Báo cáo khoa học: Dynamin-like protein-dependent formation of Woronin bodies in Saccharomyces cerevisiae upon heterologous expression of a single protein pdf

Dynamin-like protein-dependent formation of Woronin
bodies in Saccharomyces cerevisiae upon heterologous
expression of a single protein
Christian Wu
¨
rtz, Wolfgang Schliebs, Ralf Erdmann and Hanspeter Rottensteiner
Institut fu
¨
r Physiologische Chemie, Ruhr-Universita
¨
t Bochum, Germany
The HEX1 protein of Neurospora crassa, identified by
Jedd and Chua [1] and Tenney et al. [2], is the major
component of a class of microbodies limited to euasco-
mycetes and some deuteromycetes, the so-called Woro-
nin body [3,4]. Because of the syncytial growth of
filamentous fungi, wounding of hyphae can lead to a
severe loss of cytoplasm and subcellular organelles, if
the plasma membrane or a nearby septum is not rap-
idly sealed. For this reason, the Woronin body is pres-
ent in filamentous euascomycetes and plugs septal
pores immediately after cells have been damaged [1,2].
In addition to septal pore sealing in cases of injury,
Woronin bodies have also been described as being
required for efficient pathogenesis, survival during
nitrogen starvation [5] and conidiation [6] in various
fungi.
Although it is more than 140 years since the dis-
covery of this very specialized organelle [4], our knowl-
edge of the biogenesis of Woronin bodies remains
incomplete. Electron microscopy studies provided the

first evidence that Woronin bodies are derived from
other microbodies [7]. These findings have been
extended by reports showing that Woronin body
formation is initiated in the vicinity of glyoxysomes
and may proceed through fission from them [8], and
by the demonstration that PEX14 is a key player in
the biogenesis of both glyoxysomes and Woronin
bodies [9]. Furthermore, the presence of a C-terminal
canonical peroxisomal targeting signal type 1 (PTS1) is
required for the proper topogenesis of HEX1 [9] and
allows HEX1 to be imported into peroxisomes upon
heterologous expression in yeast [1]. Peroxisomal
Keywords
filamentous fungi; Neurospora crassa;
peroxisome; protein import; yeast
Correspondence
H. Rottensteiner, Institut fu
¨
r Physiologische
Chemie, Abt. Systembiochemie, Ruhr-
Universita
¨
t Bochum, D-44780 Bochum,
Germany
Fax: +49 234 321 4266
Tel: +49 234 322 7046
E-mail:
(Received 22 January 2008, revised 27
March 2008, accepted 2 April 2008)
doi:10.1111/j.1742-4658.2008.06430.x

Filamentous ascomycetes harbor Woronin bodies and glyoxysomes, two
types of microbodies, within one cell at the same time. The dominant pro-
tein of the Neurospora crassa Woronin body, HEX1, forms a hexagonal
core crystal via oligomerization and evidence has accumulated that Woro-
nin bodies bud off from glyoxysomes. We analyzed whether HEX1 is suffi-
cient to induce Woronin body formation upon heterologous expression in
Saccharomyces cerevisiae, an organism devoid of this specialized organelle.
In wild-type strain BY4742, initial import of HEX1 into existing peroxi-
somes enabled the formation of organelles with a hexagonal crystal. The
observed structures mimicked the shape of genuine Woronin bodies, but
exhibited a lower density and were significantly larger. Double-immuno-
fluorescence analysis revealed that hexagonal HEX1 structures only occa-
sionally co-localized with peroxisomal marker proteins, indicating that the
Woronin-body-like structures are well separated from peroxisomes. In cells
lacking Vps1p and Dnm1p, dynamin-like proteins required for the division
of peroxisomes, the Woronin-body-like organelles remained attached to
peroxisomes. The data indicate that Woronin bodies emerge after the
formation of a HEX1 core crystal within peroxisomes followed by Vps1p-
and Dnm1p-mediated fission.
Abbreviations
PMP, peroxisomal membrane protein; PNS, post-nuclear supernatant; PTS1, peroxisomal targeting signal type 1.
2932 FEBS Journal 275 (2008) 2932–2941 ª 2008 The Authors Journal compilation ª 2008 FEBS
HEX1 provokes the formation of very small, mem-
brane-bound protein granules that are hexagonal or
spherical [1]. Although intriguing, this observation
points to the existence of additional factors in filamen-
tous fungi that contribute to the formation of mature
and functional Woronin bodies.
Although the transport of HEX1 to Woronin bodies
via microbodies, i.e. peroxisomes, is well known, the

