Báo cáo khoa học: Actin mutations in hypertrophic and dilated cardiomyopathy cause inefficient protein folding and perturbed filament formation pdf

Actin mutations in hypertrophic and dilated
cardiomyopathy cause inefficient protein folding and
perturbed filament formation
Søren Vang
1
, Thomas J. Corydon
2
, Anders D. Børglum
2
, Melissa D. Scott
3
, Judith Frydman
3
,
Jens Mogensen
4
, Niels Gregersen
1
and Peter Bross
1
1 Research Unit for Molecular Medicine, Aarhus University Hospital and Faculty of Health Sciences, Denmark
2 Institute of Human Genetics, University of Aarhus, Denmark
3 Department of Biological Sciences and BioX Program, Stanford University, CA, USA
4 Department of Cardiology, Aarhus University Hospital, Denmark
Hypertrophic cardiomyopathy (HCM) is inherited by
autosomal dominant transmission with a prevalence of
approximately 1 : 500. The condition is defined by the
presence of unexplained myocardial hypertrophy and
myocardial histology is characterized by myocyte dis-
array [1]. HCM may be caused by missense mutations
in any one of eight known sarcomeric genes. These

genes encode proteins of the cardiac sarcomere, com-
ponents of thick and thin filaments with contractile,
structural or regulatory functions (thick filament:
MYH7, MYL3, MYL2, MYBPC3; thin filament:
ACTC, TNNT2, TNNI3, TPM1 [2]). It has been hypo-
thesized that the mutant protein (poisonous peptide)
causes a dominant negative inhibition of the protein
produced from the normal allele, impairing the sarco-
meric contractile performance [3]. This is thought to
eventually lead to a compensatory hypertrophy of the
heart [4]. A few mutations in the MYBPC3 gene are
believed to give rise to haplo-insufficiency [5].
Dilated cardiomyopathy (DCM) is the most com-
mon cause of heart failure and cardiac transplantation
in the young. DCM is usually transmitted in a domin-
Keywords
a-cardiac actin; chaperone; dilated
cardiomyopathy; hypertrophic
cardiomyopathy; protein folding
Correspondence
S. Vang, Research Unit for Molecular
Medicine, Aarhus University Hospital,
Skejby Sygehus, Brendstrupgaardsvej,
DK-8200 A
˚
rhus N, Denmark
Fax: +45 89496018
Tel: +45 89495150
E-mail:
(Received 12 January 2005, revised 24

February 2005, accepted 25 February 2005)
doi:10.1111/j.1742-4658.2005.04630.x
Hypertrophic cardiomyopathy (HCM) and dilated cardiomyopathy (DCM)
are the most common hereditary cardiac conditions. Both are frequent
causes of sudden death and are often associated with an adverse disease
course. Alpha-cardiac actin is one of the disease genes where different mis-
sense mutations have been found to cause either HCM or DCM. We have
tested the hypothesis that the protein-folding pathway plays a role in dis-
ease development for two actin variants associated with DCM and six asso-
ciated with HCM. Based on a cell-free coupled translation assay the actin
variants could be graded by their tendency to associate with the chaperonin
TCP-1 ring complex ⁄ chaperonin containing TCP-1 (TRiC ⁄ CCT) as well as
their propensity to acquire their native conformation. Some variant pro-
teins are completely stalled in a complex with TRiC and fail to fold into
mature globular actin and some appear to fold as efficiently as the wild-
type protein. A fraction of the translated polypeptide became ubiquitinated
and detergent insoluble. Variant actin proteins overexpressed in mamma-
lian cell lines fail to incorporate into actin filaments in a manner correla-
ting with the degree of misfolding observed in the cell-free assay; ranging
from incorporation comparable to wild-type actin to little or no incorpor-
ation. We propose that effects of mutations on folding and fiber assembly
may play a role in the molecular disease mechanism.
Abbreviations
ACTC, a-cardiac actin gene; CCT, chaperonin containing TCP-1; DCM, dilated cardiomyopathy; DMSO, dimethylsulfoxide; HCM, hypertrophic
cardiomyopathy; TRiC, TCP-1 ring complex; VLCAD, very-long chain acyl-CoA dehydrogenase.
FEBS Journal 272 (2005) 2037–2049 ª 2005 FEBS 2037
ant fashion; however, recessive, X-linked and mito-
chondrial inheritances have also been reported. More
than 20 disease genes have been reported so far, enco-
ding a wide variety of proteins expressed in cardiac

myocytes [6]. Recently DCM mutations in several sar-
comeric genes have been identified [2].
The a-cardiac actin gene (ACTC) was the first gene
identified to harbor both HCM and DCM mutations,
with six mutations leading to HCM and two mutations
leading to DCM (Fig. 1) [7–10]. Based on both the
clinical findings in the patients carrying the different
actin mutations and the putative protein–protein inter-
actions deduced from the X-ray structures, the pre-
vailing hypothesis proposes that while actin mutant
variants are incorporated into thin filaments in both
cases, in HCM an altered structure of the region inter-
acting with myosin impairs force generation, whereas
in DCM disturbance of the interactions with proteins
of the Z-disk impair force transmission from the sarco-
mere to the surrounding syncytium [7,9,11].
Clinical diversity or ‘phenotypic heterogeneity’ is a
hallmark of HCM and implies that factors other than
the underlying major gene defect modify the impact of
the mutant gene at the cellular and clinical level. An
increasing interest in the modulating factors that result
in the lack of correlation between genotype and pheno-
type has evolved in recent years [12,13]. These modify-
ing factors may be genetic, in which case a second
gene may regulate the expression of the primary defect
differently in different patients. The variation may also
be due to environmental factors such as age, diet, exer-
cise, pharmaceutical agents and the efficiency of the
cellular protein folding machinery.
The protein folding machinery of the cell is known

to respond to cellular stress and changes in physico-
chemical conditions [14]. The mechanism by which
chaperones influence other cellular processes include
increasing de novo folding efficiency, assisting refold-
ing of proteins denatured by stress, and modulating
the balance between folding and degradation of mis-
folded proteins [15,16]. It is the quality control func-
tion of chaperones that we are most interested in,
because molecular chaperones and proteases may act
in conjunction to determine the fate of the variant
protein [17–19]. Three pathological scenarios can be
pictured. Firstly, decreasing the negative dominance
of a poisonous peptide, thereby suppressing the sever-
ity of the disease; secondly, complete or nearly
complete degradation of the mutant allele product
resulting in haploinsufficiency as the disease mechan-
ism; and thirdly, the inability to eliminate misfolded
proteins leading to accumulation of cell toxic aggre-
gates. In all three cases degradation and folding path-
ways of the gene products are likely to be important
factors.
Studies from several groups indicate that multiple
chaperone complexes work to assist the folding of
actin [20–23]. During actin synthesis, prefoldin binds
and stabilizes the incompletely folded nascent polypep-
tide and releases it for further folding to the cytosolic
chaperonin, referred to as TCP-1 ring complex (TRiC)
or chaperonin containing TCP-1 (CCT). It has previ-
ously been shown that variations in a-skeletal actin
impair folding and polymerization [24], and that actin

