing the NADPH-
binding site of Escherichia coli flavodoxin oxidoreduc-
tase. Biochem J 352, 257–266.
28 Aliverti A, Piubelli L, Zanetti G, Lubberstedt T, Herr-
mann RG & Curti B (1993) The role of cysteine resi-
dues of spinach ferredoxin-NADP
+
reductase as
assessed by site-directed mutagenesis. Biochemistry 32,
6374–6380.

29 Aliverti A, Deng Z, Ravasi D, Piubelli L, Karplus PA
& Zanetti G (1998) Probing the function of the invari-
ant glutamyl residue 312 in spinach ferredoxin-NADP
+
reductase. J Biol Chem 273, 34008–34015.
30 Kyte J & Doolittle RF (1982) A simple method for dis-
playing the hydropathic character of a protein. J Mol
Biol 157, 105–132.
31 Black SD & Mould DR (1991) Development of hydro-
phobicity parameters to analyze proteins which bear
post- or cotranslational modifications. Anal Biochem
193, 72–82.
32 Tsai J, Taylor R, Chothia C & Gerstein M (1999) The
packing density in proteins: standard radii and volumes.
J Mol Biol 290, 253–266.
33 Eisenthal R, Danson MJ & Hough DW (2007) Cata-
lytic efficiency and k
cat
⁄ K
M
: a useful comparator?
Trends Biotechnol. 25, 247–249.
34 Li M, Binda C, Mattevi A & Edmondson DE (2006)
Functional role of the ‘‘aromatic cage’’ in human
monoamine oxidase B: structures and catalytic pro-
perties of Tyr435 mutant proteins. Biochemistry 45,
4775–4784.
35 Pace CN, Shirley A & Thomson JA (1989) Protein
Structure. A Practical Approach. IRL Press, Oxford,
New York and Tokyo.

36 Schymkowitz J, Borg J, Stricher F, Nys R, Rousseau F
& Serrano L (2005) The FoldX web server: an online
force field. Nucleic Acids Res 33, W382–W388.
Enzyme efficiency modulated by amino acid volume M. A. Musumeci et al.
1364 FEBS Journal 275 (2008) 1350–1366 ª 2008 The Authors Journal compilation ª 2008 FEBS
37 Dohr O, Paine MJ, Friedberg T, Roberts GC & Wolf
CR (2001) Engineering of a functional human NADH-
dependent cytochrome P450 system. Proc Natl Acad Sci
USA 98, 81–86.
38 Neeli R, Roitel O, Scrutton NS & Munro AW (2005)
Switching pyridine nucleotide specificity in P450 BM3:
mechanistic analysis of the W1046H and W1046A
enzymes. J Biol Chem 280, 17634–17644.
39 Meyer EA, Castellano RK & Diederich F (2003)
Interactions with aromatic rings in chemical and
biological recognition. Angew Chem Int Ed Engl 42,
1210–1250.
40 Lee EC, Kim D, Jurecka P, Tarakeshwar P, Hobza P &
Kim KS (2007) Understanding of assembly phenomena
by aromatic–aromatic interactions: benzene dimer and
the substituted systems. J Phys Chem A 111, 3446–3457.
41 Burley SK & Petsko GA (1985) Aromatic–aromatic
interaction: a mechanism of protein structure stabiliza-
tion. Science 229, 23–28.
42 Waters ML (2002) Aromatic interactions in model sys-
tems. Curr Opin Chem Biol 6, 736–741.
43 Wang M, Roberts DL, Paschke R, Shea TM, Masters
BS & Kim JJ (1997) Three-dimensional structure of
NADPH-cytochrome P450 reductase: prototype for
FMN- and FAD-containing enzymes. Proc Natl Acad

Sci USA 94, 8411–8416.
44 Gruez A, Pignol D, Zeghouf M, Coves J, Fontecave M,
Ferrer JL & Fontecilla-Camps JC (2000) Four crystal
structures of the 60 kDa flavoprotein monomer of the
sulfite reductase indicate a disordered flavodoxin-like
module. J Mol Biol 299, 199–212.
45 Biterova EI, Turanov AA, Gladyshev VN & Barycki JJ
(2005) Crystal structures of oxidized and reduced mito-
chondrial thioredoxin reductase provide molecular
details of the reaction mechanism. Proc Natl Acad Sci
USA 102, 15018–15023.
46 Marohnic CC, Crowley LJ, Davis CA, Smith ET &
Barber MJ (2005) Cytochrome b5 reductase: role of the
si-face residues, proline 92 and tyrosine 93, in structure
and catalysis. Biochemistry 44, 2449–2461.
47 Tejero J, Martinez-Julvez M, Mayoral T, Luquita A,
Sanz-Aparicio J, Hermoso JA, Hurley JK, Tollin G,
Gomez-Moreno C & Medina M (2003) Involvement of
the pyrophosphate and the 2¢-phosphate binding regions
of ferredoxin-NADP
+
reductase in coenzyme specific-
ity. J Biol Chem 278, 49203–49214.
48 Breinlinger EC, Keenan CJ & Rotello VM (1998) Mod-
ulation of flavin recognition and redox properties
through donor atom–pi interactions. J Am Chem Soc
120, 8606–8609.
49 Rotello VM (1998) The donor atom–pi interaction of
sulfur with flavin. A density functional investigation.
Heteroatom Chem 9, 605–606.