budding of Woronin bodies from microbodies is still
under investigation. Some players in peroxisomal fis-
sion have been identified in recent years, including the
dynamin-like proteins Vps1p [10] and Dnm1p [11]. The
reduction in peroxisome numbers seen in vps1D and
dnm1D single mutants is even more pronounced in the
absence of both proteins. Most cells possess only a
single peroxisome that is extended and exhibits a num-
ber of constrictions [11]. The Pex11p family of proteins
is also implicated in peroxisome fission, but is thought
to act upstream of the dynamin-like proteins [12–17].
This study is concerned with the topogenesis of
HEX1 using the heterologous Saccharomyces cerevisiae
expression model system. We used diverse cell biologi-
cal and biochemical approaches to scrutinize various
HEX1-expressing strains for the appearance of Woro-
nin-body-like structures. Furthermore, we determined
whether the formation of Woronin bodies from peroxi-
somes shares components of the peroxisomal fission
machinery by examining the fate of HEX1 in a
vps1Ddnm1D double-deletion strain. The results are dis-
cussed in terms of a mechanism for the formation of
Woronin bodies that is largely determined by the
expression of HEX1. The system set-up is likely to be
of use for studying peroxisome fission in a time-
resolved manner.
Results
HEX1 is imported into organelles in S. cerevisiae
in a PTS1-dependent manner
To address whether Woronin body formation depends

on factors specific for filamentous euascomycetes, we
heterologously expressed Neurospora crassa HEX1
cDNA under the control of the constitutive PGK1 pro-
moter in S. cerevisiae strain BY4742. Expression of
HEX1 in BY4742, achieved by the strong constitutive
PGK1 promoter, was verified by western blotting
(Fig. 1A). In line with Jedd and Chua [1], the size of
heterologously expressed HEX1 was the same as that
of endogenous N. crassa HEX1, indicating that HEX1
is correctly synthesized in this yeast strain.
Differential centrifugation confirmed the organellar
localization of HEX1; most HEX1 was found in the
organellar pellet fraction together with the peroxisomal
marker proteins Pex13p and Cta1p, whereas only a
small amount of HEX1 was located in the cytosolic
supernatant (Fig. 1A). HEX1 was also expressed in a
pex5D strain, in which PTS1 import is specifically com-
promised because of the absence of the cognate signal
receptor. In this strain, both HEX1 and the peroxi-
somal matrix protein Cta1p were exclusively detected
in the cytosolic fraction, whereas the PMP Pex13p was
still located in the organellar pellet (Fig. 1B). There-
fore, HEX1 is imported into organelles in a PTS1-
dependent manner.
Localization of HEX1 in density gradients
The subcellular distribution of HEX1 was further ana-
lyzed by sucrose density gradient centrifugation. Post-
nuclear supernatant (PNS) obtained from the wild-type
strain BY4742 was subjected to centrifugation at
100 000 g and the resulting pellet was loaded on top of

a sucrose density gradient. As expected, the peroxi-
somal membrane marker Pex13p peaked at a density
of  1.20 gÆcm
)3
and was clearly separated from the
mitochondrial marker Aac2p (1.18 gÆcm
)3
). The perox-
isomal matrix protein Fox3p exhibited a dual distribu-
tion, with one peak corresponding to that of Pex13p
and an additional peak at light fractions (Fig. 1C).
The latter was likely to be caused by ruptured organ-
elles that emerge upon resuspension of the pellet. This
distribution pattern was not altered when a PNS from
BY4742 expressing HEX1 was used. The majority of
HEX1 showed a localization that differed from that
of Fox3p (Fig. 1D), with one peak at a density of
1.23 gÆcm
)3
and one peak at lighter fractions. The dis-
tribution of HEX1 was also distinct from that of
mitochondrial Aac2p, the Golgi ⁄ endosome marker
Pep12p and the endoplasmic reticulum marker Kar2p.
When compared with the distribution profile of HEX1
in a density gradient of a N. crassa wild-type strain
(Fig. 1E), it became obvious that in yeast HEX1 did
not sediment to the density of N. crassa Woronin
bodies (1.28 gÆcm
)3
; fraction 5). Thus, in yeast, HEX1

appeared to form Woronin-body-like organelles, but
with a lower density than genuine Woronin bodies.
PTS1-dependent formation of giant Woronin
bodies
The subcellular localization of HEX1 was also analyzed
by immunofluorescence microscopy. Decoration of the
untransformed wild-type strain with anti-HEX1 serum
only led to background staining (Fig. 2A). Analysis of
the HEX1-expressing strain revealed some small
C. Wu
¨
rtz et al. Heterologous Woronin body formation
FEBS Journal 275 (2008) 2932–2941 ª 2008 The Authors Journal compilation ª 2008 FEBS 2933
circular spots typical for peroxisomes. Strikingly, large
hexagonal Woronin-body-like structures with a mean
size of  1.5 · 1.5 lm were also detected upon HEX1
expression (Fig. 2B). Remarkably, typical Woronin
bodies of N. crassa are smaller with an average size of
 400–700 nm [18]. In a pex5D strain, staining with
anti-HEX1 serum was diffuse (Fig. 2C), thereby verify-
ing the PTS1-dependent import of HEX1 in yeast.
Notably, formation of the hexagonal structures likewise
depended on the peroxisomal import receptor Pex5p.
To examine whether peroxisomal proteins co-localize
with the hexagonal structures, double-immunofluores-
cence staining was carried out in strain BY4742
co-expressing the artificial peroxisomal marker protein
GFP-SKL and HEX1. In a few cells, GFP-SKL showed
a rim-like staining around the hexagonal HEX1 struc-
tures (Fig. 2D, upper). In other cases, GFP-SKL was