variants that are unable to fold are degraded by the
ubiquitin-proteasome pathway [20].
This study has investigated the folding and stability
of variant a-cardiac actins leading to HCM and DCM.
Using a cell-free system of coupled in vitro transcrip-
tion ⁄ translation, we have studied the folding of the actin
variant proteins and their different interaction affinities
for chaperones. We have also used immunostaining and
confocal laser scanning microscopy of transfected cells
to study the ability of the variant actin protein to incor-
porate into filaments in the cytoskeleton.
Results
Some mutant actin proteins display perturbed
interaction kinetics with the TRiC chaperonin
leading to delayed folding
The folding pathway of wild-type and mutant actin
polypeptides was studied using a cell-free transcrip-
Met 305
Arg 312
Ala 331
Ala 295
Pro 164
Glu 361
Glu 99
Tyr 166
Fig. 1. Missense variations in the actin structure. Ribbon represen-
tation of the actin monomer based on the crystal structure of rabbit
b-actin (PDB accession number 1ATN). The residues mutated in
HCM are colored in blue and the residues mutated in DCM are
white. Figure prepared with the

MOLMOL program [44]. Amino acid
substitutions shown in bold lead to DCM.
Misfolding of actin variants in cardiomyopathies S. Vang et al.
2038 FEBS Journal 272 (2005) 2037–2049 ª 2005 FEBS
tion ⁄ translation system. Full length wild-type actin
and eight variant actin cDNA constructs containing
disease-causing mutations were transcribed and trans-
lated in the presence of [
35
S]methionine at 37 °C
(Table 1). Samples were taken at different time points
up to 60 min and analyzed by both SDS ⁄ PAGE and
native PAGE. Separation by SDS ⁄ PAGE and visual-
ization by phosphorimaging showed a single band of
42 kDa with similar intensity for all actin variants,
indicating homogeneous production of the nascent
polypeptide for all constructs (not shown). In this and
other experiments, we observed the transcription ⁄
translation system to have a maximum activity at
t ¼ 0–20 min.
In the initial experiment cDNAs encoding Rattus
norvegicus wild-type, human wild-type, six HCM-caus-
ing, and two DCM-causing a-cardiac actin mutations
were expressed (Fig. 1). The rat actin has the same
sequence at the protein level but minor changes at the
DNA level, and thereby served as an alternative wild-
type control. The native PAGE analysis showed that
the actin polypeptides are mainly found in three com-
plexes: one distinct band with slow mobility, a fainter
band with intermediate mobility, and a diffuse, rapidly

migrating band (Fig. 2A). This pattern of complex for-
mation over time varied between wild-type and mutant
actin polypeptides. Of all the mutants, the Arg312His
actin had the largest percentage of the protein retained
in the slowly migrating complex. This retention did
not reduce over time, as seen for wild-type actin as a
consequence of the reduced protein production rate.
Furthermore, the rapidly migrating smear was almost
absent in samples containing Arg312His actin. This
phenomenon was temperature sensitive and less pro-
nounced at 30 °C (not shown) than at 37 °C, a trait
often seen with proteins with a defective folding path-
way [25].
Previous studies have shown that the TRiC chapero-
nin binds actin in a high molecular mass complex, and
is involved in its biogenesis [21,22]. The slowly migra-
ting band was shown through immunoblotting of
native PAGE gels to comigrate with the TCP-1 subunit
of TRiC (Fig. 2B, left). Additionally, anti-(TCP-1) IgG
was able to immunoprecipitate actin from reticulocyte
lysate reactions in contrast to a negative control anti-
body raised against very-long chain acyl-CoA dehy-
drogenase (VLCAD) (Fig. 2B, right). The reticulocyte
extracts contain a large amount of hemoglobin, which
forms nonspecific interactions with radioactive material
and migrates as the intermediate band (Fig. 2C,D).
The broad, rapidly migrating smear corresponds to the
folded actin monomer. This was confirmed upon addi-
tion of 2 lg DNase I to a pulse-chase reaction of wild-
type actin, followed by analysis of the mobility shift of

this band by native PAGE and radiography (Fig. 2C).
DNase I binds the actin monomer and condenses the
smear to a distinct band of characteristic mobility. The
smear was totally absent in the Arg312His actin lanes
and therefore no actin–DNase I band appeared after
addition of DNase I (not shown).
Phosphorimager scanning of the TRiC band as a
fraction of the whole lane in Fig. 2A gave a measure
of the percentage of actin bound to TRiC at different
time points. This shows the Arg312His and Glu99Lys
variant proteins to have a sevenfold and threefold
increased relative amount of actin–TRiC complex,
respectively, when compared to wild-type after
60 min of translation at 37 °C (not shown). The
results indicate that these mutant proteins have diffi-
culty folding to assume their native form and remain
TRiC-bound. Actin molecules that fail to reach a
native state upon release from TRiC may rebind for
a second round of folding, possibly by interaction
with other chaperones as a transitional transferring
step [20,26].
Pulse-chase labeling experiments with initial biosyn-
thesis of [
35
S]actin at 37 °C for 30 min and subse-
quent termination of translation with cycloheximide
emphasized the difference in the folding kinetics
between wild-type and the Arg312His variant
Table 1. Primers used for the mutagenesis of the a-cardiac actin (ACTC) gene. The mutated bases are highlighted in bold.
Mutation Oligonucleotide Phenotype Reference

Glu99Lys CTCCGTGTTGCTCCC
AAGGAGCACCCCACCCTG HCM [10]
Pro164Ala GTAACTCACAATGTC
GCCATCTATGAGGGCTAC HCM [10]
Tyr166Cys CAATGTCCCCATCT
GCGAGGGCTACGCTTTGC HCM [8]
Ala295Ser CGCAAGGACCTGTAT
TCCAACAATGTCTTATC HCM [7]
Met305Leu CTGGAGGCACCACT
CTGTACCCTGGTATTGC HCM [8]
Ala331Pro GATTAAGATTATT
CCCCCCCCTGAGCGTAAATAC HCM [10]
Arg312His CTGGTATTGCTGATC
ACATGCAGAAGGAAATC DCM [9]
Glu361Gly GTGGATTAGCAAGCAAG
GCTACGATGAGGCAGG DCM [9]
S. Vang et al. Misfolding of actin variants in cardiomyopathies
FEBS Journal 272 (2005) 2037–2049 ª 2005 FEBS 2039
(Fig. 2D). Reticulocyte lysate contains 20 lm hemin,
which is required for translation initiation in this sys-
tem. Hemin has inhibitory effects on the ubiquitin-
proteasome degradation system [27] and was therefore
removed by a desalting step prior to the chase period
to asses the proteolytic capabilities of the extract.
Samples were taken at different time points and
transferred to native loading buffer in the presence of
EDTA to inhibit the TRiC ATPase, and kept on ice
until separation by native PAGE. At t ¼ 0 after the
protein synthesis termination, the ratio between
TRiC-bound actin and monomeric actin is approxi-

