Báo cáo khoa học: Characterization of a hemocyte intracellular fatty acid-binding protein from crayfish (Pacifastacus leniusculus) and shrimp (Penaeus monodon) pdf

Characterization of a hemocyte intracellular fatty
acid-binding protein from crayfish (Pacifastacus
leniusculus) and shrimp (Penaeus monodon)
Irene So
¨
derha
¨
ll
1
, Amornrat Tangprasittipap
1,2,3
, HaiPeng Liu
1
, Kallaya Sritunyalucksana
2
,
Poonsuk Prasertsan
3
, Pikul Jiravanichpaisal
1,4
and Kenneth So
¨
derha
¨
ll
1
1 Department of Comparative Physiology, Evolutionary Biology Centre, Uppsala University, Sweden
2 CENTEX shrimp ⁄ BIOTEC, Faculty of Science, Mahidol University, Thailand
3 Department of Industrial Biotechnology Faculty of Agro-Industry, Prince of Songkla University, Songkla, Thailand
4 BIOTEC, National Science and Technology Development Agency (NSTDA), Pathomthani, Thailand
Uptake and translocation of hydrophobic ligands are

fundamental for all living cells, and are accomplished
by members of the lipid-binding protein superfamily
(LBP). This superfamily includes the fatty acid-binding
proteins (FABPs), the cellular retinoic acid-binding
proteins (CRABPs), the cellular retinol-binding pro-
teins (CRBPs), P2 myelin proteins, adipocyte LBP,
and mammary-derived growth inhibitors, all of which
are intracellular and extracellular low-molecular-mass
proteins that bind a wide range of hydrophobic ligands
[1]. The FABPs are intracellular proteins and are pre-
sent in both vertebrates and invertebrates. Whereas the
presence and binding specificity of FABPs, CRABPs
and CRBPs are well established in vertebrates, the
binding specificity of very few invertebrate intracellular
LBPs has been investigated in detail. So far, fatty acid
Keywords
all-trans retinoic acid; crustaceans; fatty
acid-binding protein; hemocyte; retinoic acid-
binding protein
Correspondence
I. So
¨
derha
¨
ll, Department of Comparative
Physiology, Evolutionary Biology Centre,
Uppsala University, Norbyva
¨
gen 18A,
Uppsala 75236, Sweden

Fax: +46 18 4716425
Tel: +46 18 4712817
E-mail:
Website: />index.html
(Received 29 March 2006, revised 27 April
2006, accepted 2 May 2006)
doi:10.1111/j.1742-4658.2006.05303.x
Intracellular fatty acid-binding proteins (FABPs) are small members of the
superfamily of lipid-binding proteins, which occur in invertebrates and ver-
tebrates. Included in this superfamily are the cellular retinoic acid-binding
proteins and retinol-binding proteins, which seem to be restricted to verte-
brates. Here, we report the cDNA cloning and characterization of two
FABPs from hemocytes of the freshwater crayfish Pacifastacus leniusculus
and the shrimp Penaeus monodon. In both these proteins, the binding triad
residues involved in interaction with ligand carboxylate groups are present.
From the sequence and homology modeling, the proteins are probably
FABPs and not retinoic acid-binding proteins. The crayfish transcript
(plFABP) was detected at high level in hemocytes, hepatopancreas, intes-
tine and ovary and at low level in hematopoietic tissue and testis. Its
expression in hematopoietic cells varied depending on the state of the cray-
fish from which it was isolated. Expression was 10–15 times higher in cul-
tures isolated from crayfish with red colored plasma, in which hemocyte
synthesis was high, if retinoic acid was added to the culture medium. In
normal colored crayfish, with normal levels of hemocytes, no increase in
expression of p1FABP was detected. Two other putative plFABP ligands,
stearic acid and oleic acid, did not have any effect on plFABP expression
in hematopoietic cells. These results suggest that retinoic acid-dependent
signaling may be present in crustaceans.
Abbreviations
ATRA, all-trans retinoic acid; CPBS, crayfish phosphate buffered saline; CRABP, cellular retinoic acid-binding protein; CRBP, cellular retinol-

binding protein; FABP, fatty acid-binding protein; hpt, hematopoietic tissue; LBP, lipid-binding protein; RA, retinoic acid; RARE, retinoic acid-
responsive element; RXR, retinoid-X receptor.
2902 FEBS Journal 273 (2006) 2902–2912 ª 2006 The Authors Journal compilation ª 2006 FEBS
binding to LBPs has been demonstrated in the insects
Schistocerca gregaria [2] and Locusta migratoria [3]. A
recombinant putative CRABP (AAL68638) from the
shrimp Metapenaeus ensis has been shown to bind reti-
noic acid (RA) and retinal [4], and another recombin-
ant putative CRABP from Manduca sexta [5] has been
found to bind saturated as well as unsaturated fatty
acid, but not RA [6]. The 3D structure of vertebrate
LBPs is highly conserved, with a 10-stranded b-barrel
structure forming a cavity in which hydrophobic lig-
ands are bound. Binding of RA as well as of many
fatty acids requires interaction with the side chains of
a characteristic triad of conserved amino-acid residues
in the ligand-binding hollow, but it is not possible to
predict the binding specificity of the protein in ques-
tion based on the presence of this triad [6].
RA is an important modulator of embryonic develop-
ment, vision, maintenance of epithelial differentiation,
immune functions, and reproduction in vertebrates [7].
In vertebrates the parent vitamin A molecule, all-trans-
retinol, circulates in blood bound to serum retinol-
binding protein. Inside cells, all-trans-retinol and its
oxidation product (all-trans-retinal) are associated with
the cellular retinol-binding proteins (CRBP-I and
CRBP-II). All trans-retinoic acid (ATRA) is found
intracellularly bound to one of the two isoforms of reti-
noic acid-binding proteins, CRABP-I and CRABP-II