located in small dots in vicinity to the hexagonal struc-
tures stained with anti-HEX1 serum. However, most
hexagonal structures did not contain GFP-SKL,
whereas small spots were often double-labeled for
HEX1 and GFP-SKL (Fig. 2D, middle and lower).
Ultrastructure of the hexagonal structures
To corroborate the appearance of hexagonal HEX1
structures in BY4742, this strain was also analyzed by
electron microscopy. The untransformed wild-type
showed a normal distribution and morphology for all
visible organelles (Fig. 3A). In the HEX1-expressing
strain, however, large electron-opaque hexagonal
(Fig. 3B) or rectangular (Fig. 3C) structures were
visible. These clearly harbored a delimiting single
A B
C
D
E
Fig. 1. Subcellular distribution of HEX1 upon heterologous expres-
sion in S. cerevisiae. (A, B) Differential centrifugation. PNS of (A)
BY4742 and BY4742 expressing HEX1, and of (B) the otherwise
isogenic pex5D gene deletion strain, with or without expressing
HEX1, were separated by centrifugation at 25 000 g for 20 min into
a supernatant and an organellar pellet fraction. Equal amounts of
each fraction were loaded onto an SDS gel and subjected to
western blot analysis. Distribution of the peroxisomal matrix protein
catalase (Cta1p), the PMP Pex13p and HEX1 was determined with
appropriate antibodies. (C, D) Density gradient centrifugation. The
25 000 g organellar pellets of (C) BY4742 and (D) BY4742 express-
ing HEX1 were loaded on top of a linear sucrose gradient (30–60%

w ⁄ w) and subjected to centrifugation at 38 000 g for 2 h. Fractions
(1 mL) were collected from the bottom (fraction 1) to the top (frac-
tion 27) and assayed by western blot for the distribution of the per-
oxisomal matrix protein Fox3p, PMP Pex13p and HEX1. Aac2p
served as a marker for mitochondria, Kar2p for the ER and Pep12p
for the Golgi ⁄ endosome compartment. Densities of the peak frac-
tions of HEX1-containing organelles (1.23 gÆcm
)3
) and peroxisomes
(1.20 gÆcm
)3
) are indicated. (E) Density of Woronin bodies in
N. crassa. For comparison, a 25 000 g organellar pellet from a
N. crassa wild-type strain was separated on a 30–60% w ⁄ w
sucrose gradient and analyzed for the distribution of HEX1 (Woro-
nin bodies), glyoxysomal ICL1 and mitochondrial TIM23. Densities
of the peak fractions of Woronin bodies (1.28 gÆcm
)3
) and glyoxy-
somes (1.20 gÆcm
)3
) are indicated.
Heterologous Woronin body formation C. Wu
¨
rtz et al.
2934 FEBS Journal 275 (2008) 2932–2941 ª 2008 The Authors Journal compilation ª 2008 FEBS
membrane and were therefore designated as giant
Woronin bodies. The size of the hexagonal structures
fitted with the measurements based on the immunoflu-
orescence images. The rectangular structures were up

to 1.5 lm on their short side and up to 7.4 lmon
their long side, and may represent Woronin bodies in
a different orientation with respect to the plane of the
section. The short dimension fits with the measurement
of the en face view of the hexagonal structures. In
some rare cases, peroxisomes with areas of distinct
electron density were denoted (Fig. 3D), probably
representing HEX1-enriched regions that eventually
bud off from the peroxisome.
HEX1 assembles to a crystalline core in
S. cerevisiae
Because the observed Woronin-body-like hexagonal
structures differed from N. crassa Woronin bodies in
density (Fig. 1) and size (Figs 2 and 3), the question
arose as to whether HEX1 is able to form dense crys-
tals in S. cerevisiae. It has been shown previously that
Woronin bodies sediment upon medium speed
centrifugation even if the membrane is removed using
detergent, but this requires proper formation of the
HEX1 core crystal [19]. To this end, differential centri-
fugation at various speeds was conducted, in the
presence or absence of detergent. Examination of a
wild-type PNS revealed increasing amounts of peroxi-
somal marker proteins in the pellet fractions upon
increasing centrifugation speed (Fig. 4). Disintegration
of the organellar membranes by 0.5% Triton X-100
prevented the marker proteins from being sedimented
except for trace amounts in the 15 000 g pellet. A simi-
lar distribution of Cta1p and Pex13p was seen for the
strain expressing HEX1. By contrast, HEX1 was pres-

ent in the 1000 g pellet fraction and, more importantly,
HEX1 was detected in the sediment even after
A
D
B C
Fig. 2. Pex5p-dependent appearance of
giant Woronin bodies upon HEX1 expres-
sion. Yeast strains BY4742 (A),
BY4742 + HEX1 (B) and BY4742pex5D +
HEX1 (C) were analyzed for the localization
of HEX1 by indirect immunofluorescence,
using anti-HEX1 serum in combination with
Alexa Fluor 594-labeled anti-rabbit IgG. In
wild-type cells, large hexagonal structures
resembling Woronin bodies were detected
upon expression of HEX1. (D) Double-immu-
nofluorescence microscopy of BY4742
co-expressing HEX1 and the artificial peroxi-
somal marker GFP-SKL. The three panels
illustrate representative morphological differ-
ences of HEX1-stained organelles. Detection
was achieved with mouse monoclonal anti-
bodies against GFP combined with rabbit
anti-HEX1 serum. The secondary antibodies
used were Alexa Fluor 488-labeled anti-
mouse IgG and Alexa Fluor 594-labeled
anti-rabbit IgG. Bar = 5 lm.
C. Wu
¨
rtz et al. Heterologous Woronin body formation

