Báo cáo khoa học: Molecular characterization of gonad-inhibiting hormone of Penaeus monodon and elucidation of its inhibitory role in vitellogenin expression by RNA interference pptx

Molecular characterization of gonad-inhibiting hormone
of Penaeus monodon and elucidation of its inhibitory role
in vitellogenin expression by RNA interference
Supattra Treerattrakool
1
, Sakol Panyim
1,2
, Siu-Ming Chan
3
, Boonsirm Withyachumnarnkul
4,5
and
Apinunt Udomkit
1
1 Institute of Molecular Biology and Genetics, Mahidol University, Nakhon Pathom, Thailand
2 Department of Biochemistry, Mahidol University, Bangkok, Thailand
3 School of Biological Sciences, The University of Hong Kong, China
4 Department of Anatomy, Mahidol University, Bangkok, Thailand
5 Centex Shrimp, Mahidol University, Bangkok, Thailand
Female reproduction in crustaceans is controlled by an
elaborate endocrine system. The prominent cellular
activity that occurs during ovarian development is
known as vitellogenesis, which is the process whereby
vitellogenin (Vg), a yolk protein precursor, is accumu-
lated in the developing oocyte [1]. Vitellogenesis is an
essential step in ovarian maturation. Vg can be synthe-
sized in the ovary and ⁄ or other nonovarian sites such
as the hepatopancreas [2–5]. Vg synthesis and ovarian
maturation are regulated by an eyestalk endocrine
factor referred to as vitellogenesis-inhibiting hormone
(VIH) or gonad-inhibiting hormone (GIH) [6,7].

Gonad-inhibiting hormone is a member of the neu-
ropeptide family that is synthesized in neuroendocrine
cells located in the eyestalk medulla terminalis gangli-
onic X-organ. Once produced, these neuropeptides are
transported to the axon terminals that form a neuro-
haemal organ called the sinus gland, from where they
are secreted [8]. This hormone family is known as
the CHH family. Mature peptides of CHH family
Keywords
black tiger shrimp; ovarian maturation;
reproduction; RNA interference;
vitellogenesis
Correspondence
A. Udomkit, Institute of Molecular Biology
and Genetics, Mahidol University, Salaya
Campus, Nakhon Pathom 73170, Thailand
Fax: +66 2 441 9906
Tel: +66 2 800 3624, ext. 1236
E-mail:
(Received 16 November 2007, revised 18
December 2007, accepted 25 December
2007)
doi:10.1111/j.1742-4658.2008.06266.x
One of the important peptide hormones that control reproduction in crus-
taceans is gonad-inhibiting hormone (GIH). GIH is known to modulate
gonad maturation by inhibiting synthesis of vitellogenin (Vg), the precursor
of yolk proteins. In this study, a cDNA encoding a GIH (Pem-GIH) from
the eyestalk of Penaeus monodon was cloned using RT-PCR and RACE
techniques. Pem-GIH cDNA is 861 bp in size with a single ORF of 288 bp.
The deduced Pem-GIH consists of a 17-residue signal peptide and a mature

peptide region of 79 amino acids with features typical of type II peptide
hormones from the CHH family. Pem-GIH transcript was detected in eye-
stalk, brain, thoracic and abdominal nerve cords of adult P. monodon. The
gonad-inhibiting activity of Pem-GIH was investigated using the RNA
interference technique. Double-stranded RNA, corresponding to the
mature Pem-GIH sequence, can trigger a decrease in Pem-GIH transcript
levels both in eyestalk ganglia and abdominal nerve cord explant culture
and in female P. monodon broodstock. The conspicuous increase in Vg
transcript level in the ovary of GIH-knockdown shrimp suggests a negative
influence for Pem-GIH on Vg gene expression, and thus implies its role as
a gonad-inhibiting hormone. This is the first report to demonstrate the use
of double-stranded RNA to elucidate the function of GIH in P. monodon.
Abbreviations
CHH, crustacean hyperglycemic hormone; GIH, gonad-inhibiting hormone; MIH, molt-inhibiting hormone; RT, reverse transcription;
Vg, vitellogenin; VIH, vitellogenesis-inhibiting hormone.
970 FEBS Journal 275 (2008) 970–980 ª 2008 The Authors Journal compilation ª 2008 FEBS
members generally have 78–83 amino acid residues
with a molecular mass of  8–9 kDa. These hormones
contain six cysteine residues that are aligned in con-
served positions [9,10]. The CHH family can be
divided into two types, type I and type II, as reflected
by their primary structure [11–13]. The most abundant
hormone in this family, crustacean hyperglycemic hor-
mone (CHH), belongs to type I, whereas the other two
hormones, molt-inhibiting hormone (MIH) and GIH,
are categorized in type II. CHH or type I contains in
its precursor sequence a short peptide called CHH-pre-
cursor-related peptide followed by a dibasic residue-
processing site. By contrast, type II hormones are
preceded directly by the signal peptides. In addition,

alignment of the amino acid sequence reveals deletion
of the amino acid glycine at the fifth position after the
first cysteine residue in type I peptides.
Compared with CHH and MIH, only a limited
number of GIH have been characterized to date. The
first peptide with in vivo GIH activity was isolated
from the American lobster Homarus americanus [14].
Another peptide that has been shown to depress Vg
mRNA expression in the ovary fragment is the Pej-
SGP-III of Marsupenaeus japonicus [15]. Likewise, a
similar approach was used to assay VIH activity in the
crayfish Procambarus bouvieri [16]. MIH-B from the
shrimp Metapenaeus ensis, although capable of extend-
ing the molting cycle, may be considered as another
candidate for GIH because the mRNA levels of this
peptide decrease sharply during the early phase of
gonad maturation and increase continuously as the
vitellogenic stages proceed [17]. The cDNA encoding
GIH-like peptide is also found in a few other species
such as the Norway lobster Nephrops norvegicus [18]
and the prawn Macrobrachium rosenbergii [19]. How-
ever, whether the peptides encoded by these cDNAs
function as GIH needs further verification.
In this study, a cDNA encoding GIH from
Penaeus monodon and its potential role in vitellogenesis
were studied. Functional knockdown of Pem-GIH by
double-stranded (ds)RNA was applied to demonstrate
the negative effect on Vg expression in the ovary of
previtellogenic adult female and thus provides evidence
for its role as a GIH.