Wild Type Rat
Wild type
Glu99Lys
Met305Leu
Ala331Pro
Ala295Ser
Arg312His
Tyr166Cys
Pro164Ala
Glu361Gly
TRiC
Hb
N-actin
10 20 40 60 10 20 40 60 10 20 40 60 10 20 40 60 10 20 40 60
10 20 40 60 10 20 40 60 10 20 40 60 10 20 40 60 10 20 40 60
A
P
TRiC VLCAD
IP
SPS
TRiC
RIB
B
Wild Type Arg312His
0
TRiC
N-actin
1
80
120

90
60
120
90
60
30
15
2
40
30
15
0
240
18
0
D
C
Hb
*
Min.
Min.
Wild Type
N-actin
Actin-DNaseI complex
Hb
024024
Hours
+++
2µg DNase I
Fig. 2. Some actin mutations have reduced folding efficiency and prolonged chaperone interaction. In vitro protein biosynthesis carried out

using coupled transcription ⁄ translation systems. Wild-type and mutant full length cDNA in the pcDNA3.1 vector and radioactive labeling was
performed using 10 lCi ÆlL
)1
[
35
S]methionine. (A) The transcription ⁄ translation reactions were incubated at 37 °C and put on ice in a native
loading buffer containing 5 m
M EDTA at the times indicated, until separation by native PAGE on 4–15% gel and visualization by radiography.
(B) Following in vitro translation of wild-type cDNA for 30 min protein synthesis was stopped with cycloheximide at a final concentration of
150 lgÆmL
)1
and processed by native PAGE. One gel was processed by radiography (R) and one was visualized by immunoblotting (IB) with
TRiC antibodies. Additionally, the sample was precipitated by Sepharose beads coupled to either antibodies against TRiC or VLCAD for 1 h.
The washed pellet (P) or supernatant (S) was analyzed by SDS ⁄ PAGE and radiography. (C) In vitro translation of wild-type cDNA for 30 min
followed by termination of protein synthesis using cycloheximide. DNase I (2 lL) was added to each sample and incubated at 37 °C for the
times indicated before separation by native PAGE and analyzed by radiography. (D) Experimental pulse chase conditions as in (C). Samples
were incubated 0–240 min at 37 °C and analyzed by native PAGE and autoradiography. An unidentified band is indicated by an asterisk.
N-actin, native actin; Hb, hemoglobin; R, radiography; IB, immunoblot; IP, immunoprecipitation. Amino acid substitutions shown in bold lead
to DCM.
Misfolding of actin variants in cardiomyopathies S. Vang et al.
2040 FEBS Journal 272 (2005) 2037–2049 ª 2005 FEBS
mately sevenfold higher for Arg312His actin com-
pared to wild-type. The strong Arg312His actin–TRiC
complex band persists for up to two hours. This can
be explained by a tight actin–TRiC complex or by a
dynamic dissociation ⁄ reassociation equilibrium shifted
towards formation of complex. In addition, a new
actin-containing band of unknown nature is now visi-
ble in the wild-type lanes, denoted by an asterisk in
Fig. 2D.

Impaired folding leads to decreased formation
of compact native actin structures
To assess the fraction of folded to unfolded actin, the
wild-type and mutant actins were subjected to a mild
protease treatment. The cDNAs were expressed in vitro
incorporating [
35
S]Met for 30 min followed by termin-
ation of protein translation with cycloheximide. The
labeled protein products were treated with protein-
ase K, separated by SDS ⁄ PAGE and analyzed by
phosphorimaging. Actin in its native monomer confor-
mation has a compact, protease-resistant structure [20]
and when subjected to mild digestion with protein-
ase K it is cleaved at the peptide bond between Met47
and Gly48, producing a globular C-terminal 35 kDa
fragment [28]. The array of mutant proteins tested
exhibited different resistance to the digestion, all pro-
ducing the 35 kDa fragment and some being further
degraded. This suggests that the variant actins
Glu99Lys, Pro164Ala, Met305Leu, Arg312His, and
Glu361Gly are stalled in a partly folded conformation
having reduced resistance to proteolytic degradation
(Fig. 3A, upper panel).
We also assessed the fraction of folded to unfolded
actin by measuring the fraction of folded actin mono-
mer. Only full length and correctly folded actin can
form a high affinity complex with DNase I [20]. By
immobilizing DNase I on Sepharose beads, folded
actin can be pulled down from solution and quantified

by SDS ⁄ PAGE [20]. The assay was performed on the
samples mentioned above, and again the variants
Glu99Lys, Pro164Ala, Met305Leu, Arg312His and
Glu361Gly was shown to be strongly impaired in
reaching the native conformation (Fig. 3A, lower
panel).
There was a clear correlation between the assay of
protease resistance and the assay of actin folding
(Fig. 3B), indicating that the fraction of variant actin
that is not able to reach its native structure has a loose
structure and is accessible to nonspecific proteases.
The variants not impaired in these assays appeared to
fold even better than the wild-type actin. The reason
for this is unknown.
Variant actin aggregates in a ubiquitin-dependent
manner
Unfolded or misfolded proteins are often recognized
and eliminated by the quality control system [18,19].
In the cytosol, substrates are marked by covalent
modification with multiubiquitin chains, followed by
degradation by the proteasome to protect the cell from
exposed hydrophobic polypeptide segments [29]. To
test whether the misfolded variant actins are processed
by the proteasome, in vitro pulse-chase assays were
performed for the wild-type and Arg312His mutant
protein. Wild-type and variant actin were expressed
in vitro at 37 °C for 30 min. At 30 min, subsequent
translation was terminated by the addition of cyclohexi-
mide. Degradation was measured in the presence of
the proteasome inhibitor MG132, methylated ubiqu-