FEBS Journal 275 (2008) 2932–2941 ª 2008 The Authors Journal compilation ª 2008 FEBS 2935
Triton X-100 treatment, whereas the majority of
Pex13p and Cta1p were detected in the supernatant
fractions. These data indicated that a typical HEX1
crystal core was formed in yeast which is likely to
contain only minor inclusions of peroxisomal matrix
proteins.
Vps1p and Dnm1p: two dynamin-like proteins
involved in fission of peroxisomes and Woronin
bodies
So far, we have been able to show that large Woronin-
body-like structures are formed in S. cerevisiae upon
heterologous expression of N. crassa HEX1. Because
this is supposed to require budding from peroxisomes,
we analyzed whether the typical peroxisomal fission
machinery is also involved in the formation of
Woronin bodies. Key players in peroxisomal fission
are the dynamin-related proteins Vps1p and Dnm1p
[10,11] whose concomitant absence typically results in
the presence of just one giant peroxisome per cell [11].
Thus, if Vps1p and Dnm1p are also required for the
formation of Woronin bodies, HEX1-containing
microbodies should be caught in the act of separating
from peroxisomes in this mutant strain.
The effect of the vps1 dnm1 double-deletion on the
subcellular distribution of HEX1 was first analyzed by
differential centrifugation analysis. HEX1, as well as
Pex13p and Cta1p, were detected in the pellet fraction
(Fig. 5A), although trace amounts of Cta1p also
A

B
C
D
Fig. 3. Ultrastructure of giant Woronin-body-like organelles and
peroxisomes in BY4742. Cells were grown for 14 h on medium
containing oleic acid as the sole carbon source and processed
for electron microscopy. (A) Typical morphology of a wild-type cell.
(B–D) BY4742 cells expressing HEX1. (B) A Woronin-body-like
structure is viewed from the top, with the typical hexagonal shape
of a N. crassa Woronin body. (C) A giant rectangular Woronin body
is captured from the side. (D) A small Woronin body is still attached
to a peroxisome (*), representing an intermediate of the fission pro-
cess. N, nucleus; M, mitochondria; Ld, lipid droplets; V, vacuole; P,
peroxisomes; Wb, Woronin-body-like structures. (A–C) Bar = 5 lm;
(D) Bar = 2.5 lm.
Fig. 4. Properties of the Woronin body core
crystal. PNS prepared from BY4742- and
BY4742-expressing HEX1 were subjected to
centrifugation at 1000, 5000 and 15 000 g
for 5 min, in the presence or absence of Tri-
ton X-100. The resulting supernatant (S) and
pellet (P) fractions were subjected to SDS-
gel electrophoresis and analyzed by western
blotting for the distribution of HEX1, the per-
oxisomal marker proteins Pex13p and
Cta1p. Disintegration of the membranes by
Triton X-100 changed the distribution of
Pex13p and Cta1p, but not that of HEX1.
Heterologous Woronin body formation C. Wu
¨

rtz et al.
2936 FEBS Journal 275 (2008) 2932–2941 ª 2008 The Authors Journal compilation ª 2008 FEBS
appeared in the supernatant fraction. Sucrose density
gradient centrifugation showed that the distribution of
peroxisomes was similar to that for the deletion and
wild-type strains (Fig. 5B). Peroxisomal density was
not affected upon expression of HEX1. The distribu-
tion profile of HEX1 was similar to that in the wild-
type strain, although with a shift of the peak towards
that of peroxisomes (Figs 1D and 5C).
To analyze whether fission of peroxisomes and Woro-
nin-body-like structures still occurs in the vps1Ddnm1D
mutant strain, electron microscopy studies were per-
formed. The vps1Ddnm1Ddouble-deletion strain showed
mitochondria with abnormal morphology and large
interconnected peroxisomes (Fig. 6A). Upon expression
of HEX1, smaller versions of rectangular or hexagonal
Woronin-body-like structures were visible (Fig. 6B,C).
Their mean size was  0.7 · 3.8 lm, which was about
half the size of the Woronin-body-like structures in the
wild-type. Interestingly, all discernible Woronin-body-
like structures had small vesicles attached. Based on the
gathered data, these vesicles were likely to represent
peroxisomes. To support this hypothesis, immuno-
fluorescence studies were performed. Extended single
peroxisomes were observed in the double-deletion strain
expressing GFP-SKL (Fig. 7A). Upon expression of
HEX1, the synthetic peroxisomal marker GFP-SKL
appeared in spots with tail-like extensions (Fig. 7B).
The spots, but not the extensions, were also stained with