[8]. Normally, micromolar concentrations of RA and
nanomolar concentrations of retinol are present in
human plasma [9]. RA is transported inside the cell to
the nucleus [10]. In the nucleus, it exerts its effect on the
target cells by activating the RA receptors. These recep-
tors contain conserved domains that bind to specific
DNA sequences termed RA-response elements
(RAREs), and function to enhance or reduce gene tran-
scription [7,11]. In invertebrates, only a few CRABPs
have been characterized and the first one cloned was
cDNA of msCRABP isolated from the tobacco horn-
worm M. sexta. This protein shows a high degree of
similarity in the ligand-binding pocket to bovine and
human CRABP [5]. However, recent ligand-binding
studies with recombinant msCRABP showed high affin-
ity binding for fatty acids and negligible interaction
with RA and other retinoids, and hence this protein
may be a FABP rather than a CRABP [6]. Binding
studies of another putative arthropod CRABP, from
the shrimp Metapenaeus ensis (recombinant meCRABP
[4]) revealed binding of ATRA and retinol to this pro-
tein. However, as high concentrations of these ligands
were needed for binding and no binding studies with
other fatty acids were performed, the presence of true
CRABPs in invertebrates is still not conclusively
demonstrated.
The FABPs are intracellular low-molecular-mass
(14–15 kDa) proteins capable of binding long-chain
fatty acids. FABPs in vertebrates have been studied in
detail for more than three decades, and crystallography

and NMR studies have revealed the tertiary structure
of a large number of vertebrate FABPs [1]. FABPs in
invertebrates were first identified in the desert locust
S. gregaria, and now the number identified is  30
[12]. However, the physiological role of these proteins
and their binding specificities are still largely unknown.
Sequence identities between vertebrate and invertebrate
FABPs are in general low, although the known crystal-
lographic structure of invertebrate FABPs shows the
consensus b-barrel structure found in vertebrates [12].
Vertebrate FABPs are involved in cellular fatty acid
transport and utilization and compartmentalization of
intracellular fatty acid storage, and also in fatty acid-
induced regulation of gene expression (for review, see
[1]). However, the biochemical role of these proteins in
immunity is not well understood. Expression of epider-
mal FABPs has been demonstrated in mouse perito-
neal macrophages, human macrophages obtained by
in vitro differentiation of monocytes, several cell lines
derived from monocytes and macrophages [13], alveo-
lar macrophages [14] as well as in dendritic cells of the
spleen [15]. Epidermal FABP has been found to be
specifically up-regulated in monocytes involved in allo-
graft destruction [16].
In this study, we characterized an arthropod FABP
isolated from hemocytes of the freshwater crayfish
Pacifastacus leniusculus and cloned the cDNA coding
for a similar FABP from hemocytes of the penaeid
shrimp Penaeus monodon.
Results

Analysis of sequence and structure
An  560-bp hemocyte EST was obtained from the
P. leniusculus EST library (clone number HC 246-563;
DataBank accession number CF542599). By using a
combination of PCR-based techniques, this partial
cDNA was amplified from hemocyte RNA. The full
cDNA sequence is named Pacifastacus leniusculus
FABP or plFABP. Crayfish plFABP consists of an
ORF encoding a 132-amino-acid protein and one puta-
tive polyadenylation signal site (ATTAA) (Fig. 1A).
The deduced protein is  15 kDa in size, similar to
those of other RA-binding protein or FABP family
members.
The cDNA encoding a similar protein was isolated
from a P. monodon hemocyte cDNA library using
degenerated primers. The deduced amino-acid sequence
I. So
¨
derha
¨
ll et al. Crayfish intracellular fatty acid-binding protein
FEBS Journal 273 (2006) 2902–2912 ª 2006 The Authors Journal compilation ª 2006 FEBS 2903
A
B
Fig. 1. Nucleotide sequence and deduced
amino-acid sequence of plFABP and
pmFABP. (A) P. leniusculus FABP cDNA
nucleotide and putative amino-acid
sequence. The putative polyadenylation sig-
nal site is underlined. The three amino-acid

residues (Arg107, Arg127, Tyr129) of the P2
motif characteristic of RA-binding proteins
and FABPs are shown in bold and under-
lined. (B) P. monodon FABP cDNA nucleo-
tide and putative amino-acid sequence. The
three amino-acid residues (Arg110, Arg130,
Tyr132) of the P2 motif characteristic of the
RA-binding proteins and FABPs are shown
in bold and underlined.
Crayfish intracellular fatty acid-binding protein I. So
¨
derha
¨
ll et al.
2904 FEBS Journal 273 (2006) 2902–2912 ª 2006 The Authors Journal compilation ª 2006 FEBS
of pmFABP is 136 amino acids long (Fig. 1B). Amino-
acid alignment of various FABP sequences shows that
crayfish FABP is most closely related to pmFABP
(72% amino acid similarity), and this pmFABP
sequence is nearly identical (88% identity, 5% similar-
ity) with meCRABP and the Litopenaeus vannamei
dbEST CK570804 sequence (Fig. 2). plFABP shares
high sequence identity with the Manduca protein
(msCRABP, AAC24317) and also with other arthropod
FABPs [6]. The amino-acid sequence of plFABP, as well
as that of pmFABP, shows identity with vertebrate
CRABPs and FABPs of 35–45% and similarity of 20–
25%, some of which are shown in Fig. 2. However,
comparison of sequences as such does not give any
information about the binding specificity of these two

crustacean FABPs. The crayfish and shrimp sequences
contain the essential three amino acids R ⁄ R ⁄ Y (in cray-
fish Arg107, Arg127 and Tyr129) of the P2 motif con-
sidered important for binding ATRA in vertebrates, but
they are also important in the binding of some fatty
acids [17–20]. Vertebrate CRABPs usually have a tryp-
tophan residue two amino acids before the first R
(marked in Fig. 2) in the P2 motif, whereas in plFABP
there is a polar tyrosine residue (as in Manduca), and in
shrimp FABP a leucine is at this position. CRABPs
usually have a longer 2nd a-helix compared to FABPs
shown in Fig. 2 by the two gaps before Pro38, and we
therefore consider the crustacean proteins to be FABPs.
A better homology model was obtained by super-
imposing the plFABP sequence on vertebrate FABPs
(Fig. 3A,B) compared with vertebrate CRABPs
(Fig. 3C,D). Only one region covering four amino acids
(Asn100–Lys103) has low confidence (shown in red in
Fig. 3B) in the FABP-based model compared with four
regions in the CRABP-based model.
FABP gene expression and localization
We isolated plFABP cDNA from hemocyte RNA and
analyzed the tissue distribution of plFABP mRNA.
Fig. 2. Amino-acid sequence alignment of plFABP and pmFABP with various invertebrate and human (hs) FABPs and CRABPs. Alignment
shows the following sequences: plFABP (BankIt accession 800194), pmFABP (BankIt accession 789217), meCRABP (AAL68638), msCRABP
(AAC24317), hsFABPb (1FDQb), hsFABPb (1JJXa), hsCRABP1 (NP_00469), hsCRABP2 (NP_001869). plFABP shows identity ⁄ similarity of
51% ⁄ 21% to pmFABP, 50% ⁄ 22% to meCRABP, 45% ⁄ 16% to msCRABP, 38% ⁄ 23% to hsFABPb_1FDQb, 38% ⁄ 22% to hsFABPb_1JJXa,
41% ⁄ 23% to hsCRABP1, and 39% ⁄ 23% to hsCRABP2. Note the gap in front of Pro38 in all FABPs showing a longer 2nd a-helix in CRABPs.
Fig. 3. Molecular modeling of plFABP using human FABP and
CRABP-I as templates. (A) plFABP superimposed on the X-ray crys-