Results
Cloning and characterization of Pem-GIH cDNA
A partial 3¢ cDNA sequence encoding GIH from
P. monodon (Pem-GIH) was amplified by several sets
of degenerate primers (Fig. 1) designed from the con-
served amino acid sequences of type II hormones in
the CHH family. Nucleotide sequence analysis revealed
that 7 of 213 recombinant clones harbored GIH-like
nucleotide sequences, as judged by a unique feature of
the amino acid sequences at the C-terminus, which are
longer than and different from that of MIHs. To
obtain the 5¢ region of this cDNA, a set of specific
primers was designed from the 3¢ sequence of the
cDNA as described in the Experimental procedures. In
addition, full-length cDNA was amplified with specific
primers, as shown in Fig. 1. The nucleotide sequences
of the full-length Pem-GIH cDNA of eight individual
recombinant clones were sequenced, and confirmed as
representing identical clones. Fig. 2 shows the nucleo-
tide sequence of Pem-GIH cDNA (GenBank accession
no. DQ643389) and its deduced amino acid sequence.
10 0 b
p

PR T
PM 1
PM1
IH 3
5′RACE-GIH1.1
ma tGIH F/

T7-mat GI HF
GI HR
ma tG IH R/
T7 -m at GI HR
10 0 b
p

5′ 3′
PR T
PM 1
3′RACE-GIH1A
3
′RACE-GIH1 B
PRT
PM1
5
′RACE-GIH1
5
′RACE-GIH2
5
′RACE-GIH 3
GIHF
ma tGIH F/
T7-mat GI HF
GI HR
ma tG IH R/
T7 -m at GI HR
Fig. 1. Schematic diagram showing the structure of Pem-GIH cDNA and locations of the primers used in this study. The 5¢- and 3¢-UTRs are
shown as a thin line. The ORF is depicted by boxes: the unfilled box represents the signal peptide and the filled box represents the mature
peptide.

S. Treerattrakool et al. P. monodon GIH cDNA and its role in Vg expression
FEBS Journal 275 (2008) 970–980 ª 2008 The Authors Journal compilation ª 2008 FEBS 971
The full-length cDNA encoding the putative GIH
of P. monodon was composed of 861 nucleotides
containing a 5¢-UTR (93 bp), an ORF (288 bp), a stop
codon (TGA) and a 3¢-UTR (477 bp) with a potential
polyadenylation signal AATAAA located 7 bp
upstream of the poly(A) tail. The ORF of Pem-GIH
codes for a protein of 96 amino acid residues. The sig-
nal peptide, predicted using the signalp 3.0 server
( consisted of
17 amino acids, whereas the remaining 79 amino acids
comprised the mature Pem-GIH peptide. The deduced
amino acid sequence of putative Pem-GIH showed the
conservation of six cysteine residues in the mature pep-
tide with a glycine residue at the fifth position after
the first cysteine. Mature Pem-GIH showed 68%
amino acid identity with the GIH of M. ensis, but 45
and 48% amino acid identity with that of H. americ-
anus (Hoa-GIH) and N. norvegicus (Nen-GIH), respec-
tively (Fig. 3).
Tissue-specific expression of Pem-GIH
Pem-GIH expression in several P. monodon tissues was
examined by RT-PCR using a pair of primers specific
for Pem-GIH cDNA. GIH transcripts at the expected
size of 385 bp were detected in the eyestalk ganglia,
brain, thoracic nerve cord and abdominal nerve cord
of individual shrimp. No GIH transcript was found in
other tissues examined. This expression profile is simi-
lar to that of Mee-GIH expression in mature female

M. ensis [17]. Interestingly, expression of Pem-GIH in
these tissues was found in both male and female of
adult and adolescent P. monodon (Fig. 4).
dsRNA-induced Pem-GIH knockdown in shrimp
explant culture
The role of Pem-GIH was investigated by dsRNA-
mediated gene silencing via RNAi, using dsRNA spe-
cific to the Pem-GIH . The coding sequence for mature
Pem-GIH was used as template in the synthesis of
GIH-specific dsRNA. The efficacy of this GIH-
dsRNA to knockdown GIH expression was first deter-
mined in GIH-expressing tissues. Briefly, eyestalk
XOSG neurons and abdominal nerve cord explant
were cultured in a medium that contained GIH-
dsRNA. RT-PCR results showed barely detectable
levels of GIH transcript in the GIH-dsRNA-treated
eyestalk XOSG culture from adult female shrimp after
3 h (Fig. 5A) indicating that GIH expression could be
efficiently inhibited by GIH-dsRNA. Similar results
were also seen when abdominal nerve cord from either
adult or adolescent female shrimp was incubated with
GIH-dsRNA for 3 and 6 h (Fig. 5B,C). By contrast,
the irrelevant dsRNA, GFP-dsRNA, failed to knock-
down Pem-GIH mRNA expression as the abdominal
nerve cord incubated with GFP-dsRNA expressed
similar levels of Pem-GIH transcript to that of the
control sample into which no dsRNA was added.
These results indicated that GIH-dsRNA was capable
of triggering sequence-specific knockdown of Pem-
GIH expression in shrimp explant culture, and thus

Fig. 2. Nucleotide and deduced amino acid
sequences of Pem-GIH. The amino acids
are presented as one-letter symbols and
shown below their codons in each line. The
highlighted amino acid sequence represents
the putative mature peptide region. An
asterisk marks the stop codon. The putative
polyadenylation site is underlined. The num-
bers on the left and right of the sequences
show the coordinate of nucleotides and
amino acids in corresponding lines.
P. monodon GIH cDNA and its role in Vg expression S. Treerattrakool et al.
972 FEBS Journal 275 (2008) 970–980 ª 2008 The Authors Journal compilation ª 2008 FEBS
was a potent tool for functional study of Pem-GIH in
the shrimp.
Biological assay for vitellogenesis-inhibiting
activity of Pem-GIH by dsRNA-mediated
functional knockdown
To test whether the knockdown of Pem-GIH expres-
sion by dsRNA would interfere with Vg gene expres-
sion, previtellogenic adult female P. monodon were
injected with GIH-dsRNA and the level of Pem-GIH
expression as well as the expression of Vg transcript in
the shrimp was determined by RT-PCR.
In order to determine the silencing effect of GIH-
dsRNA in the shrimp, eyestalk ganglia were collected
from previtellogenic adult P. monodon on day 3, 5 and
7 subsequent to GIH-dsRNA injection. The results
(Fig. 6A) show that 3 days after dsRNA injection,
Actin

Pem-GIH
bp
500
400
A
Adult
B
Adolescent
Male
D
Actin
Pem-GIH
500
400
M E S B T G N c H Hp M - v e M E S B T G N c H Hp M - v e
M E S B T G N c H Hp M - v e M E S B T G N c H Hp M - v e
F
e
m
a
l
e