A

B

C
Fig. 5. Subcellular distribution of HEX1 in a BY4742vps1Ddnm1D mutant strain. (A) Differential centrifugation. PNS was subjected to centri-
fugation at 25 000 g for 20 min and the resulting pellet and supernatant fractions were analyzed by immunoblotting for the presence of
HEX1, the peroxisomal marker proteins Pex13p and Cta1p. The detection of HEX1 and Cta1p in the pellet fraction indicated that the
vps1Ddnm1D mutant remained import competent. (B, C) Density gradient centrifugation. The 25 000 g organellar pellets of (B)
BY4742vps1Ddnm1D and (C) BY4742vps1Ddnm1D expressing HEX1 were loaded on top of a linear sucrose gradient (30–60% w ⁄ w) and
subjected to centrifugation for 2 h at 38 000 g. Fractions (1 mL) were collected from the bottom (fraction 1) to the top (fraction 27) and
assayed by western blot for the distribution of HEX1, the peroxisomal marker proteins Fox3p and Pex13p.
A
B
C
Fig. 6. Ultrastructure of a BY4742vps1Ddnm1D mutant expressing HEX1. Cells were processed for electron microscopy after growth on
medium containing oleic acid as the sole carbon source for 14 h. (A) Typical morphology of a BY4742vps1Ddnm1D cell with large,
misshapen mitochondria. (B, C) Morphology upon expression of HEX1 in BY4742vps1Ddnm1D. Woronin-body-like structures were formed
that are still attached to peroxisomes. (B) One rectangular and one nearly hexagonal Woronin body are visible. (C) A rectangular Woronin
body with appended peroxisomal structures on both small sides. N, nucleus; M, mitochondria; Ld, lipid droplets; V, vacuole; P, peroxisomes;
Wb, Woronin-body-like structures. Bar = 5 lm.
C. Wu
¨
rtz et al. Heterologous Woronin body formation
FEBS Journal 275 (2008) 2932–2941 ª 2008 The Authors Journal compilation ª 2008 FEBS 2937
anti-HEX1 Ig, suggesting that the observed extensions
represent tubular peroxisomes attached to Woronin-
body-like objects. Thus, our study shows that HEX1-
containing organelles can emerge from peroxisomes in
yeast, in a process that depends on the typical peroxi-

somal fission machinery.
Discussion
The Woronin bodies of filamentous ascomycetes are
highly specialized organelles. They plug septal pores
after hyphal damage and protect the mycel from exces-
sive loss of cytoplasm. It is thought that the formation
of the core crystal of Woronin bodies occurs by self-
assembly of the HEX1 protein [1]. To analyze whether
additional specific factors of filamentous fungi are
needed for Woronin body formation we heterologously
expressed N. crassa HEX1 in S. cerevisiae. This led to
the Pex5p-dependent formation of giant Woronin-
body-like structures containing a stable HEX1 crystal
(Fig. 4). It is currently unclear why these impressing
structures were not observed previously in a similarly
designed experiment [1], but we theorize that Woronin-
body-like organelles only emerge above a threshold
expression level of HEX1.
The giant organelles exhibited a lower density than
genuine Woronin bodies from N. crassa. One reason
for the lower density of these Woronin-body-like struc-
tures might be the presence of trace amounts of peroxi-
somal matrix proteins. For example, evidence for the
appearance of some GFP-SKL or Cta1p was gathered
in several of our localization experiments. The density
of these structures could thereby be lowered without
prohibiting formation of the HEX1 crystal. In Asper-
gillus oryzae, formation of HEX1 multimers, and there-
fore crystal formation, was shown to depend on HEX1
phosphorylation via protein kinase C [2,20]. It is also

conceivable that the yeast kinase ortholog phosphory-
lates HEX1 inefficiently and as a consequence crystal
assembly is adversely affected. Without a doubt, bacte-
rially expressed HEX1 can spontaneously assemble to
crystals in vitro [1]. However, the in vitro crystals and
Woronin-body-like organelles detected in yeast exceed
the size of the Woronin bodies observed in living
hyphae of N. crassa. HEX1 may be capable of forming
large crystals without phosphorylation, but the crystal
packing might be different when HEX1 is phosphory-
lated. This would require solving the 3D structure
of phosphorylated HEX1 and comparing it with the
published structure of unphosphorylated HEX1 [19].
Separation of Woronin-body-like organelles from
peroxisomes was demonstrated in immunofluorescence
and electron microscopy images by the occasional
occurrence of intermediate structures harboring zones
of luminal material with distinct electron density, but
not yet separated by a membrane. Similar structures
have been seen in micrographs from the filamentous
fungus Fusarium oxysporum, revealing the formation
of an electron opaque matrix that buds off from
microbodies [7]. These intermediate structures were
predominant in a mutant yeast strain lacking the
dynamin-like proteins Dnm1p and Vps1p, which are
important players in the normal fission of peroxisomes
[11]. Immunofluorescence microscopy studies further
showed that co-localization of GFP-SKL and HEX1
occurs much more frequently in the vps1Ddnm1D
Fig. 7. Subcellular localization of HEX1, the