itin, EDTA or dimethylsulfoxide (DMSO) during the
chase period (Fig. 4). Samples were taken at 0, 2 and
4 h and kept on ice until electrophoretic analysis. At
4 h, a sample was centrifuged at 16 000 g for 20 min
and washed in 1% (v ⁄ v) Triton X-100 to detect the
formation of detergent-insoluble aggregates. All sam-
ples were boiled in SDS loading buffer and separated
by SDS ⁄ PAGE followed by quantification by phos-
phorimaging (Fig. 4). Wild-type actin was stable dur-
ing the four hour chase period, and produced only a
small amount of SDS soluble aggregate and no detect-
able high molecular mass ubiquitinated actin. How-
ever, the amount of soluble Arg312His actin decreased
over time and after four hours only approximately
25% remained. After 4 h, a large fraction of SDS sol-
uble actin and high molecular mass ubiquitinated actin
was detected in the Triton X-100 insoluble pellet.
Concordantly, treatment with the specific proteasome
inhibitor MG132 did not have any effect on either the
wild-type or the Arg312His actin. This indicates that
following polyubiquitination, the protein aggregates
and cannot be degraded by the proteasome. Incubation
with methylated ubiquitin inhibited the formation of
high molecular mass ubiquitin conjugates. Methylated
ubiquitin can be efficiently ligated to protein sub-
strates, but terminates elongation of polyubiquitin
chains because its reactive lysine residue is blocked
[30]. Ubiquitination can be completely blocked by
treatment with EDTA. The E1 catalyzed activation of
ubiquitin is Mg

2+
- and ATP-dependent and is there-
fore blocked by the addition of EDTA [29]. By inhibit-
ing ubiquitin conjugation either partly or completely,
the formation of Triton X-100 insoluble aggregates
was also inhibited, suggesting the aggregation to be
ubiquitin-dependent. Results of the quantification of
full length actin in the SDS ⁄ PAGE are shown in
S. Vang et al. Misfolding of actin variants in cardiomyopathies
FEBS Journal 272 (2005) 2037–2049 ª 2005 FEBS 2041
Fig. 4B,C. Quantification of all radioactive material
having higher molecular mass than actin, and thus rep-
resenting ubiquitin conjugates, is shown in Fig. 4D.
Some actin variants show perturbed filament
formation
We investigated the ability of the mutant proteins to
form filamentous actin in cell culture. To test the sub-
cellular localization of mutant actins and their ability
to polymerize, we expressed full length wild-type and
mutant actin using the mammalian expression vector
pcDNA3.1 ⁄ Myc-His A, producing a C-terminally
c-Myc-tagged chimeric protein. The tagged versions of
the actin variants behaved like the untagged versions
when tested in the in vitro system (data not shown).
Transfected HEK-293 or COS-7 cells were stained with
primary antibodies against c-Myc prior to labeling with
green fluorescent secondary antibodies and costained
with Texas Red fluorescent phalloidin, a standard mar-
ker for filamentous actin. The in situ immunostaining
was visualized by confocal laser scanning microscopy

Proteinase K
Before treatment After treatment
DNase I
Glu361Gl
y
Arg312His
Ala331Prp
Met305Leu
Ala295Ser
Tyr166Cys
Pro164Ala
Glu99Lys
Wild Type
Glu361Gly
Arg312His
Ala331Prp
Met305Leu
Ala295Ser
Tyr166Cys
Pro164Ala
Glu99Lys
Wild
Ty pe
Wild type
Glu99Lys
Pro164Ala
Tyr166Cys
Ala295Ser
Met
305Ly

s
A
l
a
331Pro
Arg312His
Glu361Gly
Relative to wild type
0,0
0,5
1,0
1,5
2,0
2,5
3,0
DNase I rescued
Proteinase K digested
A
B
Fig. 3. Some actin variations lead to a non-native loose protein structure. In vitro translation for 30 min at 37 °C followed by termination of
protein synthesis using 150 lgÆmL
)1
cycloheximide. (A) Resistance to protease treatment was assessed by digestion with 20 lgÆmL
)1
pro-
teinase K for 15 min at 20 °C and inhibition by 10 m
M PMSF for 10 min on ice. Actin binding to DNase I was measured by incubation with
Sepharose beads coupled to DNase I for 1 h at 4 °C followed by stringent washing and elution of actin by SDS loading buffer containing
40% (v ⁄ v) formamide. (B) The samples were analyzed by SDS ⁄ PAGE and quantified by phosphorimager scanning. Each sample was normal-
ized to its respective untreated sample and relative difference to the wild-type was calculated. Error bars indicate standard deviations. Amino

acid substitutions shown in bold lead to DCM.
Misfolding of actin variants in cardiomyopathies S. Vang et al.
2042 FEBS Journal 272 (2005) 2037–2049 ª 2005 FEBS
SDS gel
024 0PP24 024 0PP24024 0PP24 P P024 024
Wild Type Arg312His Wild Type Arg312HisWild Type Arg312His Wild Type Arg312His
DMSO Met-UbMG132 EDTA
A
B
Full length actin
Wild type
Hours
43210
0,0
0,2
0,4
0,6
0,8
1,0
1,2
Full length actin
Arg312His
Hours
0,0
0,2
0,4
0,6
43210
0,8
1,0

1,2
CD
Wild Type
Arg312His
Wild Type
Arg312His
Wild Type
Arg312His
Wild Type
Arg312His
Ubiquitinated actin
0
10
20
30
40
DMSO MG132 Met-Ub EDTA
Pellet fraction
Wild Type
Arg312His
Wild Type
Arg312His
Wild Type
Arg312His
Wild Type
Arg312His
DMSO MG132 Met-Ub EDTA
0
5
10

15
20
Fig. 4. Insoluble misfolded actin accumulates in a ubiquitin dependant manner. In vitro translation for 30 min followed by termination of pro-
tein synthesis using cycloheximide at a final concentration of 150 lgÆmL
)1
. Samples taken at 0, 2 and 4 h after termination were briefly spun
at 16 000 g dissolved in SDS buffer on ice until gel separation. Samples at 4 h were spun at 16 000 g for 20 min, washed in 1% Triton X-
100 and dissolved in SDS buffer. All samples were analyzed by SDS ⁄ PAGE and quantified by phosphorimager scanning. (A) Autoradiogram
of SDS ⁄ PAGE gel containing wild-type and Arg312His actin with DMSO (0.1% v ⁄ v; vehicle control), the proteasome inhibitor MG132
(25 l
M), Met-Ub (1 mg mL
)1
), and EDTA (8 mM). The numbers are the chase period in hours and P is the pelleted non-Triton X-100 soluble
fraction at t ¼ 4 h. (B) Quantified phosphorimager scanning of the full length soluble actin band calculated relative to t ¼ 0 values. DMSO
(d), MG132 (s), Met-Ub (,) and EDTA (.). (C) Bar representation of Triton X-100 insoluble actin aggregates relative to wild-type DMSO val-
ues. Only the 42 kDa actin band was scanned and the wild-type DMSO fraction was set to 1. (D) Scanning of high molecular mass ubiquiti-
nated actin relative to the wild-type DMSO soluble sample at 4 h. Ubiquitinated actin was defined as the scanning of all radioactive material
running slower than 42 kDa in the SDS gel. Triton X-100 soluble samples (unfilled bars) and Triton X-100 insoluble samples (filled bars).
S. Vang et al. Misfolding of actin variants in cardiomyopathies
FEBS Journal 272 (2005) 2037–2049 ª 2005 FEBS 2043
and images were processed using Adobe photoshop.
Because neither HEK-293 cells nor COS-7 cells are
muscle cells, and do not contain sarcomeres, one can
question the physiological relevance of actin expression
in these cells. However, as wild-type a -cardiac actin is
capable of incorporating into cytoskeletal actin fibers,
they may mimic the development of HCM and DCM
at a sufficient level to distinguish and grade the actin
variants.
The red fluorescent phalloidin stained the actin fila-