tal structure of human brain FABP (1fdqA, 1fdqB) and colored by
secondary structure succession from blue to red. (B) plFABP super-
imposed as in (A) and colored by confidence, where high confid-
ence is towards blue in the spectrum. (C) plFABP superimposed on
human CRABP (|pbd|1cbp|, |pbd|2cbr|) and colored by secondary
structure succession from blue to red. (D) plFABP superimposed as
in (C) and colored by confidence, where high confidence is towards
blue in the spectrum.
I. So
¨
derha
¨
ll et al. Crayfish intracellular fatty acid-binding protein
FEBS Journal 273 (2006) 2902–2912 ª 2006 The Authors Journal compilation ª 2006 FEBS 2905
Based on RT-PCR analysis, a strong plFABP signal
was detected in hemocytes, hepatopancreas, intestine
and ovary, whereas in hpt and testis, FABP expression
was low, and in eyestalk and muscle no signal at all
could be detected (Fig. 4A). A similar result was
achieved by northern blot analysis, which showed that
the amount of plFABP transcript was very high in
hemocytes, hepatopancreas and intestine, and barely
detectable in eyestalk and muscle cells (Fig. 4B). How-
ever, in hpt the low expression found by RT-PCR was
not confirmed by northern blot (Fig. 4B). This differ-
ence may indicate that some mature hemocytes were
mixed with the hpt cells, and the more sensitive
RT-PCR was able to detect hemocyte plFABP mRNA
in the hpt sample. To see if this was the case, we per-
formed in situ hybridization experiments with hpt cells,

which were examined under the microscope for the
presence of hemocytes before the assay. In situ hybrid-
ization experiments were performed using dioxigenin-
labeled cDNA probes for plFABP. Fluorescence of the
plFABP signal was detected in hemocytes as well as in
hpt cells, and the granular cells showed a very strong
signal (Fig. 4C). From these experiments, it was obvi-
ous that several hpt cells did express plFABP, but at a
lower level than the hemocytes. Moreover, the fraction
of hpt cells expressing plFABP varied a lot between
different animals: in some animals expression was high
and in some very low.
Treatment of hpt cells with putative ligands
in vitro
As there was large variation in plFABP expression in
hpt cells, we assessed the effect of different putative
ligands for the plFABP protein on hpt cells in vitro.
Hpt cell cultures were initiated and then cultured for
48 h. Different concentrations of ATRA, oleic acid or
stearic acid were then added to the medium, and the
morphology of the cells was observed every day. After
7 days, plFABP expression was compared. As shown
in Fig. 5A–D, cell spreading was affected slightly after
culture in the presence of ATRA at a concentration of
10 nm or higher, whereas no obvious change was
observed with the other fatty acids. Interestingly, lipid
droplet formation, as judged by oil red staining, was
observed in hpt cells cultured with an unsaturated fatty
acid (oleic acid), but not in those cultured with stearic
acid (a saturated fatty acid) or ATRA (Fig. 5E–G).

Lipid droplet formation was always observed in the
presence of oleic acid at concentrations of 0.1–1.0 mm,
whereas the changes in spreading in the presence of
ATRA were more variable. Because of variable results,
we investigated some characteristics of the individual
crayfish from which the hpt cells were isolated. We
divided the crayfish into two different groups accord-
ing to the color of the hemolymph and called these
groups CN (for normal color) and CR (for red color)
(Fig. 6, absorbance peak between 450 and 520 nm). In
normal colored crayfish, the total number of hemo-
cytes was 0.6 (±0.2) · 10
6
(n ¼ 5), whereas in the red
colored crayfish, it was 3.1 (±0.9) · 10
6
(n ¼ 5), per
ml hemolymph, indicating that hemocyte synthesis is
higher in crayfish with red colored plasma. Further-
more, the clotting reaction was much more rapid in
crayfish with red plasma, clotting occurring within
5 min compared with several hours in normal colored
crayfish. The crayfish with red plasma usually had a
thick hpt, which again implies a higher hemocyte
count and thus higher hemocyte synthesis than normal
colored crayfish. Therefore, we speculated that the
A
B
C
Fig. 4. Expression of plFABP in different tissues analyzed by

RT-PCR, northern blot and in situ hybridization. (A) RT-PCR analysis
of plFABP expression. Total RNA was extracted from the hemocyte
(HC), hematopoietic tissue (HPT), hepatopancreas (Hep), muscle
(Mu), eyestalk (ES), intestine (Int), testis (Tes), and ovary (Ova) of
P. leniusculus. Primers specific for plFABP were designed to
amplify a 566-bp fragment. RT was omitted from the control reac-
tion to ensure that the amplified band is derived from RNA. (B) Nor-
thern blot analysis of the crayfish CRABP transcript. Total RNA
extracted from hemocyte (HC), hematopoietic tissue (HPT), intes-
tine (Int), eyestalk (Eye), muscle (Mu), testis (Tes), and hepatopan-
creas (Hep) of P. leniusculus hemocytes and electrophoretically
separated on 1% agarose gel and then blotted on to nylon mem-
brane. The blot was hybridized with a probe corresponding to
plFABP or pl 40S ribosome as an internal control. (C) In situ hybrid-
ization in granular cells (G), semigranular cells (SG), and hematopoi-
etic tissue cells (HPT) using a dioxigenin-labeled plFABP cDNA
probe.
Crayfish intracellular fatty acid-binding protein I. So
¨
derha
¨
ll et al.
2906 FEBS Journal 273 (2006) 2902–2912 ª 2006 The Authors Journal compilation ª 2006 FEBS
hematopoietic process may be more active in these
crayfish. We, therefore, tested whether exogenous fatty
acids or ATRA could affect plFABP mRNA expres-
sion in cultured hpt cells from the CN and CR groups.
Whereas no difference was observed on the addition of
the two fatty acids (Fig. 7), a dramatic effect was
achieved by the addition of ATRA at 100 nm.As