C
Fig. 4. Expression of Pem-GIH in different tissues of P. monodon. RT-PCR products were amplified from the total RNA of eyestalk (ES),
brain (B), thoracic nerve (TG), abdominal nerve cord (Nc), heart (H), hepatopancreas (Hp) and muscle (M) using the specific primers for the
5¢-region of Pem-GIH. The negative PCR is indicated by ) ve. The actin transcript of P. monodon was used as an internal control of the
amount of RNA template. Each panel shows tissue distribution of Pem-GIH in adult female (A), adult male (B), adolescent female (C) and
adolescent male (D). The identity of RT-PCR products was confirmed by DNA sequencing.
Fig. 3. Alignment of Pem-GIH with GIH and MIH from other species of crustacean. The deduced amino acid sequence of GIH from

P. monodon (Pem-GIH; this study) is aligned with GIHs of M. ensis (Mee-GIH; AF294648), H. americanus (Hoa-GIH; X87192), N. norvegicus
(Nen-GIH; AF163771) and MIHs of P. monodon (Pem-MIH1; AAR89516 and Pem-MIH2; AAR89517), M. japonicus (Pej-sgp-IV; BAA20432),
M. ensis (Mee-MIH; AAC27452), L. vannamei (Liv-MIH1; AAR04348) and F. chinensis (Fec-MIH; AAL55258). Sequence identities are high-
lighted in black color, and light gray depicts the conservative changes. The percent identity of the pro- and mature sequences between
Pem-GIH and other hormones was shown on the right to the C-terminus of the sequences.
S. Treerattrakool et al. P. monodon GIH cDNA and its role in Vg expression
FEBS Journal 275 (2008) 970–980 ª 2008 The Authors Journal compilation ª 2008 FEBS 973
shrimp administered with GIH-dsRNA showed drasti-
cally reduced Pem-GIH transcript levels in the eyestalk
ganglia when compared with control shrimp injected
with Tris ⁄ NaCl only. This comprehensive silencing
lasted until day 5 before the expression of Pem-GIH
began to recover to some extent on day 7. Moreover,
expression of two other related genes, Pem-CHH1 and
Pem-MIH1 of P. monodon, did not change in GIH-
knockdown shrimp when compared with control
shrimp (Fig. 6B), suggesting the specificity of Pem-
GIH silencing by GIH-dsRNA. Subsequently, the
consequence of the depletion in GIH transcript on Vg
synthesis was investigated on day 5 after GIH-dsRNA
injection. Fig. 7 shows that the Vg transcription level
was increased more than ninefold in the ovary of
GIH-knockdown previtellogenic adult shrimp when
3 h
dsGIH
–ve
Pem-GIH
Actin
A

– +
Pem-GIH
Actin
C
0 h
dsGIH
3 h
– + +
Shrim
p
#2
dsGFP
dsGIH
6 h
–
+
+
dsGFP dsGIH
3 h
–
+ +
dsGFP
dsGIH
6 h
–
+ +
dsGFP
–ve
Shrim
p

#1
0 h
–ve
Pem-GIH
Actin
B

3 h
dsGIH
dsGFP
3 h
dsGIH
dsGFP
– + + – + +
Fig. 5. Expression of Pem-GIH in shrimp explant culture after incubating with GIH-dsRNA. The eyestalk ganglia and abdominal nerve cord
were dissected from live shrimp and incubated in modified M199 culture medium with or without the specified dsRNA. The Pem-GIH and
actin transcripts were detected by RT-PCR at the indicated time points. (A) Expression of Pem-GIH in the eyestalk ganglia of adult female
shrimp at 3 h after incubating without ()) or with (+) GIH-dsRNA. (B) Expression of Pem-GIH in the abdominal nerve cord of adult female
shrimp at 3 and 6 h after incubating without ()) or with (+) GIH-dsRNA or GFP-dsRNA as indicated. (C) Expression of Pem-GIH in the abdom-
inal nerve cord of two adolescent female shrimp at 3 and 6 h after incubating without ()) or with (+) GIH-dsRNA or GFP-dsRNA as indicated.
)ve in (A–C) depicts the negative PCR.
B dsGIH M
Pem-GIH
Actin
700
500
bp
B M dsGIH
Pem-CHH1
Actin

500
bp
B M dsGIH
Pem-MIH1
Actin
800
500

bp
Pem-GIH
Actin
800 bp
500 bp
1 2 3 4 5
1 2 3 4 5 6
M
Buffer
GIH-dsRNA
Day 3
Pem-GIH
Actin
800 bp
500 bp
1 2 3 4 5
1 2 3 4 5 6
Day 5
800 bp
500 bp
Day 7
Pem-GIH

Actin
1 2 3 4 5
1 2 3
A
B
Fig. 6. Time-course and specificity of Pem-GIH silencing by dsRNA in shrimp. (A) Previtellogenic adult female P. monodon were injected
with Tris ⁄ NaCl or 3 lg GIH-dsRNA ⁄ g body weight of shrimp. Eyestalk ganglia were collected from both groups of shrimp at day 3, 5 and 7,
and Pem-GIH transcripts were detected by RT-PCR. Numbers represent individual shrimp in each group. (B) Representative of agarose gel
showing levels of Pem-GIH, Pem-CHH1 and Pem-MIH1 transcript in previtellogenic adult female shrimp detected by RT-PCR. The expression
of Pem-GIH, Pem-CHH1 and Pem-MIH1 was examined in shrimp injected with Tris ⁄ NaCl (B) and GIH-dsRNA (dsGIH) on day 5 following
GIH-dsRNA injection. For (A) and (B), actin transcript was amplified as internal control and M represent 100 bp ladder DNA marker.
P. monodon GIH cDNA and its role in Vg expression S. Treerattrakool et al.
974 FEBS Journal 275 (2008) 970–980 ª 2008 The Authors Journal compilation ª 2008 FEBS
compared with that in control shrimp. The increase in
the ratio of Vg to actin transcripts in the GIH-depleted
background suggested that functional knockdown of
Pem-GIH led to the induced expression of Vg in the
ovary.
Discussion
Because of the lack of information on the GIH in pen-
aeid shrimp, the attempt to clone GIH cDNA from
P. monodon in this study was carried out using a
RACE approach with degenerate primers designed
from the conserved amino acid sequences among
MIH ⁄ GIH from other species of crustaceans. To
increase the possibility of obtaining the GIH cDNA of
P. monodon, codons preferably used for CHH
(GenBank accession nos AF233295, AY346379 and
AY346380) and MIH (GenBank accession nos
AY496454 and AY496455) genes of this species were