peroxisomal marker proteins GFP-SKL and
Pex14p in BY4742vps1Ddnm1D cells. Indi-
rect double immunofluorescence was used
with cells co-expressing HEX1 and GFP-SKL
or GFP-SKL alone. Detection was achieved
with mouse mAbs against GFP in combina-
tion with (A) rabbit anti-Pex14p and (B) rab-
bit anti-HEX1 serum. The secondary
antibodies used were Alexa Fluor 488-
labeled anti-mouse IgG and Alexa Fluor 594-
labeled anti-rabbit IgG, respectively. (A)
Single large GFP-SKL-stained peroxisomes
are visible. Upon heterologous expression of
HEX1 (B), GFP-SKL-stained spots with tail-
like extensions were discernible. The spots
but not the extensions were also decorated
by the anti-HEX1 serum. Bar = 5 lm.
Heterologous Woronin body formation C. Wu
¨
rtz et al.
2938 FEBS Journal 275 (2008) 2932–2941 ª 2008 The Authors Journal compilation ª 2008 FEBS
mutant than in the wild-type, in accordance with a
budding and detachment of Woronin-body-like organ-
elles from peroxisomes. This assumption gained further
weight by the appearance of extensions from double-
labeled spots that exclusively contained GFP-SKL.
The methods applied did not, however, allow us to
discern whether these tubular structures are indeed
interconnected or represent clustered peroxisomes. In
future studies, time-lapse microscopy will be needed to

directly show the emergence of HEX1-containing
organelles. Nonetheless, Vps1p and Dnm1p clearly con-
trolled the budding of Woronin-body-like organelles
from yeast peroxisomes and we thus suppose that both
proteins are also key players in Woronin body forma-
tion in filamentous fungi. A recent study by Liu et al.
revealed that N. crassa vps1 and dnm1 single mutants
were clearly compromised in peroxisomal fission,
whereas Woronin body formation was still feasible,
although the size and numbers of Woronin bodies were
reduced [21]. It will be interesting to see whether the
absence of both dynamin-like proteins prevents the
fission of Woronin bodies in filamentous fungi.
It is worth noting that in the vps1Ddnm1D strain,
HEX1 was almost exclusively localized to the organel-
lar pellet and exhibited a similar distribution in sucrose
density gradients as in the wild-type. This also held
largely true for Cta1p. Furthermore, the density of
peroxisomes remained unchanged in the vps1Ddnm1D
mutant, thereby indicating that an impaired fission
process does not significantly interfere with peroxi-
somal protein import.
Expressing HEX1 in the well-characterized model
organism S. cerevisiae could be a suitable tool to ana-
lyze the mechanism of peroxisome division in more
detail. Organellar budding can be easily followed by
imaging techniques due to the different morphology of
peroxisomes and Woronin bodies and, most impor-
tantly, is arrested at intermediate states in vps1Ddnm1D
deficient cells. The expression of dynamin-like proteins

from inducible promoters in the double-deletion strains
will allow studying the dynamic fission process in a
time-dependent manner.
Experimental procedures
Strains and culture conditions
For all plasmid amplifications and isolations Escherichia
coli strain DH5a was used (Invitrogen, Carlsbad, CA,
USA). The yeast wild-type strain BY4742 was used. The
strain BY4742pex5D was obtained from the EUROSCARF
strain collection (Frankfurt, Germany) and construction of
the double-deletion strain BY4742vps1Ddnm1D was as
described previously [11]. Transformation of yeast cells was
performed as described previously [22]. Media for the culti-
vation of yeast and bacterial strains were prepared
as described elsewhere [23,24]. N. crassa strain FGSC#987
(St. Lawrence 74-OR23-1A, mat A) was obtained from the
Fungal Genetics Stock Center (Kansas City, KS, USA).
Plasmids and cloning procedures
For heterologous expression in yeast, N. crassa HEX1 was
amplified from a N. crassa cDNA library using PCR with
primer pair RE951 (AAGAATTCATGGGCTACTACGA
CGAC) ⁄ RE952 (AACTCGAGTTAGAGGCGGGAACC
GTG) introducing recognition sites for EcoRI and XhoI
(obtained from MWG-BIOTECH AG, Ebersberg,
Germany). The resulting fragment was subcloned into
pBluescript SK(+) (Stratagene, La Jolla, CA, USA) for
sequencing purposes. The identity of the HEX1 fragment
was verified by automated sequencing (MWG-BIOTECH).
The insert was cloned as an EcoRI–XhoI fragment into
appropriately prepared pYPGE15 [25], designed for constit-

utive expression in S. cerevisiae.
Antibodies
Antibodies against GFP (BD Biosciences, Franklin Lakes,
NJ, USA), Pep12p (Molecular Probes, Eugene, OR, USA),
Kar2p [26], TIM23 [27], ICL1 [28], Cta1p [29], HEX1 [30],
Fox3p [31], Pex14p [31], Aac2p [32], and Pex13p [33] have
been described previously. SDS ⁄ PAGE and immuno-
blotting were performed according to standard protocols
[23]. Horseradish peroxidase-coupled anti-rabbit and anti-
mouse IgG, in combination with the ECLÔ system (GE
Healthcare, Munich, Germany), was used to detect immuno-
reactive complexes.
Subcellular fractionation
Preparation of PNS from S. cerevisiae cells and differential
centrifugation at 25 000 g were conducted as described pre-
viously [24]. Density gradient centrifugation was carried out
as described previously [34] with the modification that
instead of a PNS, a 100 000 g organellar pellet was loaded
on top of the gradients, and a 30–60% (w ⁄ w) sucrose den-
sity gradient with a 2 mL 65% sucrose cushion was used.
The preparation of a N. crassa PNS and the separation of
a 25 000 g organellar pellet by density gradient centri-
fugation has been described elsewhere [9].
Electron microscopy
The ultrastructure of yeast cells was studied with oleate-
induced cells that had been fixed with 1.5% KMnO
4
and
processed as described previously [24].
C. Wu