ments, composed of either endogenous actin only or a
combination of endogenous and exogenous actin. In
the cell lines used, this gave rise to a discrete staining
of the outer cell boundaries and only to a lesser extent
the actin cables in the cytosol (Fig. 5). The c-Myc tar-
geted green fluorescence stained the actin coded by the
transfected actin cDNA only – both as part of the
actin filament and as nonincorporated actin molecules.
By merging the red and green signal, the intracellular
localization of mutated actin as well as its ability to be
incorporated in actin filaments could be evaluated.
c-Myc-tagged wild-type actin mostly colocalized with
phalloidin-stained actin filaments, indicating correct
processing and filament formation of tagged actin. The
Tyr166Cys, Ala295Ser and Ala331Pro mutant actin
proteins colocalized with actin filaments similar to the
wild-type with a clear c-Myc staining in the cell cyto-
skeleton but also some diffuse staining juxtaposed to
the nucleus. The Glu99Lys, Pro164Ala, Met305Leu,
Arg312His and Glu361Gly mutant proteins were distri-
buted evenly throughout the cytosol with no apparent
colocalization with the phalloidin stained actin. These
findings are in agreement with the in vitro results
above, showing that variant actins, which are impaired
in folding and have an increased tendency to become
insoluble, also fail to be incorporated in filaments. It is
even noticeable that variants having a less severe fold-
ing deficiency in vitro like the Met305Leu actin also
have slightly better filament incorporation in vivo.
Culturing cells transfected with wild-type or mutant

actin with the proteasomal inhibitor MG132 overnight
before fixation caused neither any further accumula-
tion of actin in the cytosol, nor any formation of
aggregates, as judged by the immunofluorescence ana-
lysis (data not shown).
Fig. 5. Only correctly folded actin proteins can incorporate into
fibers. COS-7 cells transiently transfected with c-Myc tagged actin
wild-type and mutant variants and stained for nuclei (Hoechst
33258, blue), filamentous actin (phalloidin, red) and transfected
actin (c-Myc antibodies, green) followed by confocal laser scanning
microscopy. Colocalization of filamentous actin and transfected
actin lead to yellow color. Plus and minus symbols indicate colocali-
zation with the cell cytoskeleton. Mock transfected cells showed
no cross reactivities from the c-Myc antibody. Transfection with a
vector expressing the green fluorescent protein (GFP) served as a
positive control for the transfection procedure giving a transfection
frequency of approximately 60%. Amino acid substitutions in bold
type face lead to DCM. The results are representative of three sep-
arate experiments.
Misfolding of actin variants in cardiomyopathies S. Vang et al.
2044 FEBS Journal 272 (2005) 2037–2049 ª 2005 FEBS
Discussion
Mutations in the a-cardiac actin gene may lead to re-
modeling of the heart and cause either HCM or DCM.
The prevailing hypothesis states that the mutated gene
product can be incorporated into actin fibers and
exerts a negative effect on the gene product from the
normal allele [3]. However, an initial requirement for
fiber incorporation is proper folding to a native-like
actin structure maintained by the protein quality con-

trol system. In addition to a stable structure, the actin
variant must still be able to bind its many regulatory
binding proteins for proper polymerization [23]. Sev-
eral examples exist of disease-related missense varia-
tions leading to incomplete folding with a variety of
consequences for the cell. To test these events, we
expressed the wild-type and eight actin variant proteins
in an in vitro translation system using rabbit reticulo-
cyte extracts. Using this system, we found a subset of
the mutant proteins to have altered chaperone inter-
action kinetics, as visualized on native nondenaturing
PAGE. The most severe folding-defective variant pro-
tein and the one with the highest tendency to remain
in complex with the TRiC chaperonin was Arg312His
actin, which is found in one patient with DCM. For
this mutant, the amount of soluble TRiC-bound actin
decreased over time. This suggests that actin folding is
an iterative process in which each cycle of binding and
release from the chaperonin can fold a subset of the
mutant actin proteins; however, with reduced efficiency
compared to the wild-type (Fig. 2C).
The fraction of unfolded mutant protein was
assessed by performing two types of folding assays.
First, a mild digestion with proteinase K, which pro-
duces a 34 kDa C-terminal fragment. There are drastic
differences in the protease susceptibility of different
mutant actins, suggesting different degrees of folding.
A common trait is the size of the product, indicating
the eventual formation of a wild-type-like structure.
The second assay involves binding of native actin by

DNase I conjugated beads. Through this assay we saw
that folded, full length wild-type, but not specific
mutants of actin, bind to DNase I. Both assays taken
together indicate that some mutants have an impaired
folding pathway. Our results show that all actin
mutants can be folded to the mature form, but with
widely varying efficiency (Fig. 3).
Increased turnover of mutant proteins is character-
ized in several hereditary diseases, exemplified by the
elimination of missense variations in phenylalanine
hydroxylase leading to phenylketonuria and short-
chain acyl-CoA dehydrogenase (SCAD) missense vari-
ant proteins, leading to SCAD deficiency [25,31,32], as
well as deficiencies in other metabolic and tumor sup-
pressor genes [33–36]. These conditions are inherited
by autosomal recessive transmission whereby misfolded
polypeptides are eliminated, leading to loss of function
and disease development. In cardiomyopathies caused
by mutations in the ACTC gene, the elimination of the
actin variant proteins before their incorporation into
fibers could either function as a positive modulator
and reduce the severity of the clinical phenotype, or as
a negative modulator to increase a haploinsufficiency
effect. A different pathology could arise from failure
to degrade misfolded actin variants and accumulation
of cell-toxic aggregates as seen in desmin-related cardio-
myopathy [37]. Indeed, the presence of filament oligo-
mers, the cytotoxic precursor of aggresomes, has been
identified in cardiomyocytes from both DCM and
HCM patients [38]. The genetic characterization for