also taken into consideration for primer design. In
addition, mRNA from eyestalk neurons of adult female
P. monodon at different vitellogenic stages as deter-
mined by gonadal somatic index were used as the tem-
plate for cDNA cloning in this study. This is based on
a previous study which showed high levels of GIH
mRNA in the sinus gland during previtellogenesis
and vitellogenesis [20]. A putative GIH cDNA of
P. monodon (Pem-GIH) was successfully cloned using
the aforementioned strategy. The deduced amino acid
sequence of putative GIH from P. monodon possesses
all the characteristics in agreement with a type II
hormone from the CHH family [11–13]. Moreover, the
C-terminus of Pem-GIH had an extension of two
amino acid residues when compared with that of
MIH. This is consistent with previously identified GIHs
from other crustacean species (Fig. 3). Pem-GIH
cDNA was thus subsequently examined for its gonad-
inhibiting function by using a RNA interference
(RNAi) technique.
RNAi, a post-transcription gene-silencing process in
which dsRNA triggers sequence-specific suppression of
its cognate mRNA [21], is a powerful tool for studying
gene function [22–24]. In P. monodon, a dsRNA-
induced gene-silencing phenomenon has been recently
demonstrated [25], therefore it was selected as a tool for
studying the functional knockdown of Pem-GIH cDNA
in this study. GIH-specific dsRNA was synthesized from
a 240 bp coding region of the mature Pem-GIH.
The use of long dsRNA provides the possibility of

generating more varieties of effective siRNA (21–23
nucleotides) molecules. Nevertheless, the nonspecific
silencing, known as off-target phenomenon, may also
occur from these diverse siRNA products of the long
dsRNA [26,27]. To minimize this off-target silencing,
the GIH-dsRNA sequence was used to search for a pos-
sible region of 21–23 consecutively identical nucleotides
in the sequences of all P. monodon CHH and MIH.A
nucleotide sequence comparison revealed no such region
(data not shown) in either CHHsorMIHs, suggesting
that the GIH-dsRNA should direct sequence-specific
silencing of Pem-GIH with a minimal off-target effect
on other related genes. Indeed, this was clearly showed
by the result in Fig. 6B in which the shrimp adminis-
tered with GIH-dsRNA still expressed CHH and MIH
at the level comparable with that of the control shrimp.
The efficacy of GIH-dsRNA to silence Pem-GIH
expression was manifested by the dramatic depletion in
Pem-GIH mRNA level in shrimp eyestalk ganglia and
abdominal nerve cords as early as 3 h after incubating
with GIH-dsRNA. This silencing was not affected by
irrelevant dsRNA, thus indicating that Pem-GIH
knockdown occurred in a sequence-specific fashion.
Similar specific silencing of Pem-GIH by GIH-dsRNA
was also demonstrated in adolescent female P. monodon
(Fig. S1). Accordingly, any biological changes observed
following GIH-dsRNA injection may be considered the
consequence of Pem-GIH knockdown.
To date, no conclusive evidence about the mode of
action of GIH on vitellogenesis has been established.

Recently, the recombinant vitellogeneis-inhibiting
hormone (VIH or GIH) of H. americanus has been
GIH/acti
n
Buffer
GIH dsRNA
GIH/actin
0
0.2
0.4
0.6
0.8
1
1.2
1.4
1.6
1.8
Vg/actin
levelnoisserpxeevitaleR
Vg/actin
Fig. 7. Influence of GIH-dsRNA on Pem-GIH and Vg expression in
previtellogenic adult female shrimp. Shrimp were injected with
Tris ⁄ NaCl or GIH-dsRNA. Eyestalk ganglia and ovaries were col-
lected at 5 days after injection to examine for Pem-GIH and Vg
mRNA levels, respectively, by RT-PCR. The graph represents rela-
tive expression levels of Pem-GIH compared with actin levels that
were quantified using the
SCION IMAGE program. Values are shown
as mean ± SEM (n = 5). Relative amounts of Pem-GIH ⁄ actin tran-
script in both the control (Tris ⁄ NaCl-injected) and GIH-dsRNA-

injected shrimp are represented by gray bars (P < 0.01), whereas
those of Vg ⁄ actin transcript in both groups of shrimp are shown by
white bars (P < 0.05).
S. Treerattrakool et al. P. monodon GIH cDNA and its role in Vg expression
FEBS Journal 275 (2008) 970–980 ª 2008 The Authors Journal compilation ª 2008 FEBS 975
reported for its biological activity to inhibit Vg mRNA
synthesis in the ovary of heterologous species, M. japo-
nicus [28]. In addition to the ovary, hepatopancreas has
been revealed as another site for Vg synthesis in shrimp
[29,30]. Although the function of Vg originating from
the hepatopancreas has not been clearly evidenced, it
has been shown that Vg expression in the hepatopan-
creas is correlated with ovarian maturation [31]. After
synthesis in the hepatopancreas, Vg undergoes post-
translational processing into smaller subunits by a sub-
tilisin-like endoprotease, these subunits are then
released into the hemolymph. These hemolymph Vg
subunits are further processed by an unidentified
enzyme before being sequestered by the ovary, and
form yolk protein (vitellin) subunits [32]. The induced
ovarian Vg expression of GIH-knockdown previtello-
genic adult P. monodon evidently indicates the inhibi-
tory function of Pem-GIH on Vg gene expression in the
ovary. Our results are in concurrence with an increase
in Vg expression after eyestalk ablation in M. japonicus
[33,34] and L. vannamei [35]. In addition, the level of
Vg expression in hepatopancreas was not appreciably
affected following dsRNA-mediated knockdown of
Pem-GIH (data not shown). This is not unanticipated
because Vg synthesis was not induced in hepatopan-

creas of eyestalk-ablated shrimp either, especially
within the first 7 days following eyestalk ablation [33].
In addition, Okumura et al. showed that the Vg mRNA
level increased slowly in hepatopancreas at the start of
vitellogenesis in naturally mature female of M. japoni-
cus, compared with that in the ovary [36]. Empirically,
our results support the postulation that ovarian Vg is
required for early maturation of the ovary in crusta-
ceans [5] and conform well to the precocious ovarian
development after the main source of GIH synthesis
was removed by eyestalk extirpation [37].
Although a similar strategy was used to analyze the
function of CHH cDNA from L. schmitti [38], the
effect of CHH silencing on glucose level was deter-
mined at 24 h after dsRNA injection. Our study
clearly demonstrates that the effect of dsRNA silencing
is effective for at least 5 days in shrimp, which pro-
vides further benefit to the use of dsRNA for analysis
of genes whose function has long-term physiological
influence.
Although the function of GIH has been studied
mainly in female crustaceans, expression of Pem-GIH
in male P. monodon, which is similar to previous
reports [17,39], implies that GIH may play a more ver-
satile role in the male as well. Eyestalk ablation in the
crayfish Cherax quadricarinatus resulted in an overex-
pression of androgenic gland polypeptides, which had
a direct effect on male reproductive system [40].
Whether Pem-GIH is involved in reproduction in male
P. monodon needs further investigation.