¨
rtz et al. Heterologous Woronin body formation
FEBS Journal 275 (2008) 2932–2941 ª 2008 The Authors Journal compilation ª 2008 FEBS 2939
Immunofluorescence microscopy
All light microscopy studies were performed with an Axio-
plan microscope and axiovision 4.6 software (Zeiss, Jena,
Germany) as described previously [35]. Antibodies and used
dilutions were as follows: N. crassa anti-HEX1 serum
(1 : 100), S. cerevisiae anti-Pex14p serum (1 : 500) and anti-
GFP IgG (1 : 100). The secondary antibodies applied were
obtained from Molecular Probes (Alexa Fluor 594 goat
anti-rabbit IgG and Alexa Fluor 488 goat anti-mouse IgG).
Acknowledgements
We thank F. Nargang for the N. crassa cDNA library
and M. Bu
¨
rger for technical assistance. This work was
supported by grants from the Deutsche Forschungs-
gemeinschaft (project B10 of SFB480) and by the
Fonds der Chemischen Industrie.
References
1 Jedd G & Chua N-H (2000) A new self-assembled per-
oxisomal vesicle required for efficient resealing of the
plasma membrane. Nat Cell Biol 2, 226–231.
2 Tenney K, Hunt I, Sweigard J, Pounder JI, McClain C,
Bowman EJ & Bowman BJ (2000) hex-1, a gene unique
to filamentous fungi, encodes the major protein of the
Woronin body and functions as a plug for septal pores.
Fungal Genet Biol 31, 205–217.
3 Buller AHR (1933) Researches in Fungi. Hafner, New

York, NY.
4 Woronin MS (1864) Zur Entwicklungsgeschichte des
Ascobolus pulcherrimus Cr. und einiger Pezizen. Abh
Senkenb Naturforsch Ges 5, 333–344.
5 Soundararajan S, Jedd G, Li X, Ramos-Pamplona M,
Chua NH & Naqvi NI (2004) Woronin body function
in Magnaporthe grisea is essential for efficient pathogen-
esis and for survival during nitrogen starvation stress.
Plant Cell 16, 1564–1574.
6 Simon UK, Bauer R, Rioux D, Simard M & Oberwin-
kler F (2005) The vegetative life-cycle of the clover
pathogen Cymadothea trifolii as revealed by transmis-
sion electron microscopy. Mycol Res 109, 764–778.
7 Wergin WP (1973) Development of Woronin bodies
from microbodies in Fusarium oxysporum f. sp. lycoper-
sici. Protoplasma 76, 249–260.
8 Tey WK, North AJ, Reyes JL, Lu YF & Jedd G (2005)
Polarized gene expression determines Woronin body
formation at the leading edge of the fungal colony. Mol
Biol Cell 16, 2651–2659.
9 Managadze D, Wu
¨
rtz C, Sichting M, Niehaus G,
Veenhuis M & Rottensteiner H (2007) The peroxin
PEX14 of Neurospora crassa is essential for the biogene-
sis of both glyoxysomes and Woronin bodies. Traffic 8,
687–701.
10 Hoepfner D, van den Berg M, Philippsen P, Tabak
HF & Hettema EH (2001) A role for Vps1p, actin,
and the Myo2p motor in peroxisome abundance and

inheritance in Saccharomyces cerevisiae. J Cell Biol
155, 979–990.
11 Kuravi K, Nagotu S, Krikken AM, Sjollema K,
Deckers M, Erdmann R, Veenhuis M & van der Klei IJ
(2006) Dynamin-related proteins Vps1p and Dnm1p
control peroxisome abundance in Saccharomyces cerevi-
siae. J Cell Sci 119, 3994–4001.
12 Erdmann R & Blobel G (1995) Giant peroxisomes in
oleic acid-induced Saccharomyces cerevisiae lacking the
peroxisomal membrane protein Pmp27p. J Cell Biol
128, 509–523.
13 Marshall PA, Krimkevich YL, Lark RH, Dyer JM,
Veenhuis M & Goodman JM (1995) Pmp27 promotes
peroxisomal proliferation. J Cell Biol 129, 345–355.
14 Schrader M, Reuber BE, Morrell JC, Jimenez-Sanchez
G, Obie C, Stroh TA, Valle D, Schroer TA & Gould SJ
(1998) Expression of PEX11beta mediates peroxisome
proliferation in the absence of extracellular stimuli.
J Biol Chem 273, 29607–29614.
15 Smith JJ, Marelli M, Christmas RH, Vizeacoumar FJ,
Dilworth DJ, Ideker T, Galitski T, Dimitrov K, Rachu-
binski RA & Aitchison JD (2002) Transcriptome profil-
ing to identify genes involved in peroxisome assembly
and function. J Cell Biol 158, 259–271.
16 Rottensteiner H, Stein K, Sonnenhol E & Erdmann R
(2003) Conserved function of Pex11p and the novel
Pex25p and Pex27p in peroxisome biogenesis. Mol Biol
Cell 14, 4316–4328.
17 Tam YY, Torres-Guzman JC, Vizeacoumar FJ, Smith
JJ, Marelli M, Aitchison JD & Rachubinski RA (2003)