shown in Fig. 7, there was a 13-fold increase in
plFABP expression in hpt cells isolated from the CR
group after ATRA treatment, whereas in the control
group (CN) no change in expression was found
(Fig. 7).
Discussion
FABPs belong to a large superfamily of low-
molecular-mass, small cytosolic lipid-binding proteins
responsible for the binding of RA and ⁄ or fatty acid
molecules. The biological roles of these proteins span
over a wide range of processes such as transport, cellu-
lar uptake and cytoplasmic trafficking of fatty acids,
and modulation of the amount of RA available to
nuclear receptors [1,20]. FABPs are found intracellu-
larly in vertebrates as well as in invertebrates, but the
Fig. 5. Hpt cells cultured for 2 days in the presence of putative plFABP ligands. (A) Control; (B) ATRA 1 nM; (C) ATRA 10 nM; (D) ATRA
100 n
M. (E–G) Hpt cells stained with oil red to detect lipid, counterstained with methyl green. (E) Stearic acid 0.3 mM; (F) oleic acid 0.3 mM;
(G) ATRA 100 n
M.
Fig. 6. Absorbance spectrum from 400 to 800 nm of plasma from
different crayfish. Solid line, absorption of plasma with red color;
dashed line, absorption of plasma with normal color.
Fig. 7. plFABP mRNA relative expression induced with putative lig-
ands in vitro, analyzed by real-time RT-PCR. Expression of plFABP
in hpt cultures after 7 days in the presence of 0.5 m
M oleic acid,
0.5 m
M stearic acid or 100 nM ATRA. CR, hpt cultures from crayfish
with red plasma; CN, from crayfish with normal plasma.

I. So
¨
derha
¨
ll et al. Crayfish intracellular fatty acid-binding protein
FEBS Journal 273 (2006) 2902–2912 ª 2006 The Authors Journal compilation ª 2006 FEBS 2907
presence of CRABPs in invertebrates has not been
conclusively demonstrated [6].
We report for the first time the presence of a FABP
in invertebrate hemocytes and hpt, and that the expres-
sion of this protein can be modulated by external addi-
tion of ATRA. However, our data do not support the
existence of CRABPs in invertebrates, as our sequence
analysis and 3D structural modeling clearly show that
the crayfish and shrimp FABPs do not possess the
characteristics of vertebrate CRABPs, although they
express the conserved R ⁄ R ⁄ Y of the P2 motif. FABPs
isolated from the same tissue, from different vertebrate
species, consistently display sequence identities higher
than 70%, whereas FABPs from different tissues of
a given species share identities as low as 20%, and
plFABP shows  30–45% identity with vertebrate
FABPs [1].
Our new crustacean FABPs show high similarity to
other invertebrate FABPs, although the tissue distribu-
tion is different from that of the shrimp M. ensis
CRABP transcript, which according to the sequence
is probably a FABP. plFABP was highly expressed
in the hepatopancreas and hemocytes, whereas in
M. ensis no expression was found in the hepatopancre-

as [4]. The opposite result to that reported in this
paper was obtained for the eyestalk: expression in
shrimp eyestalk was fairly high, whereas expression in
crayfish eyestalk was absent [4].
In M. ensis, the ovaries at the early and late stages
of vitellogenesis display similar high levels of mRNA
transcripts, and we also found high plFABP expression
in the ovaries of crayfish, indicating a role for these
FABPs in gonadal maturation. The presence of FABP
in the early larval stages of shrimp (M. ensis) also sug-
gests that this protein may be involved in early larval
development [4].
So far no role has been indicated for FABPs in
invertebrate immunity or hematopoiesis. In vertebrate
immunity, the function of different FABPs is not
clearly understood, although several FABPs are
expressed in immune active cells [14]. Long-chain fatty
acids also regulate gene transcription via FABPs by
activating nuclear peroxisome proliferator-activated
receptors, which are essential for induction of differen-
tiation in some cell types [21].
RA, the biologically active metabolite of vitamin A,
regulates the patterning and development of many
vertebrate organs [22–24], and also exerts a wide range
of effects on both normal and malignant hematopoietic
cells [25,26]. However, in invertebrates (or nonchor-
dates), no clear evidence exists for the presence of a
RA signaling pathway [23], although in our work an
effect of externally added ATRA was found, clearly
indicating that some sort of RA signaling exists. In

another crustacean, the fiddler crab Uga pugilator,
endogenous retinoids have been isolated from the limb
blastema [27], and external addition of RA to the crab
during limb regeneration was also shown to induce
malformation and slow growth [28]. Moreover, expres-
sion of retinoid-X receptor (UpRXR) was increased
after treatment with RA in the fiddler crab during limb
regeneration [29]. RXR is a heterodimeric receptor that
can bind RA receptor but also other nuclear receptor
proteins. Although RA receptor can bind ATRA and
9-cis RA, after dimerization with RXR, RXR in verte-
brates can only bind 9-cis RA. RXR homologs have
been described in insects, and the Drosophila homolog
ultraspiracle forms heterodimers with the ecdysone
receptor and is unable to bind RA [23]. However,
although the fiddler crab UpRXR shares high similarity
in its DNA binding domain to insect ultraspiracles, its
ligand-binding domain is more closely related to verteb-
rate RXRs [29]. Recent results also show that UpRXR
occurs in several different splicing variants, indicating
that more has to be learned about these receptor pro-
teins before a lack of RA signaling in invertebrates can
be ruled out [30]. In Ciona intestinalis, more than 20
genes have been shown to be up-regulated in the
embryo by RA treatment, and in M. sexta a RARE-
like motif has been found in the 5¢ regulatory region of
the msCRABP (AAC24317) gene [5]. Whether similar
RA-dependent regulatory sequences are present in the
promoter region of plFABP and whether the effect of
external RA mimics some endogenous substance still