In summary, this study identified and characterized
Pem-GIH cDNA of P. monodon in both molecular and
biological aspects. The system of a functional–knock-
down study was exploited using GIH-specific dsRNA,
and revealed, for the first time, the influence of Pem-
GIH on vitellogenin transcript levels in the ovary,
which directly linked GIH to expression of Vg mRNA.
Finally, our results demonstrated that dsRNA-medi-
ated gene silencing has a potential as a powerful tool
for functional study of other genes in crustaceans.
Experimental procedures
Animals
Wild adult female P. monodon, at different vitellogenic
stages, were caught from the Gulf of Thailand, Chonburi
Province, Thailand. They were used in cDNA cloning
experiments. Previtellogenic adult female P. monodon used
for the GIH functional assay were domesticated shrimp
provided by Bangkok Aquaculture Farm Company
(BAFCO, Huasai, Nakhon Si Thammarat Province,
Thailand).
Experiments involving animals were carried out in accor-
dance with animal care and use protocol of the Mahidol
University Animal Care and Use Committee (MUACUC).
Total RNA preparation and first-strand cDNA
synthesis
Eyestalk neurons were dissected from individual eyestalks
of adult female shrimp at various stages of reproductive
cycle and homogenized in TRI-REAGENT
Ò
(Molecular

Research Center, Cincinnati, OH, USA). Total RNA of
eyestalks was extracted by using TRI-REAGENT
Ò
accord-
ing to instructions of the manufacturer’s protocol.
The reverse transcription (RT) step was performed with
ImProm-IIÔ reverse transcriptase (Promega, Madison, WI,
USA) according to the manufacturer’s protocol using
500 nm of oligo(dT)16 or PRT primer (5¢-CCGGAATTC
AAGCTTCTAGAGGATCCTTTTTTTTTTTTTTTT-3¢)to
prime cDNA synthesis at 42 °C for 60 min.
RACE
The degenerate primers used in 3¢-RACE of Pem-GIH
cDNA were designed from the conserved amino acid
sequences of MIH ⁄ GIH from several species of crustacean.
In the first round of PCR, a 1 lL aliquot of cDNA was
amplified with 3¢-RACE-GIH1A [5¢-TG(TC)(AC)CIGGIG
TIATGGG(TC)AAC(AC)GIGA-3¢] and PM1 (5¢-CCGG
AATTCAAGCTTCTAGAGGATCC-3¢) primers in 25 lL
P. monodon GIH cDNA and its role in Vg expression S. Treerattrakool et al.
976 FEBS Journal 275 (2008) 970–980 ª 2008 The Authors Journal compilation ª 2008 FEBS
of a reaction mixture containing 10 mm Tris ⁄ HCl pH 9.0,
50 mm KCl, 0.1% Triton X-100, 1.5 mm MgCl
2
, 200 nm of
each primer, 200 lm each of dATP, dCTP, dGTP, dTTP
and 1.25 units of Taq DNA Polymerase in storage buffer B
(Promega). Amplification was performed in a DNA thermal
cycler (GeneAmp System 2400; PE Applied Biosystems,
Foster City, CA, USA) with 35 cycles of 94 °C for 30 s,

50 °C for 30 s and 74 °C for 1 min followed by 7 min incu-
bation at 74 °C as a final extension. Subsequently, nested
amplification was performed with 200 nm of 3¢-RACE-
GIH1B [5¢-ATGGG(TC)AAC(AC)GIGA(TC)(ATC)TITA
(TC)(GA)AIAA(AG)GT-3¢] and PM1 primers to obtain the
specific product.
For 5¢-RACE, first-strand cDNA synthesis was per-
formed in a reaction as described above, except that 1 lm
of 5¢-RACE-GIH1 primer (5¢-CCACGGCCGGCCGGC
ATTGAG-3¢) was substituted for PRT primer. The reaction
was carried out using two-step RT. The first RT step was
incubated at 50 °C for 60 min. The RNA template was
denatured again at 83 °C for 3 min and then immediately
on ice for 5 min. For the second RT step, 1 lL of ImProm-
IIÔ reverse transcriptase was added to the reaction. The
reaction was incubated at 50 °C for 60 min and then termi-
nated at 70 °C for 15 min. The RNA template was
degraded with RNaseH before proceeding with cDNA
purification by QIAquick PCR Purification Kit (Qiagen,
Hilden, Germany). A 20 lL aliquot of purified cDNA was
tailed with dATP in 30 lL of 100 mm cacodylate buffer
(pH 6.8), 1 mm CoCl
2
, 0.1 mm dithiothreitol, 200 lm dATP
and 20 units of terminal deoxynucleotidyl transferase (TdT)
(Promega). The reaction was incubated at 37 °C for 20 min
and TdT was heat-inactivated at 65 °C for 10 min. The first
round PCR with 3 lL of the dA-tailed cDNA template was
carried out as described for 3¢-RACE using 200 nm of
5¢-RACE-GIH2 (5¢-GGCCTCGCGCTTGGCCGAGTG-3¢)

and PRT primers, except that annealing was performed at
55 °C for 30 s. Second-round PCR was performed with
200 nm of 5¢-RACE-GIH3 (5¢-TCGATTTCTGCACAAGC
CATCCAGCTG-3¢) and PM1 primers to obtain specific
amplified product.
Amplification of full-length Pem-GIH cDNA
Total RNA extracted from one pair of eyestalks from an
adult female shrimp in stage IV of vitellogenesis, as
described above, was used to synthesize a cDNA template
for the cloning of full-length cDNA of Pem-GIH.A1lL
aliquot of cDNA was amplified with GIHF (5¢-GAACGTC
TCGTATAAAAGGTCTGCG-3¢) and GIHR (5¢-GGTCG
ACTTTATTTTAACGGAAAATTAAT-3¢) primers in a
25 lL reaction containing 1· Phusion HF buffer including
1.5 mm MgCl
2
, 500 nm of each primer, 200 lm each of
dATP, dCTP, dGTP, dTTP and 0.25 units of Phusion
DNA Polymerase (Finnzymes, Espoo, Finland). Amplifica-
tion was performed in a DNA thermal cycler (GeneAmp
System 2400; PE Applied Biosystems) with 35 cycles of
98 °C for 10 s, 50 °C for 30 s and 72 °C for 1 min followed
by 7 min incubation at 72 °C as a final extension.
RT-PCR
To detect tissue-specific expression of Pem-GIH, total RNA
extracted from several P. monodon tissues, including eye-
stalks, brain, thoracic nerve cord, abdominal nerve cord,
heart, hepatopancreas, ovary and muscle, was used as a
template for RT with PRT primer as described above. The
specific transcript of Pem-GIH was amplified with GIHF