Pex11-related proteins in peroxisome dynamics: a role
for the novel peroxin Pex27p in controlling peroxisome
size and number in Saccharomyces cerevisiae. Mol Biol
Cell 14, 4089–4102.
18 Trinci A & Collinge AJ (1974) Occlusion of the septal
pores of damaged hyphae of Neurospora crassa by
hexagonal crystals. Protoplasma 80, 57–67.
19 Yuan P, Jedd G, Kumaran D, Swaminathan S, Shio H,
Hewitt D, Chua N-H & Swaminathan K (2003) A
HEX-1 crystal lattice required for Woronin body func-
tion in Neurospora crassa. Nat Struct Mol Biol 10, 264–
270.
20 Juvvadi P, Maruyama J & Kitamoto K (2007) Phos-
phorylation of the Aspergillus oryzae Woronin body
protein, AoHex1, by protein kinase C: evidences for
its role in the multimerization and proper localization
of the Woronin body protein. Biochem J 405, 533–
540.
21 Liu F, Ng SK, Lu Y, Low W, Lai J & Jedd G (2008)
Making two organelles from one: Woronin body bio-
genesis by peroxisomal protein sorting. J Cell Biol 180,
325–339.
Heterologous Woronin body formation C. Wu
¨
rtz et al.
2940 FEBS Journal 275 (2008) 2932–2941 ª 2008 The Authors Journal compilation ª 2008 FEBS
22 Schiestl R & Gietz R (1989) High efficiency transforma-
tion of intact yeast cells using single stranded nucleic
acids as a carrier. Curr Genet 16, 339–346.
23 Sambrook J, Fritsch E & Maniatis T (1989) Molecular

Cloning: A Laboratory Manual. Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, NY.
24 Erdmann R, Veenhuis M, Mertens D & Kunau W
(1989) Isolation of peroxisome-deficient mutants of
Saccharomyces cerevisiae. Proc Natl Acad Sci USA 86,
5419–5423.
25 Brunelli J & Pall M (1993) A series of yeast shuttle
vectors for expression of cDNAs and other DNA
sequences. Yeast 9, 1299–1308.
26 Rose MD, Misra LM & Vogel JP (1989) KAR2, a kary-
ogamy gene, is the yeast homolog of the mammalian
BiP ⁄ GRP78 gene. Cell 57, 1211–1221.
27 Mokranjac D, Paschen S, Kozany C, Prokisch H, Hop-
pins S, Nargang F, Neupert W & Hell K (2003) Tim50,
a novel component of the TIM23 preprotein translocase
of mitochondria. EMBO J 22, 816–825.
28 Maeting I, Schmidt G, Sahm H, Revuelta J, Stierhof Y
& Stahmann K (1999) Isocitrate lyase of Ashbya gos-
sypii – transcriptional regulation and peroxisomal local-
isation. FEBS Lett 444, 15–21.
29 Gurvitz A, Rottensteiner H, Kilpelainen S, Hartig A,
Hiltunen J, Binder M, Dawes I & Hamilton B (1997)
The Saccharomyces cerevisiae peroxisomal 2,4–dienoyl-
CoA reductase is encoded by the oleate-inducible gene
SPS19. J Biol Chem 272, 22140–22147.
30 Schliebs W, Wu
¨
rtz C, Kunau W, Veenhuis M &
Rottensteiner H (2006) A eukaryote without catalase-
containing microbodies: Neurospora crassa exhibits a

unique cellular distribution of its four catalases. Eukary-
otic Cell 5, 1490–1502.
31 Erdmann R & Kunau W (1994) Purification and immu-
nolocalization of the peroxisomal 3–oxoacyl-CoA thio-
lase from Saccharomyces cerevisiae. Yeast 10, 1173–1182.
32 Palmieri L, Rottensteiner H, Girzalsky W, Scarcia P,
Palmieri F & Erdmann R (2001) Identification and
functional reconstitution of the yeast peroxisomal ade-
nine nucleotide transporter. EMBO J 20, 5049–5059.
33 Erdmann R & Blobel G (1996) Identification of Pex13p
a peroxisomal membrane receptor for the PTS1 recogni-
tion factor. J Cell Biol 135, 111–121.
34 Scha
¨
fer A, Kerssen D, Veenhuis M, Kunau WH &
Schliebs W (2004) Functional similarity between the
peroxisomal PTS2 receptor binding protein Pex18p and
the N–terminal half of the PTS1 receptor Pex5p. Mol
Cell Biol 24, 8895–8906.
35 Girzalsky W, Rehling P, Stein K, Kipper J, Blank L,
Kunau W & Erdmann R (1999) Involvement of Pex13p
in Pex14p localization and peroxisomal targeting signal
2-dependent protein import into peroxisomes. J Cell
Biol 144, 1151–1162.
C. Wu
¨
rtz et al. Heterologous Woronin body formation
FEBS Journal 275 (2008) 2932–2941 ª 2008 The Authors Journal compilation ª 2008 FEBS 2941