has to be investigated in crayfish. Externally added
ATRA was only effective in hpt cells isolated from
crayfish with red hemolymph. Crayfish with red plasma
had both a high number of hemocytes and rapid clot-
ting ability compared with crayfish with normal colored
plasma, indicating that they have higher hemocyte syn-
thesis and a more rapid clotting system. We have previ-
ously shown that, in a high-density lipoprotein, the
b1,3-glucan-binding protein present in plasma,  1.6%
of its total lipids is carotenoids, and a low density lipo-
protein, the clotting protein, is pink–orange in color
[31,32]. Therefore these proteins may contribute to the
increase in red color of the plasma. However, in the
pacific white shrimp Litopenaeus vannamei, red hemo-
lymph in combination with decreased clotting ability
was detected after infection with Taura syndrome virus
[33]. In kuruma prawn, Metapenaeus japonicus, the
hemolymph turned red after injection with a toxic ser-
ine proteinase isolated from the pathogen Vibrio algino-
lyticus [34]. If crayfish with red colored plasma respond
to ATRA by greatly increased expression of plFABP,
this may indicate that this FABP is involved in
Crayfish intracellular fatty acid-binding protein I. So
¨
derha
¨
ll et al.
2908 FEBS Journal 273 (2006) 2902–2912 ª 2006 The Authors Journal compilation ª 2006 FEBS
hemocyte synthesis, as hemocyte numbers are higher in
these crayfish. However, more experiments are needed

to conclusively explain the physiological relevance of
this ATRA-induced plFABP expression.
In conclusion, there is still no evidence for true
RA-regulated gene expression in invertebrate animals.
Although no substrate-binding experiments were per-
formed on purified native or recombinant plFABP in
this study, our data give some support to the idea that
a RA signaling pathway is likely to be present in crus-
taceans, and this pathway may be more active during
stress.
Experimental procedures
Experimental animals
Freshwater crayfish, P. leniusculus, were purchased from
Nils Fors, Torsa
˚
ng at Lake Va
¨
ttern, Sweden and were
maintained in tanks with aerated running water at 10 °C.
Only intermolt crayfish were used in this study.
Cloning of crayfish and shrimp FABP cDNA
An EST sequence of crayfish FABP was found in a P. len-
iusculus hemocyte EST library. Several sets of gene-specific
primers based on the crayfish EST sequence were designed
for 5¢-RACE and 3¢-RACE. First-strand cDNA was syn-
thesized from 4 lg total RNA-3¢-RACE System for Rapid
Amplification of cDNA Ends kit (Invitrogen, Carlsbad,
CA, USA), using an oligo-dT-adapter primer. An initial
amplification by PCR was carried out with specific F7-
FABP (5¢-AGGGACAAGCTTATCCAGACGCAG-3¢)as

sense primer and AUAP as antisense primer, under the fol-
lowing conditions: a first step of 3 min at 94 °C was fol-
lowed by 35 cycles of 30 s at 92 °C, 30 s at 55 °C and
1 min at 72 °C, and 72 °C for 7 min. The nested PCR was
performed with specific F106-FABP (5¢-GATGGCGTG
GTGTCCAAGCGTATC-3¢) as sense primer and abridged
universal amplification primer (AUAP) as antisense primer
with a 10-fold dilution of the 1st PCR as the template,
under the same conditions.
For 5¢-RACE, first-strand cDNA (4 lg total RNA) was
synthesized by reverse transcription. Thermoscript
tm
reverse
transcriptase and 0.5 lm oligo(dT)
20
or 5¢-AAAGTAGCA
ATGGCAGCAACA-3¢ (reverse, R191-FABP) primer were
allowed to react for 1 h at 50 °Cin20lL reaction mixture
containing 1 mm dNTP and 5 mm dithiothreitol in first-
strand buffer. The cDNA was purified using a QIAquick
PCR purification kit (Qiagen, Hilden, Germany). To
anchor the PCR product at the 5¢ end, cDNA was tailed
for 10 min at 37 °C using 15 units of terminal deoxynucle-
otidyl transferase (Promega, San Diego, CA, USA) and
200 lm dCTP. To amplify the 5¢-mRNA ends of crayfish
FABP, we used a series of FABP-specific primers as fol-
lows: 5¢-CTCAGAGGACTCGAGGGTGT-3¢ (reverse, R2-
CRBP), 5¢-CTCAGAGGACTCGAGGGTGT-3¢ (reverse,
R1-FABP), R191-FABP and 5¢-GGCCACGCGTCGAC
TAGTACGGGIIGGGIIGGGIIG-3¢ (forward, anchor pri-

mer, AP). A first amplification by PCR was carried out
with specific AP as sense primer and R191-FABP as anti-
sense primer, using 1 lL reverse transcription reaction mix-
ture in a total volume of 25 lL: a first step of 3 min at
94 °C was followed by 35 cycles of 30 s at 92 °C, 30 s at
53 °C and 1 min at 72 °C, and 72 °C for 7 min. The first
round of PCR was carried out with AP-specific and
TG-specific primer under the conditions described above.
Nested PCR was performed with the AP and reverse
FAPB-specific primer using 1 lL of the first round PCR
product. The RACE PCR products were visually examined
on a 1.2% agarose gel after electrophoresis. PCR products
were cut out of the gel slice and purified using the GFX
PCR DNA and Gel Band Purification kit (Amersham
Bioscience, Uppsala, Sweden) and then cloned into a PCR
2.1-TOPO TA cloning vector (Invitrogen) following the
manufacturer’s instructions.
On the basis of this sequence, degenerated and specific
primers were designed from both plus and minus strands:
forward-Sh1, 5¢-GAGAAYTTCGAYGARTTYATGAA-3¢;
reverse-Sh2, 5¢-GTAGGTATCGCCGTCCTTGGTG-3¢;
reverse-Sh3, 5¢-GCCATCAGCTGTGGTCTCTTCA-3¢.
The UNI-ZAP XR cDNA library from hemocyte of
P. monodon was used as a template to amplify by PCR
combination with T3 and T7, and the resulting PCR prod-
ucts were cloned and sequenced as above.
Preparation of hpt
The hpt was dissected from the dorsal side of the stomach,
as described in [35]. It was separated into single cells by incu-
bation in 650 lL 0.1% collagenase (Type I + Type IV) solu-