these cardiomyocytes is, however, not accounted for.
During various cell stress situations, the protein qual-
ity control system may fail in processing the misfolded
proteins leading to further increase in accumulation.
Recent studies have shown that TRiC interacts with
a number of non-native proteins containing b-sheets,
including the von Hippel-Lindau tumor suppressor
protein [34] and the WD (tryptophan-aspartate) repeat
proteins [39]. A broader specificity towards b-sheet
containing proteins suggests that TRiC may suppress
aggregation of polyglutamine containing proteins in
neurodegenerative diseases [40]. It is possible that the
ability of TRiC to prevent aggregation of actin vari-
ants plays a role in the development of the disease,
and may underlie differences in the expression of a dis-
ease phenotype in different patients having the same
actin mutation.
In contrast to the fate of the above-mentioned and
many other misfolded proteins, the misfolded
Arg312His actin is not degraded by the ubiquitin-pro-
teasome system; at least not within the time scope and
experimental conditions in this study. Arg312His actin
rather accumulates in a Triton X-100 insoluble fraction.
Inhibition of the ligation of ubiquitin monomers to actin
(either partly or completely) increased the percentage of
actin found in the soluble fraction. This suggests that
polyubiquitinated but not unmodified actin mutants are
prone to become detergent-insoluble and aggregate.
This is consistent with examples of colocalization of
ubiquitin and aggregates in cells [41]. Extending the

experiment to all eight mutants showed a correlation
between the degrees of misfolding as judged by the pro-
teinase K resistance and DNase I binding assay, and
tendencies to form detergent-insoluble fractions (data
not shown). Calculating the theoretical change in aggre-
gation rate as a consequence of the mutations using the
S. Vang et al. Misfolding of actin variants in cardiomyopathies
FEBS Journal 272 (2005) 2037–2049 ª 2005 FEBS 2045
method described by Chiti et al. [42] gives aggregation
rates corresponding to the experimentally observed
aggregation tendency. The variant actins that are
impaired in folding and showed tendencies to become
insoluble in detergent in our analyses give an increased
calculated aggregation rate, with the Arg312His having
the highest rate increase (data not shown). This correla-
tion suggests a similarity between the actin-containing
aggregates and the ones found in amyloid deposits
in neurodegenerative diseases, rather than amorphous
unstructured aggregates [42].
Examination of mutant actin in intact cells reveals a
correlation between the degree of protein misfolding
and impairment of incorporation into filaments. This
suggests that diminished ability to form filaments is
caused by folding impairment. The nonfilamentous
mutant actin proteins appear diffuse throughout
the cytosol, apparently without being degraded by the
ubiquitin proteasome system, as treatment with the
potent proteasomal inhibitor MG132 did not result in
increased accumulation of misfolded actin (not shown).
The inability of misfolded actin monomers to form

filaments raises the question whether the negative dom-
inance of the disease is evolving from the filaments
with incorporated variant actin proteins as previously
suggested [7–10] or from negative effects of misfolded
actin molecules in the cytosol. Genetic heterogeneity
and different environmental factors may modify the
residual folding efficiency of the mutant proteins, and
thereby exert modulation on the clinical expression. To
further define such modifying factors, inbred rodent
models with controlled genetic and environmental
backgrounds will be imperative.
A recent HCM study showed no specific phenotype
associated with ACTC mutations [8]. Reviewing the
clinical data, there seems, interestingly, to be a correla-
tion between the severity of the disease and the ability
of the variant actin to incorporate into filaments. In
patients carrying mutations giving rise to actin proteins
capable of incorporating into fibers (Tyr166Cys,
Ala295Ser, and Ala331Pro), only five out of 19 were
symptomatic, whereas eight out of nine were sympto-
matic when the actin protein had reduced ability to
incorporate (Glu99Lys, Pro164Ala and Met305Leu;
P < 0.005, Fisher’s Exact test). This may arise from
the reduced amount of actin filament (haploinsuffi-
ciency), or from stressful cellular situations resulting
from the accumulation of misfolded and ⁄ or aggregated
actin protein. Based on data from this study and the
fact that toxic oligomers previously have been
described in HCM [38], the latter seems to be the most
likely. These findings, however, must be interpreted

with caution because of the small number of patients.
In general, distinct mutations in sarcomeric proteins
cause either dilated or hypertrophic cardiomyopathy;
no mutation can lead to both DCM and HCM, disre-
garding end stage dilation in HCM. This suggests that
the mutations initiate different series of events that
remodel the heart. We show that both DCM-causing
ACTC mutations encode actin variants with inefficient
folding and perturbed filament formation, whereas
only half of the HCM-causing ACTC mutations (three
out of six) encode actin proteins that appear misfolded
by the criteria employed here. It is therefore tempting
to speculate that the inability to form myofilaments
and ⁄ or the accumulation of aggregates as a result of
protein misfolding could be one of the cellular patho-
logical effects of a mutation that influence the direc-
tion of cardiac remodeling towards either HCM or
DCM. Previous mouse models and myotube assays
have been used to study the effect of sarcomeric varia-
tions; however, the causal molecular mechanisms
underlying these effects have never before been stud-
ied. The effect of impaired protein folding precedes the
potential effect of the malfunctioning variant protein.
The presence of misfolded proteins may influence the
cellular stress level and impair the Ca
2+
sensitivity of
the myocyte.
The finding that protein misfolding and the influence
from the protein quality control system may have effects

on clinical progression of DCM and HCM is a para-
digm shift for these types of cardiomyopathies. Research
into this new avenue may give a basis to design novel
therapeutic strategies and new categories of model
systems like those pursued in amyloidosis diseases inclu-
ding Alzheimer’s and Parkinson’s disease [17].
Experimental procedures
Plasmids
The complete ACTC cDNA sequence was obtained using
the IMAGE clone CM147-m7 as template in a PCR reac-
tion using Pfu Turbo polymerase from Stratagene (La Jolla,
CA, USA). The forward primer contains a KpnI site and an
optimized Kozak sequence (GGTACCGCCACCATG), and
the reverse primer contains an XhoI site. The PCR product
was purified and ligated into the KpnI ⁄ XhoI site of the
pcDNA3.1 vector (Invitrogen, Carlsbad, CA, USA). Muta-
genesis was performed using the Quick change kit (Strata-
gene). All clones were checked for mutagenesis and the
absence of PCR-induced errors. For constructing a c-Myc
His-tagged chimeric actin, a PCR product from the same
forward primer and a reverse primer bearing an XhoI
restriction site substituting the stop codon was inserted into
the KpnI ⁄ XhoI site in the pcDNA3.1 ⁄ Myc-His A vector
Misfolding of actin variants in cardiomyopathies S. Vang et al.
2046 FEBS Journal 272 (2005) 2037–2049 ª 2005 FEBS
(Invitrogen). The Expand High Fidelity polymerase from
Roche (Basel, Switzerland) was used.
In vitro transcription/translation
In vitro protein biosynthesis was carried out using TNT
Quick Coupled Transcription ⁄ Translation Systems (Prome-