50 Druhan LJ & Swenson RP (1998) Role of methionine
56 in the control of the oxidation–reduction potentials
of the Clostridium beijerinckii flavodoxin: effects of
substitutions by aliphatic amino acids and evidence for
a role of sulfur–flavin interactions. Biochemistry 37,
9668–9678.
51 Xia X & Li WH (1998) What amino acid properties
affect protein evolution? J Mol Evol 47, 557–564.
52 Kapp OH, Moens L, Vanfleteren J, Trotman CN,
Suzuki T & Vinogradov SN (1995) Alignment of 700
globin sequences: extent of amino acid substitution and
its correlation with variation in volume. Protein Sci 4,
2179–2190.
53 Ferrer-Costa C, Orozco M & de la Cruz X (2007) Char-
acterization of compensated mutations in terms of
structural and physico-chemical properties. J Mol Biol
365, 249–256.
54 Young L & Post CB (1996) Catalysis by entropic
guidance from enzymes. Biochemistry 35, 15129–
15133.
55 Karplus PA & Schulz GE (1989) Substrate binding and
catalysis by glutathione reductase as derived from
refined enzyme: substrate crystal structures at 2 A
˚
reso-
lution. J Mol Biol 210, 163–180.
56 Krauth-Siegel RL, Arscott LD, Schonleben-Janas A,
Schirmer RH & Williams CH Jr (1998) Role of active
site tyrosine residues in catalysis by human glutathione
reductase. Biochemistry 37, 13968–13977.

57 Lu G, Campbell WH, Schneider G & Lindqvist Y
(1994) Crystal structure of the FAD-containing frag-
ment of corn nitrate reductase at 2.5 A
˚
resolution: rela-
tionship to other flavoprotein reductases. Structure 2,
809–821.
58 Nishida H, Inaka K, Yamanaka M, Kaida S, Kobay-
ashi K & Miki K (1995) Crystal structure of NADH-
cytochrome b5 reductase from pig liver at 2.4 A
˚
resolu-
tion. Biochemistry 34, 2763–2767.
59 Shirabe K, Yubisui T, Nishino T & Takeshita M (1991)
Role of cysteine residues in human NADH-cytochrome
b5 reductase studied by site-directed mutagenesis. Cys-
273 and Cys-283 are located close to the NADH-bind-
ing site but are not catalytically essential. J Biol Chem
266, 7531–7536.
60 Batie CJ & Kamin H (1984) Ferredoxin:NADP
+
oxido-
reductase. Equilibria in binary and ternary complexes
with NADP+ and ferredoxin. J Biol Chem 259, 8832–
8839.
61 Barik S (1996) Site-directed mutagenesis in vitro by meg-
aprimer PCR. In In Vitro Mutagenesis Protocols (Trower
MK, ed.), pp. 203–215. Humana Press, Totowa, NJ.
62 Aiyar A & Xiang YLJ (1996) Site-directed mutagenesis
using overlap extension PCR. In In Vitro Mutagenesis

Protocols (Trower MK, ed.), pp. 177–191. Humana
Press, Totowa, NJ.
63 Ceccarelli EA, Viale AM, Krapp AR & Carrillo N
(1991) Expression, assembly, and processing of an
active plant ferredoxin-NADP
+
oxidoreductase and its
M. A. Musumeci et al. Enzyme efficiency modulated by amino acid volume
FEBS Journal 275 (2008) 1350–1366 ª 2008 The Authors Journal compilation ª 2008 FEBS 1365
precursor protein in Escherichia coli. J Biol Chem 266,
14283–14287.
64 Hurley JK, Salamon Z, Meyer TE, Fitch JC, Cusano-
vich MA, Markley JL, Cheng H, Xia B, Chae YK &
Medina M (1993) Amino acid residues in Anabaena fer-
redoxin crucial to interaction with ferredoxin-NADP
+
reductase: site-directed mutagenesis and laser flash pho-
tolysis. Biochemistry 32, 9346–9354.
65 Laemmli UK (1970) Cleavage of structural proteins
during the assembly of the head of bacteriophage T4.
Nature 227, 680–685.
66 Geren LM & Millett F (1981) Fluorescence energy
transfer studies of the interaction between adreno-
doxin and cytochrome c. J Biol Chem 256, 10485–
10489.
67 Pace CN, Laurents DV & Thomson JA (1990) pH
dependence of the urea and guanidine hydrochloride
denaturation of ribonuclease A and ribonuclease T1.
Biochemistry 29, 2564–2572.
68 Zanetti G (1976) A lysyl residue at the NADP binding

site of ferredoxin-NADP reductase. Biochim Biophys
Acta 445, 14–24.
Enzyme efficiency modulated by amino acid volume M. A. Musumeci et al.
1366 FEBS Journal 275 (2008) 1350–1366 ª 2008 The Authors Journal compilation ª 2008 FEBS