tion at room temperature for 40 min. After collagenase
treatment the tissue was gently passed 10–20 times through a
pipette and centrifuged at 380 g for 5 min to remove the col-
lagenase solution. The pellet was washed twice with 500 lL
CPBS by centrifugation at 380 g for 5 min and then resus-
pended in CPBS and used in subsequent experiments [35].
Separation of hemocytes
The different hemocyte populations of P. leniusculus were
separated and harvested by a sucrose density gradient cen-
trifugation method [36].
In situ hybridization
Circulating hemocytes and isolated hpt cells were analyzed
by in situ hybridization using cDNA probes for crayfish
I. So
¨
derha
¨
ll et al. Crayfish intracellular fatty acid-binding protein
FEBS Journal 273 (2006) 2902–2912 ª 2006 The Authors Journal compilation ª 2006 FEBS 2909
FABP. The cells were attached to slides as previously des-
cribed [37] and fixed with 95% ethanol for 5 min at room
temperature and stored in 70% ethanol at )20 °C until
used. Sequences corresponding to 332 bp of the FABP
region of the crayfish were labeled with dioxigenin using
Klenow enzyme according to the manufacturer’s protocol
(Boehringer-Mannheim, Mannheim, Germany). The fixed
slides were pretreated with 0.1–4 lgÆmL
)1
proteinase K
(PCR grade; Roche, Mannheim, Germany) for 15 min at

37 °C and then hybridized with dioxigenin-labeled probe
in 1.1 · Denhart’s solution, 5.5% dextran sulfate,
0.2 mgÆmL
)1
sonicated salmon sperm DNA, and 4.4 ·
NaCl ⁄ Cit overnight at 42 °C. The samples were washed in
2 · NaCl ⁄ Cit for 2 · 5 min at 20 °C and 0.1 · NaCl ⁄ Cit
for 10 min at 42 °C. Hybrids were detected using anti-diox-
igenin-fluorescein (Fab fragments) and two secondary fluo-
rescein-labeled antibodies. Hybridization of RNase-treated
cells and nonprobe was used as negative controls.
RT-PCR
Expression of FABP mRNA in tissues was demonstrated
by RT-PCR. Total RNA was extracted from a variety of
crayfish tissues including hemocyte, hpt, hepatopancreas,
muscle, eyestalk, intestine, testis and ovary using Trizol.
One microgram total RNA was reverse-transcribed using
Thermoscript
tm
reverse transcriptase with oligo(dT) as pri-
mer. Two specific primers, forward 5¢-GGCAAGTACACC-
CTCGAGTCCT-3¢ and reverse 5¢-AAGGATGATGGA
TTTTTGGTGGTG-3¢, were used in PCR as described
above. Crayfish ribosomal 40S gene was used as a house-
keeping gene; the primer sequences were as follows:
forward 5¢-CCAGGACCCCCAAACTTCTTAG-3¢ and
reverse 5¢-GAAAACTGCCACAGCCGTTG-3¢.
Northern blot analysis
Total RNA of hemocytes, hpt, hepatopancreas, muscle,
eyestalk, intestine, testis and ovary of crayfish were

extracted with Trizol (Invitrogen), using the supplier’s
manual with some modifications. To avoid any contamin-
ation of genomic DNA, the extracted total RNA was
digested with RNase-free DNase I (Ambion, Austin, TX,
USA). Ten micrograms of total RNA in parallel with
RNA markers (Promega) were separated electrophoretical-
ly in a 1% formaldehyde ⁄ agarose gel at 70 V for 2.5 h
and transferred to a nylon Hybond N membrane (Amer-
sham Pharmacia Biotech) by capillary blotting overnight.
The blotted membrane was crosslinked by UV-linker
(Stratagene, La Jolla, CA, USA). The FABP DNA frag-
ment (residue 300–609) was used as a probe. The DNA
probe was labeled with [
32
P]dCTP[aP] using the Mega-
prime DNA Labeling System (Amersham Pharmacia Bio-
tech). The membrane was hybridized at 42 °C and
washed with high stringency according to the manufac-
turer’s instruction for Hybond N membrane. The mem-
branes were then subjected to image plates for the
phosphoimager BAS-2040 (Fuji, Tokyo, Japan). The
radioactivity was quantified using the image gauge pro-
gram, version 3.4 (Fuji). Crayfish actin was used as an
internal control for quantification of total RNA.
Treatment with fatty acids and ATRA
ATRA (Sigma-Aldrich, Steinheim, Germany) was dissolved
in dimethyl sulfoxide at 10 mm and stored at )80 °Cin
amber (light-protected) Eppendorf safe lock tubes as a
stock solution. Oleic acid and stearic acid solutions were
prepared as described by Stremmel & Berk [38]. Briefly, the

fatty acids (Sigma) were dissolved at 50 lm in 0.1 m NaOH
at 37 °C, and a solution of 2.5 mm fatty acid-free BSA
(Sigma) in NaCl ⁄ P
i
was added to a fatty acid ⁄ albumin
molar ratio of 5; the pH was adjusted to 7.4 with NaOH.
The stearic acid solution was incubated at 60 °C for 15 min
to allow solubilization of the fatty acid complex. The solu-
tions were then filter sterilized and diluted with culture
medium to its final working concentration. The hpt cells
were cultured in the presence or absence of 0.1–1.0 mm
fatty acids or ATRA from 1 nm to 1 lm. The fatty acid-
s ⁄ ATRA were introduced 3–5 days after initiation of the
culture, and the medium was changed (to one with fatty
acid ⁄ ATRA maintained) every 2 days until the 7th of cul-
ture. The morphology was observed every day. Expression
of FABP in hpt cells was determined by real-time RT-PCR
at different time intervals after the treatment.
Comparative quantitation of plFABP mRNA
expression using real-time RT-PCR
Hpt cell cDNA was synthesized using oligo(dT) as des-
cribed above and diluted to 1 : 10 with MilliQ filter steril-
ized water. Real-time RT-PCR and data analysis
were performed in a Roter-gene3000 (Corbett Robotics,
Australia) using QuantiTect
tm
SYBRÒ Green PCR kit
(Qiagen). Primers (458+ GGCAGCAGCAGTGACAGT
AGCAATAG and 596– ACGAGGAAGCGAAGGATGA
TGATGG) were chosen to amplify a 139-base pair frag-