and 5¢-RACE-GIH1 primers to detect Pem-GIH transcript
level in all experiments. The reaction was amplified with
35 cycles of 94 °C for 30 s, 50 °C for 30 s and 74 °C for
1 min followed by 7 min incubation at 74 °C as a final
extension. To detect Vg transcript in the ovary, Vg-F
(5¢-CTAAGGCAATTATCACTGCTGCT-3¢) and Vg-R
(5¢-AAGCTTGGCAATGTATTCCTTTT-3¢) primers desig-
ned from the EST clone containing Vg sequence from
P. monodon ovary (GenBank accession no. EE332453) were
used in a reaction with 32 cycles of 94 °C for 30 s, 50 °C
for 30 s and 74 °C for 1 min followed by 7 min incubation
at 74°C. The actin transcript was amplified with PmActin-F
(5¢-GACTCGTACGTCGGGCGACGAGG-3¢) and PmAc-
tin-R (5¢-AGCAGCGGTGGTCATCACCTGCTC-3¢)
primers in a reaction with 21 cycles of 94 °C for 30 s,
55 °C for 30 s and 74 °C for 1 min followed by further
incubation at 74 °C for 7 min. The expected sizes of
Pem-GIH, Vg and actin transcripts are 385, 354 and
539 bp, respectively.
Preparation of GIH-dsRNA
Production of GIH-dsRNA by in vitro transcription
Two DNA templates for dsRNA of GIH that span the
coding sequence of the mature Pem-GIH, each containing
T7 promoter sequence at the 5¢-end on different strands
were synthesized by PCR from full-length Pem-GIH cDNA.
Two separate PCR reactions were set up, one with
T7-containing forward primer (5¢-TAATACGACTCACTA
TAGGGAGAAA CATC CTGG ACAGCA AATGC AGGG -3¢)
and reverse primer (5¢-CCGGCATTGAGGATGCTGAT-
3¢) for the sense-strand template, the other with forward

primer matGIHF (5¢-AACATCCTGGACAGCAAATGCA
GGG-3¢) and T7-containing reverse primer (5¢-TAATACG
ACTCACTATAGGGAGACCGGCA TTGAGGATG CTG
AT-3¢) for the antisense-strand template. The reaction
consisted of denaturation at 94 °C for 30 s, annealing at
57 °C for 30 s and extension at 74 °C for 1 min for
9 cycles with a 1 ° C decrease in annealing temperature
per cycle; the annealing temperature then remained at
48 °C for another 30 cycles and followed by a final
extension at 74 °C for 7 min. The expected PCR product
were excised and purified with a gel extraction kit
S. Treerattrakool et al. P. monodon GIH cDNA and its role in Vg expression
FEBS Journal 275 (2008) 970–980 ª 2008 The Authors Journal compilation ª 2008 FEBS 977
(Qiagen), as described in the manufacturer’s protocol. A
mixture of 1 lg of each template was used in an in vitro
transcription reaction with MEGAscriptÒRNAi Kit
(Ambion, Austin, TX, USA) according to the manufac-
turer’s protocol with some modifications. Briefly, sense- and
antisense-strand templates were amplified in separate PCR
as described above. The two templates were mixed in equal
amounts and added to a single transcription reaction to syn-
thesize dsRNA with T7 RNA polymerase at 37 °C for 6 h.
To increase the duplex yield, the transcription reaction was
incubated at 75 °C for 5 min, and allowed to cool to room
temperature. The remaining DNA template and single-
stranded RNA in solution were digested with DNaseI and
RNaseA at 37 °C for 1 h. The proteins, free nucleotides and
degraded nucleic acid residues were removed from double-
stranded RNA by the filter cartridge as described in manu-
facturer’s instructions. Finally, dsRNA was eluted with

100 lLof95°C pre-heated 10 mm Tris ⁄ HCl pH 7, and
1mm EDTA.
Production of GIH-dsRNA by in vivo expression in
Escherichia coli
In order to obtain large quantity of dsRNA for the in vivo
functional assay, GIH-dsRNA was produced as hairpin-
RNA precursor in E. coli following a previously described
method [25] with some modifications. A 340 bp DNA
template for the sense strand of dsRNA connecting with a
loop region was amplified with primers sense-GIHF1-XbaI
(5¢-GCTCTAGAAACATCCTGGACAGCA-3¢) and sense-
GIHR1-BamHI (5¢-CGGGATCCTAGCGCAGGGGGA
GA-3¢). Another DNA template for the antisense strand of
dsRNA, 240 bp, was amplified with primers as-GIHF-SalI
(5¢-CGGTCGACAACATCCTGGACAGCA-3¢) and as-
GIHR-BamHI (5¢-CGGGATCCTCACCACGGCCGG
CCGGC-3¢). The antisense template was first cloned into
pET17b vector at BamHI and XhoI sites, following by the
sense template at XbaI and BamHI. The resulting recombi-
nant plasmid was constructed and propagated in E. coli
DH5a and its nucleotide sequence was verified by auto-
mated DNA sequencing.
The recombinant plasmid of hairpin-RNA of Pem-GIH
was subsequently transformed into an RNaseIII-deficient
E. coli HT115 strain. Expression of hairpin-RNA was
induced with 0.4 mm isopropyl thio-b-d-galactoside for
2 h in 2· YT medium. Cells were harvested by centrifu-
gation and resuspended in 500 lL NaCl ⁄ P
i
containing

0.1% SDS. The sample was boiled for 2 min and then
snapped cool on ice. To eliminate endogenous RNA from
bacterial cell and single-stranded RNA in the loop region
of GIH hairpin-RNA, the cell lysate was treated with
RNaseA at 37 °C for 30 min. dsRNA of Pem-GIH was
extracted by using TRI-REAGENT
Ò
(Molecular Research
Center) and resuspended in Tris ⁄ NaCl (10 mm Tris ⁄ HCl
pH 7, 10 mm NaCl).
The quantity of dsRNA was determined by the UV spec-
trophotometry at an absorbancy of A
260
.
dsRNA-mediated Pem-GIH knockdown in shrimp
explant culture
Eyestalk ganglia or abdominal nerve cords of P. monodon
were dissected from individual shrimp. The eyestalk from
a single shrimp was used in each experiment. The XOSG
neuron from the left eyestalk was used as a negative control
whereas that from the right eyestalk was treated with
dsRNA as described below. Nerve cord from the same
shrimp was cut into  0.8–1 cm pieces and used in one set
of the experiment. The explant samples were incubated in a
well of 24-well plate filled with 1.5 mL of modified
M199 culture medium consisting of M199 powder in crab
saline (440 mm NaCl, 11 mm KCl, 13.3 mm CaCl
2
,26mm
MgCl