ga, Madison, WI, USA) as recommended by the supplier.
Radioactive labeling was performed using [
35
S]methionine
(10 lCiÆlL
)1
; Amersham Pharmacia Biotech, Little Chal-
font, Buckinghamshire, UK). The transcription ⁄ translation
reactions were incubated at 37 °C, and the translation pro-
cess was terminated using cycloheximide in a final concen-
tration of 150 lgÆmL
)1
. In pulse-chase reactions, the
samples were desalted prior to the chase period on a Micro
Bio-Spin 30 column (Bio-Rad, Hercules, CA, USA) in de-
salting buffer (20 mm Hepes, pH 7.4, 100 mm potassium
acetate, 5 mm magnesium acetate, 1 mm dithiothreitol) and
an ATP regenerating system was added (1 mm ATP,
1 lgÆlL
)1
creatine phosphokinase, 10 mm phosphocreatine).
Chase was performed at 37 °C. The protein product was
analyzed by native (nondenaturing) PAGE (4–15%
Tris ⁄ HCl Criterion gels from Bio-Rad) and SDS ⁄ PAGE
(12.5% Tris ⁄ HCl Criterion gels from Bio-Rad). Samples
for SDS ⁄ PAGE analysis were denatured by heating to
95 °C for 5 min in SDS sample buffer [350 mmolÆ L
)1
Tris ⁄ HCl, pH 6.8, 30% (v ⁄ v) glycerol, 10% (w ⁄ v) SDS,
9.3% (v ⁄ v) dithiothreitol, 0.12 mgÆmL

)1
Bromophenol
blue]. Purified DNase I (grade D) was from Worthington
(Lakewood, NJ, USA). The gels were dried and the radio-
labeled protein products were visualized on an Amersham
Biosciences PhosphorImager (STORM 840). Quantification
was carried out using the imagequant software.
Immunoblotting and immunoprecipitation
In vitro translated actin was separated by native PAGE and
blotted on to poly(vinylidene difluoride) membrane using a
transfer buffer containing 50 mm boric acid, blocked in 5%
(w ⁄ v) nonfat milk and immunoblotted with anti-(rat TCP-1a)
monoclonal Igs (CTA-122; StressGen, Victoria, Canada).
Secondary HRP conjugated mouse anti-(rat IgG) Ig
(80–9520; Zymed, San Francisco, CA, USA) was added and
visualized by chemiluminescence using the ECL Plus western
blotting detection reagent (Amersham Biosciences). Direct
image analysis was carried out by phosphorimaging.
Immunoprecipitation was performed on in vitro transla-
ted actin polypeptides using anti-(rat TCP-1 a) monoclonal
Igs. Protein G-coupled Sepharose beads (Amersham Bio-
science) were washed in NP-40 buffer (150 mm NaCl,
50 mm Tris pH 8.0, 1 mm phenylmethylsulfonyl fluoride),
incubated with the antibody at 4 °C for 60 min and washed
three times. Reticulocyte lysate containing freshly translated
wild-type or mutant actin was added and incubated at 4 °C
for 60 min. The beads were precipitated, washed three times
in NP-40 buffer, separated by SDS ⁄ PAGE and visualized
by phosphorimaging.
Folding efficiency assays

Radioactively labeled wild-type and mutant actin from
in vitro translation (37 °C for 30 min) was treated by add-
ing 25 lgÆmL
)1
proteinase K (Sigma, St. Louis, MO, USA)
in NaCl ⁄ P
i
at 20 °C for 15 min. Protease activity was
stopped with 10 mm phenylmethylsulfonyl fluoride on ice
for 10 min, samples were heated to 95 °C for 5 min in SDS
sample buffer and separated by SDS ⁄ PAGE and visualized
by phosphorimaging. DNase I was coupled to Sepharose
beads and incubated with actin as described previously [43].
In brief, radioactively labeled wild-type and mutant actin
from in vitro translation reactions (37 °C for 30 min) was
incubated with the Sepharose coupled DNase I on ice for
60 min, washed, eluted in SDS sample buffer containing
40% (v ⁄ v) formamide for 5 min at 95 °C and separated by
SDS ⁄ PAGE and visualized by phosphorimaging.
Ubiquitination and aggregation assay
In vitro transcription and translation was performed in reti-
culocyte extract at 37 °C for 30 min, stopped with cyclo-
heximide and treated with DMSO, the ubiquitination
inhibitor MG-132 from Calbiochem (#474790), methylated
ubiquitin from Sigma (#U1632), or EDTA during chase
intervals at 37 °C. Aliquots taken at t ¼ 0, 2 and 4 h were
briefly centrifuged at 16 000 g. An aliquot taken at t ¼ 4h
was centrifuged at 16 000 g and soluble material was
removed by washing in 1% (v ⁄ v) Triton X-100. All samples
were separated by SDS ⁄ PAGE and visualized and quanti-

fied by phosphorimaging.
Immunofluorescence
HEK-293 (ATCC CRL-1573) and COS-7 (ATCC CRL-
1651) cells were cultured in Dulbecco’s modified Eagle med-
ium, high glucose formulation (Gibco-BRL, Paisley, UK)
containing 10% (v ⁄ v) heat inactivated fetal bovine serum
(Gibco-BRL), 100 unitsÆmL
)1
penicillin (Leo, Ballerup,
Denmark), 0.1 mgÆmL
)1
streptomycin (Leo) in 5% CO
2
,
95% air (v ⁄ v) at 37 °C. The cells were seeded in 10 cm
2
slideflasks (Nunc, Roskilde, Denmark) and transiently
transfected with c-Myc His-tagged actin cDNA constructs
using the FuGENE 6 transfection reagent (Roche, Indi-
anapolis, IN, USA) according to supplier’s recommenda-
tions. 48 h after transfection, the cells were washed in
NaCl ⁄ P
i
, fixed in freshly prepared 4% (w ⁄ v) paraformalde-
hyde (Merck, Darmstadt, Germany) for 15 min. Immuno-
staining of transfected actin was done using the 9E10
monoclonal antibody against the c-Myc tag (Research
Diagnostics Inc., Flanders, NJ, USA) as primary antibody,
S. Vang et al. Misfolding of actin variants in cardiomyopathies
FEBS Journal 272 (2005) 2037–2049 ª 2005 FEBS 2047