ment of the plFABP. Primers specific to the crayfish ribo-
somal 40S gene (156+ GACGAATGGCATACACCTGAG
AGG and 280– CAGGACTCTGCAGTTCAAGCTGATG)
were used to quantify cellular RNA input of each prepar-
ation with a 125-bp PCR product. The PCR mixture con-
tained 12.5 lL2· QuantiTect
tm
SYBR Green PCR master
mix, 0.4 lm each primer, and 5 lL diluted cDNA template.
RNase-free distilled water was added to reach a total vol-
ume of 25 lL per reaction. All runs used a negative control
without target DNA. Thermal cycling conditions were as
follows: 95 °C for 15 min, followed by 45 cycles of 94 °C
for 15 s, 62 °C for 30 s, and 72 °C for 30 s. All PCRs were
performed in triplicate.
Crayfish intracellular fatty acid-binding protein I. So
¨
derha
¨
ll et al.
2910 FEBS Journal 273 (2006) 2902–2912 ª 2006 The Authors Journal compilation ª 2006 FEBS
Assay of hemocyte number and clotting
Total hemocyte number was determined as previously des-
cribed [35]. The absorption spectra of plasma from different
crayfish were analyzed after removal of the hemocytes from
the hemolymph by centrifugation (800 g, 10 min at 4 °C).
Clotting ability was analyzed as described previously [39].
Oil red O staining
After being cultured for 2 days in the presence of fatty
acids or ATRA, the cells were washed twice with ice-cold

NaCl ⁄ P
i
, fixed in 10% formalin for 10 min, rinsed in dis-
tilled water, infiltrated into 100% propylene glycol for
5 min, and then stained with oil red O (Wako, Dusseldorf,
Germany) for 8 min at 60 °C. The cells were counterstained
with 0.5% methyl green (Sigma, St Louis, MO, USA) in
0.1 m sodium acetate, pH 4.2, for 5 min at 37 °C, followed
by rinsing in distilled water (3 · 3 min each) and mounting
in aqueous mounting medium.
Protein homology modeling
Structural models of the crayfish FABP were created using
Deep View analysis software ( />One model was based on the published X-ray crystal struc-
ture of human brain FABP (1fdqA, 1fdqB) and NMR struc-
ture of human brain FABP. In another model, plFABP was
superimposed on human CRABP (|pbd|1cbp|, |pbd|2cbr|).
Acknowledgements
This research is supported by a Carl Tryggers Founda-
tion grant (to I.S.), a Swedish Science research Council
grant (to K.S.) and a grant to A.T. from the Thailand
Research Fund (TRF) for a Royal Golden Jubilee
Ph.D. fellowship (2.B.PS ⁄ 42 ⁄ A.1).
References
1 Zimmerman AW & Veerkamp JH (2002) New insights
into the structure and function of fatty acid-binding
proteins. Cell Mol Life Sci 59, 1096–1116.
2 Haunerland NH & Chisholm JM (1990) Fatty acid
binding protein in flight muscle of the locust Schisto-
cerca gregaria. Biochim Biophys Acta 1047, 233–238.
3 Maatman RG, Degano M, Van Moerkerk HT, Van

Marrewijk WJ, Van der Horst DJ, Sacchettini JC &
Veerkamp JH (1994) Primary structure and binding
characteristics of locust and human muscle fatty-acid-
binding proteins. Eur J Biochem 221, 801–810.
4 Gu PL, Gunawardene YI, Chow BC, He JG & Chan
SM (2002) Characterization of a novel cellular retinoic
acid ⁄ retinol binding protein from shrimp: expression of
the recombinant protein for immunohistochemical
detection and binding assay. Gene 288, 77–84.
5 Mansfield SG, Cammer S, Alexander SC, Muehleisen
DP, Gray RS, Tropsha A & Bollenbacher WE (1998)
Molecular cloning and characterization of an inverte-
brate cellular retinoic acid binding protein. Proc Natl
Acad Sci USA 95, 6825–6830.
6 Folli C, Ramazzina I, Percudani R & Berni R (2005)
Ligand-binding specificity of an invertebrate (Manduca
sexta): putative cellular retinoic acid binding protein.
Biochim Biophys Acta 1747, 229–237.
7 Zou C, Ramakumar S, Qian L, Zang R, Wang J,
Grossman HB, Lotan R & Liebert M (2005) Effect of
retinoic acid and interferon alpha-2a on transitional cell
carcinoma of bladder. J Urol 173, 247–251.
8 Noy N (2000) Retinoid-binding proteins: mediators of
retinoid action. Biochem J 384, 481–495.
9 Chen Q & Ross CA (2004) Retinoic acid regulates cell
cycle progression and cell differentiation in human
monocytic THP-1 cells. Exp Cell Res 297, 68–81.
10 A
˚
stro

¨
m A, Tavakkol A, Pattersson V, Cromie M, Elder
JT & Voorhees JJ (1991) Molecular cloning of two
human cellular retinoic acid-binding proteins (CRABP).
J Biol Chem 266 , 17662–17666.
11 Chambon P (1996) A decade of molecular biology of
retinoic acid receptors. FASEB J 10, 940–954.
12 Esteves A & Ehrlich R (2006) Invertebrate intracellular
fatty acid bining proteins. Comp Biochem Physiol 142,
262–274.
13 Makowski L, Boord JB, Maeda K, Babaev VR, Uysal
KT, Morgan MA, Parker RA, Suttles J, Fazio S,
Hotamisligil GS, et al. (2001) Lack of macrophage
fatty-acid-binding protein aP2 protects mice deficient in
apolipoprotein E against atherosclerosis. Nat Med 7,
699–705.
14 Schachtrup C, Scholzen TE, Grau V, Luger TA, Sorg
C, Spener F & Kerkhoff C (2004) L-FABP is exclusively
expressed in alveolar macrophages within the myeloid
lineage: evidence for a PPARalpha-independent expres-
sion. Int J Biochem Cell Biol 36, 2042–2053.
15 Kitanaka N, Owada Y, Abdelwahab SA, Iwasa H,
Sakagami H, Watanabe M, Spener F & Kondo H
(2003) Specific localization of epidermal-type fatty acid
binding protein in dendritic cells of splenic white pulp.
Histochem Cell Biol 120, 465–473.
16 Grau V, Garn H, Bette M, Spener F, Steiniger B,
Gemsa D & Stehling O (2003) Induction of epidermal
fatty acid binding protein in intravascular monocytes of
renal allografts. Transplantation 75, 685–688.