2
,26mm Na
2
SO
4
and 10 mm Hepes pH 7.2) supple-
mented with 100 lgÆmL
)1
penicillin–streptomycin anti-
fungus and 40 lgÆmL
)1
gentamicin sulfate. The samples
were added to 3 lg of GIH-dsRNA and cultured with
shaking at 20–24 °C for the appropriate length of time.
Samples were then washed with modified M199 medium
plus antibiotic before collected for RNA extraction. The
level of Pem-GIH transcript was detected by RT-PCR with
GIHF and 5¢-RACE-GIH1 primers as described earlier.
Functional knockdown assay for Pem-GIH activity
Previtellogenic adult female P. monodon at the intermolt
and early premolt stages (C–D2) ( 85–120 g each) were
cultured in tanks filled with artificial seawater ( 30 p.p.t.
salinity). Shrimp were divided into two groups, each con-
taining five shrimp. The control group was injected through
the arthrodial membrane of the second walking leg with
Tris ⁄ NaCl ( 3 lLÆg
)1
body weight) and the experimental
group was injected with GIH-dsRNA ( 3 lgÆlL
)1

)at
3 lgÆg
)1
body weight. The level of GIH and Vg transcripts
in eyestalk ganglia and ovary, respectively were detected by
RT-PCR 5 days after being administered with dsRNA.
Statistical analysis
Results are presented as mean ± SEM. Statistical signifi-
cance between values was determined by Levene’s test of
independent sample t-test from spss for Windows 11.5.
Acknowledgements
We acknowledge Hiu Kwan Tiu (School of Biological
Sciences, The University of Hong Kong) for her kind
advice on the shrimp explant culture technique. We
thank Ms Junpim Wannarungsi at Bangkok Aquacul-
ture Farm Company (BAFCO) for supplying adult
P. monodon GIH cDNA and its role in Vg expression S. Treerattrakool et al.
978 FEBS Journal 275 (2008) 970–980 ª 2008 The Authors Journal compilation ª 2008 FEBS
female P. monodon. This study was supported by The
Royal Golden Jubilee PhD program to ST, the RD&E
Funding from BIOTEC, Thailand and Mahidol Uni-
versity research grant. SMC was supported by a grant
(HKU#7482 ⁄ 05M) from the Research Grant Council
of the Hong Kong SAR Government.
References
1 Tsukimura B (2001) Crustacean vitellogenesis: its role
in oocyte development. Am Zool 41, 465–476.
2 Tsutsui N, Kawazoe I, Ohira T, Jasmani S, Yang W-J,
Wilder MN & Aida K (2000) Molecular characteriza-
tion of a cDNA encoding vitellogenin and its expression

in the hepatopancreas and ovary during vitellogenesis in
the Kuruma prawn, Penaeus japonicus. Zool Sci 17,
651–660.
3 Avarre J-C, Michelis R, Tietz A & Lubzens E (2003)
Relationship between vitellogenin and vitellin in a mar-
ine shrimp (Penaeus semisulcatus) and molecular charac-
terization of vitellogenin complementary DNAs. Biol
Reprod 69, 355–364.
4 Tsang W-S, Quackenbush LS, Chow BKC, Tiu SHK,
He JG & Chan S-M (2003) Organization of the shrimp
vitellogenin gene: evidence of multiple genes and tissue
specific expression by the ovary and hepatopancreas.
Gene 303, 99–109.
5 Yang F, Xu HT, Dai ZM & Yang WJ (2005) Molecular
characterization and expression analysis of vitellogenin
in the marine crab Portunus trituberculatus. Comp
Biochem Physiol B 142, 456–464.
6 Charmantier G, Charmantier-Daures M & Van Herp F
(1997) Hormonal regulation of growth and reproduc-
tion in crustaceans. In Endocrinology and Reproduction,
Recent Advances in Marine Biotechnology, Vol. 1
(Fingerman M, Nagabhushanam R & Thompson M-F,
eds), pp. 109–161. Science Publishers, Enfield, NH.
7 Huberman A (2000) Shrimp endocrinology. A review.
Aquaculture 191, 191–208.
8 Skinner DM (1985) Molting and regeneration. In The
Biology of Crustacea, Integuments, Pigments and
Hormonal Processes , Vol. 9 (Bliss DE & Mantel LH
eds), pp. 43–146. Academic Press, Orlando, FL.
9 Keller R (1992) Crustacean neuropeptides: structures,

functions and comparative aspects. Experientia 48, 439–
448.
10 Ohira T, Katayama H, Tominaga S, Takasuka T,
Nakatsuji T, Sonobe T, Aida K & Nagasawa H (2005)
Cloning and characterization of a molt-inhibiting
hormone-like peptide from the prawn Marsupenaeus
japonicus. Peptide 26, 259–268.
11 Lacombe C, Greve P & Martin G (1999) Overview
on the sub-grouping of the crustacean hyperglycemic
hormone family. Neuropeptides 33, 71–80.
12 Chen SH, Lin CY & Kuo CM (2005) In silico analysis
of crustacean hyperglycemic hormone family. Mar
Biotechnol 7, 193–206.
13 Chan SM, Gu PL, Chu KH & Tobe SS (2003) Crusta-
cean neuropeptide genes of the CHH ⁄ MIH ⁄ GIH
family: implications from molecular studies. Gen Comp
Endocrinol 134, 214–219.
14 Soyez D, Van Deijnen JE & Martin M (1987) Isolation
and characterization of a vitellogenesis-inhibiting factor
from the sinus gland of the lobster, Homarus americ-
anus. J Exp Zool 244, 479–484.
15 Tsutsui N, Katayama H, Ohira T, Nagasawa H, Wilder
MN & Aida K (2005) The effects of crustacean hyper-
glycemic hormone-family peptides on vitellogenin gene
expression in the kuruma prawn, Marsupenaeus
japonicus
. Gen Comp Endocrinol 144, 232–239.
16 Aguilar MB, Quackenbush LS, Hunt DT, Shabanowitz
J & Huberman A (2002) Identification, purification and
initial characterization of the vitellogenesis-inhibiting

hormone from the Mexican crayfish Procambarus
bouvieri (Ortmann). Comp Biochem Physiol B 102,
491–498.
17 Gu P-L, Tobe SS, Chow BKC, Chu KH, He J-G &
Chan S-M (2002) Characterization of an additional
molt inhibiting hormone-like neuropeptide from the
shrimp Metapenaeus ensis. Peptide 23, 1875–1883.
18 Edomi P, Azzoni E, Mettulio R, Pandolfelli N, Ferrero
EA & Giulianini PG (2002) Gonad-inhibiting hormone
of the Norway lobster (Nephrops norvegicus): cDNA
cloning, expression, recombinant protein production,
and immunolocalization. Gene 284, 93–102.
19 Yang W-J & Rao KR (2001) Cloning of precursors for
two MIH ⁄ VIH-related peptides in the prawn, Macrob-
rachium rosenbergii. Biochem Biophys Res Commun 289,
407–413.
20 De Kleijn DPV, Janssen KPC, Waddy SL & Hegeman R
(1998) Expression of the crustacean hyperglycemic hor-
mones and the gonad-inhibiting hormone during the
reproductive cycle of the female American lobster
Homarus americanus. J Endrocrinol 156, 291–298.
21 Hannon GL (2002) RNA interference. Nature 418,
244–251.
22 Tsuzuki S, Sekiguchi S & Hayakawa Y (2005) Regula-
tion of growth-blocking peptide expression during
embryogenesis of the cabbage armyworm. Biochem
Biophys Res Commun 335, 1078–1084.
23 Volz J, Osta MA, Kafatos FC & Muller HM (2005)
The roles of two clip domain serine proteases in innate
immune responses of the malaria vextor Anopheles