17 Wang L, Li Y & Yan H (1997) Structure function rela-
tionships of cellular retinoic acid binding protein. J Biol
Chem 272, 1540–1547.
18 Wang L, Li Y, Abildgaard Y, Markley JL & Yan H
(1998) NMR solution structure of type II human
I. So
¨
derha
¨
ll et al. Crayfish intracellular fatty acid-binding protein
FEBS Journal 273 (2006) 2902–2912 ª 2006 The Authors Journal compilation ª 2006 FEBS 2911
cellular retinoic acid binding protein: implications for
ligand binding. Biochemistry 37, 12727–12736.
19 Jones PD, Carne A, Bass NM & Grigor MR (1988) Iso-
lation and characterization of fatty acid binding pro-
teins from mammary tissue of lactating rats. Biochem J
251, 919–925.
20 Kleywegt GJ, Bergfors T, Senn H, Le Motte P, Gsell B,
Shudo K & Jones TA (1994) Crystal structures of cellu-
lar retinoic acid binding proteins I and II in complex
with all-trans-retinoic acid and a synthetic retinoid.
Structure 2, 1241–1258.
21 Tan NS, Shaw NS, Vinckenbosch N, Liu P, Yasmin R,
Desvergne B, Wahli W & Noy N (2002) Selective coop-
eration between fatty acid binding proteins and peroxi-
some proliferator-activated receptors in regulating
transcription. Mol Cell Biol 22, 5114–5127.
22 Evans T (2005) Regulation of hematopoiesis by retinoid
signaling. Exp Hematol 33, 1055–1061.
23 Fujiwara S & Kawamura K (2003) Acquisition of reti-

noic acid signaling pathway and innovation of the chor-
date body plan. Zool Sci 20, 809–818.
24 Maden M & Hind M (2003) Retinoic acid, a regenera-
tion-inducing molecule. Dev Dyn 226, 237–244.
25 Carbin BE, Collins VP & Ekman P (1987) Tissue poly-
peptide antigen (TPA), some cytokeratins and epithelial
membrane antigen (EMA) in normal, inflamed and
malignant urothelium. Urol Res 15, 191–194.
26 Purton LE, Bernstein ID & Collins SJ (1999) All-trans
retinoic acid delays the differentiation of primitive
hematopoietic precursors (lin-c-kit+Sca-1 (+)) while
enhancing the terminal maturation of committed gra-
nulocyte ⁄ monocyte progenitors. Blood 94, 483–495.
27 Hopkins P (2001) Limb regeneration in the fiddler crab,
Uca pugilator: hormonal and growth factor control.
Am Zool 41, 389–398.
28 Hopkins PM & Durica DS (1995) Effects of all-trans
retinoic acid on regenerating limbs of the fiddler crab,
Uca pugilator. J Exp Zool 272, 455–463.
29 Chung AC, Durica DS, Clifton SW, Roe BA & Hop-
kins PM (1998) Cloning of crustacean ecdysteroid recep-
tor and retinoid-X receptor gene homologs and
elevation of retinoid-X receptor mRNA by retinoic acid.
Mol Cell Endocrinol 139, 209–227.
30 Wu X, Hopkins PM, Palli SR & Durcia DS (2004)
Crustacean retinoid-X receptor isoforms: distinctive
DNA binding and receptor–receptor interaction with a
cognate ecdysteroid receptor. Mol Cell Immunol 218,
21–38.
31 Hall. M, van Heusden MC & So

¨
derha
¨
ll K (1995)
Identification of the major lipoproteins in crayfish
hemolymph as proetins involved in immune recogni-
tion and clotting. Biochem Bophys Res Commun 216,
939–946.
32 Hall M, Wang R, van Antowerpen R, Sottrup-Jensen L
&So
¨
derha
¨
ll K (1999) The crayfish plasma clotting pro-
tein: a vitellogenin-related protein responsible for clot
formation in crustacean blood. Proc Natl Acad Sci USA
96, 1965–1970.
33 Song Y-L., YuC-I, Lien T-W, Huang C-C & Lin M-N
(2003) Haemolymph parameters of pacific white shrimp
(Litopenaeus vannamei) infected with taura syndrome
virus fish shell. Immunology 14, 317–331.
34 Chen FR, Liu PC & Lee KK (1999) Purification and
partial characterization of a toxic serine protease pro-
duced by pathogenic Vibrio alginolyticus. Microbios 98,
95–111.
35 So
¨
derha
¨
ll I, Bangyeekhun E, Mayo S & So

¨
derha
¨
ll K
(2003) Hemocyte production and maturation in an
invertebrate animal; proliferation and gene expression in
hematopoietic stem cells of Pacifastacus leniusculus. Dev
Comp Immunol 27, 661–672.
36 So
¨
derha
¨
ll K & Smith VJ (1983) Separation of the hae-
mocyte populations of Carcinus maenas and other mar-
ine decapods, and prophenoloxidase distribution. Dev
Comp Immunol 7, 229–239.
37 Johansson MW & So
¨
derha
¨
ll K (1985) Isolation and
purification of a cell adhesion factor from crayfish
blood cells. J Cell Biol 106, 1795–1803.
38 Stremmel W & Berk PD (1986) Hepatocellular influx of
[
14
C]oleate reflects membrane transport rather than
intracellular metabolism or binding. Proc Natl Acad Sci
USA 83, 3086–3090.
39 So

¨
derha
¨
ll K (1981) Fungal cell wall b-1,3-glucans induce
clotting and phenoloxidase attachment to foreign surfa-
ces of crayfish hemocyte lysates. Dev Comp Immunol 5,
565–573.
Crayfish intracellular fatty acid-binding protein I. So
¨
derha
¨
ll et al.
2912 FEBS Journal 273 (2006) 2902–2912 ª 2006 The Authors Journal compilation ª 2006 FEBS