gambiae. J Biol Chem 280, 40161–40168.
24 Martin D, Maestro O, Cruz J, Mane-Padros D &
Belles X (2006) RNAi studies reveal a conserved role
for RXR in molting in the cockroach Blattella germa-
nica. J Insect Physiol 52, 410–416.
S. Treerattrakool et al. P. monodon GIH cDNA and its role in Vg expression
FEBS Journal 275 (2008) 970–980 ª 2008 The Authors Journal compilation ª 2008 FEBS 979
25 Yodmuang S, Tirasophon W, Roshorm Y, Chin-
nirunvong W & Panyim S (2006) YHV-protease dsRNA
inhibits YHV replication in Penaeus monodon and pre-
vents mortality. Biochem Biophys Res Commun 341,
351–356.
26 Jackson AL & Linsley PS (2004) Noise amidst the silence:
off-target effects of siRNAs? Trends Genet 20, 521–524.
27 Quin S, Ademal M & Lane T (2005) A computational
study of off-target effects of RNA interference. Nucleic
Acids Res 33, 1834–1847.
28 Ohira T, Okumura T, Suzuki M, Yajima Y, Tsutsui N,
Wilder MN & Nagasawa H (2006) Production and
characterization of recombinant vitellogenesis-inhibiting
hormone from the American lobster, Homarus
americanus. Peptides 27, 1251–1258.
29 Tseng D-Y, Chen Y-N, Kou G-H, Lo C-F & Kuo C-M
(2001) Hepatopancreas is the extraovarian site of
vitellogenin synthesis in black tiger shrimp, Penaeus
monodon. Comp Biochem Physiol A 129, 909–917.
30 Phiriyangkul P & Utarabhand P (2006) Molecular char-
acterization of a cDNA encoding vitellogenin in the
banana shrimp, Penaeus (Litopenaeus) merguiensis and
sites of vitellogenin mRNA expression. Mol Reprod Dev

73, 410–423.
31 Jayasankar V, Tsutsui N, Jasmani S, Saido-Sakanaka
H, Yang WJ, Okuno A, Tran TT, Aida K & Wilder
MN (2002) Dynamics of vitellogenin mRNA expression
and changes in hemolymp vitellogenin levels during
ovarian maturation in the giant freshwater prawn
Macrobrachium rosenbergii . J Exp Zool 293, 675–682.
32 Okuno A, Yang WJ, Jayasankar V, Saido-Sakanaka H,
Huong do TT, Jasmani S, Atmomarsono M, Subr-
amoniam T, Tsutsui N, Ohira T et al. (2002) Deduced
primary structure of vitellogenin in the giant fresh water
prawn, Macrobrachium rosenbergii, and yolk processing
during ovarian maturation. J Exp Zool 292, 417–429.
33 Okumura T, Kim YK, Kawazoe I, Yamano K, Tsutsui
N & Aida K (2006) Expression of vitellogenin and cor-
tical rod protein during induced ovarian development
by eyestalk ablation in the kuruma prawn, Marsupena-
eus japonicus. Comp Biochem Physiol A 143, 246–253.
34 Okumura T (2007) Effects of bilateral and unilateral
eyestalk ablation on vitellogenin synthesis in immature
female kuruma prawn, Marsupenaeus japonicus. Zoolog
Sci 24, 233–240.
35 Raviv S, Parnes S, Segall C, Davis C & Sagi A (2006)
Complete sequence of Litopenaeus vannamei (Crustacea:
Decapoda) vitellogenin cDNA and its expression in
endocrinologically induced sub-adult females. Gen
Comp Endocrinol 145, 39–50.
36 Okumura T, Yamano K & Sakiyama K (2007) Vitello-
genin gene expression and hemolymph vitellogenin dur-
ing vitellogenesis, final maturation, and oviposition in

female kuruma prawn, Marsupenaeus japonicus. Comp
Biochem Physiol A 147
, 1028–1037.
37 Browdy CL & Samocha TM (1985) The effect of
eyestalk ablation on spawning, molting and mating
of Penaeus semisulcatus de Haan. Aquaculture 49,
19–29.
38 Lugo JM, Morera Y, Rodriguez T, Huberman A,
Ramos L & Estrada M (2006) Molecular cloning and
characterization of the crustacean hyperglycemic hor-
mone cDNA from Litopenaeus schmitti: functional anal-
ysis by double-strnaded RNA interference technique.
FEBS J 273, 5669–5677.
39 De Kleijn DPV, Coenen T, Laverdure AM, Tensen CP &
Van Herp F (1992) Localization of messenger RNAs
encoding crustacean hyperglycemic hormone and gonad-
inhibiting hormone in the X-organ sinus gland complex
of the lobster Homarus americanus. Neuroscience 51,
121–128.
40 Khalaila I, Manor R, Weil S, Granot Y, Keller R &
Sagi A (2002) The eyestalk–androgenic gland–testis
endocrine axis in the crayfish Cherax quadricarinatus.
Gen Comp Endocrinol 127, 147–156.
Supplementary material
The following supplementary material is available
online:
Fig. S1. Silencing of Pem-GIH in adolescent female
P. monodon. Adolescent shrimp (22–23 g) were divided
into three groups. Control shrimp (buffer) were
injected with Tris ⁄ NaCl, whereas shrimp in the experi-

mental group (dsGIH) were injected with GIH-dsRNA
at a concentration of 2 lg ⁄ 10 g shrimp. The third
group (dsGFP) was injected with GFP-dsRNA at the
same concentration as GIH-dsRNA. Eyestalk ganglia
were collected from individual shrimp in each group at
72 h after injection for RNA extraction and detection
of Pem-GIH and actin transcripts by RT-PCR. )ve
represents negative PCR.
This material is part of the online article from

Please note: Blackwell Publishing are not responsible
for the content or functionality of any supplementary
materials supplied by the authors. Any queries (other
that missing material) should be directed to the corre-
sponding author for the article.
P. monodon GIH cDNA and its role in Vg expression S. Treerattrakool et al.
980 FEBS Journal 275 (2008) 970–980 ª 2008 The Authors Journal compilation ª 2008 FEBS