and goat antimouse antibody conjugated to Alexa Fluor
dye (#A21131; Molecular Probes, Leiden, the Netherlands)
as secondary antibody. Nuclei were stained with Hoechst
33258 and Texas Red-X-phalloidin (#T7471; Molecular
Probes) was used for F-actin staining. Visualization was
performed by confocal laser scanning microscopy (Leica
Microsystems AG, Wetzlar, Germany).
Acknowledgements
This work was supported by the Danish Heart Foun-
dation, The Danish National Research Foundation,
Aarhus University Hospital’s Research Initiative, and
The Clinical Institute, University of Aarhus, Denmark.
References
1 Maron BJ (1997) Hypertrophic cardiomyopathy. Lancet
350, 127–133.
2 Fatkin D & Graham RM (2002) Molecular mechanisms
of inherited cardiomyopathies. Physiol Rev 82, 945–980.
3 Seidman CE & Seidman JG (2001) Hypertrophic cardio-
myopathy. In The Metabolic and Molecular Bases of
Inherited Diseases (Scriver CR, Beaudet AL, Valle D,
Sly WS, Vogelstein B, Childs B & Kinzler K, eds), pp.
5433–5450. McGraw-Hill Education, New York.
4 Bonne G, Carrier L, Richard P, Hainque B & Schwartz
K (1998) Familial hypertrophic cardiomyopathy: from
mutations to functional defects. Circ Res 83, 580–593.
5 Andersen PS, Havndrup O, Bundgaard H, Larsen LA,
Vuust J, Pedersen AK, Kjeldsen K & Christiansen M
(2004) Genetic and phenotypic characterization of muta-
tions in myosin-binding protein C (MYBPC3) in 81
families with familial hypertrophic cardiomyopathy:

total or partial haploinsufficiency. Eur J Hum Genet 12,
673–677.
6 Towbin JA & Bowles NE (2002) The failing heart.
Nature 415, 227–233.
7 Mogensen J, Klausen IC, Pedersen AK, Egeblad H,
Bross P, Kruse TA, Gregersen N, Hansen PS, Baandrup U
& Børglum AD (1999) Alpha-cardiac actin is a novel
disease gene in familial hypertrophic cardiomyopathy.
J Clin Invest 103, R39–R43.
8 Mogensen J, Perrot A, Andersen PS, Havndrup O,
Klausen IC, Christiansen M, Bross P, Egeblad H,
Bundgaard H, Osterziel KJ et al. (2004) Clinical and
genetic c haracter istics of alpha c ardiac actin gene mutations
in hypertrophic cardiomyopathy. J Med Genet 41, e10.
9 Olson TM, Michels VV, Thibodeau SN, Tai YS &
Keating MT (1998) Actin mutations in dilated cardio-
myopathy, a heritable form of heart failure. Science
280, 750–752.
10 Olson TM, Doan TP, Kishimoto NY, Whitby FG,
Ackerman MJ & Fananapazir L (2000) Inherited and
de novo mutations in the cardiac actin gene cause hyper-
trophic cardiomyopathy. J Mol Cell Cardiol 32, 1687–
1694.
11 Chen J & Chien KR (1999) Complexity in simplicity:
monogenic disorders and complex cardiomyopathies.
J Clin Invest 103, 1483–1485.
12 Dipple KM & McCabe ER (2000) Phenotypes of
patients with ‘simple’ Mendelian disorders are complex
traits: thresholds, modifiers, and systems dynamics. Am
J Hum Genet 66, 1729–1735.

13 Gregersen N, Bolund L & Bross P (2003) Protein mis-
folding, aggregation, and degradation in disease. Meth-
ods Mol Biol 232, 3–16.
14 Lindquist S & Craig EA (1988) The heat-shock proteins.
Annu Rev Genet 22, 631–677.
15 Frydman J (2001) Folding of newly translated proteins
in vivo: the role of molecular chaperones. Annu Rev Bio-
chem 70, 603–647.
16 Hartl FU & Hayer-Hartl M (2002) Molecular chaper-
ones in the cytosol: from nascent chain to folded pro-
tein. Science 295, 1852–1858.
17 Barral JM, Broadley SA, Schaffar G & Hartl FU (2004)
Roles of molecular chaperones in protein misfolding dis-
eases. Semin Cell Dev Biol 15, 17–29.
18 McClellan AJ & Frydman J (2001) Molecular chaper-
ones and the art of recognizing a lost cause. Nat Cell
Biol 3, E51–E53.
19 Goldberg AL (2003) Protein degradation and protection
against misfolded or damaged proteins. Nature 426,
895–899.
20 Frydman J & Hartl FU (1996) Principles of chaperone-
assisted protein folding: differences between in vitro and
in vivo mechanisms. Science 272, 1497–1502.
21 Frydman J, Nimmesgern E, Ohtsuka K & Hartl FU
(1994) Folding of nascent polypeptide chains in a high
molecular mass assembly with molecular chaperones.
Nature 370, 111–117.
22 Hansen WJ, Cowan NJ & Welch WJ (1999) Prefoldin-
nascent chain complexes in the folding of cytoskeletal
proteins. J Cell Biol 145, 265–277.

23 Rommelaere H, Waterschoot D, Neirynck K, Vandek-
erckhove J & Ampe C (2003) Structural plasticity of
functional actin: pictures of actin binding protein
and polymer interfaces. Structure (Camb) 11, 1279–
1289.
24 Costa CF, Rommelaere H, Waterschoot D, Sethi KK,
Nowak KJ, Laing NG, Ampe C & Machesky LM
(2004) Myopathy mutations in alpha-skeletal-muscle
actin cause a range of molecular defects. J Cell Sci 117,
3367–3377.
25 Pedersen CB, Bross P, Winter VS, Corydon TJ, Bolund
L, Bartlett K, Vockley J & Gregersen N (2003) Misfold-
ing, degradation, and aggregation of variant proteins.
The molecular pathogenesis of short chain acyl-CoA
Misfolding of actin variants in cardiomyopathies S. Vang et al.
2048 FEBS Journal 272 (2005) 2037–2049 ª 2005 FEBS
dehydrogenase (SCAD) deficiency. J Biol Chem 278,
47449–47458.
26 Siegers K, Waldmann T, Leroux MR, Grein K, Shev-
chenko A, Schiebel E & Hartl FU (1999) Compart-
mentation of protein folding in vivo: sequestration of
non-native polypeptide by the chaperonin-GimC
system. EMBO J 18, 75–84.
27 Haas AL & Rose IA (1981) Hemin inhibits ATP-depen-
dent ubiquitin-dependent proteolysis: role of hemin in
regulating ubiquitin conjugate degradation. Proc Natl
Acad Sci USA 78, 6845–6848.
28 Higashi-Fujime S, Suzuki M, Titani K & Hozumi T
(1992) Muscle actin cleaved by proteinase K: its poly-
merization and in vitro motility. J Biochem (Tokyo)

112, 568–572.
29 Haas AL & Siepmann TJ (1997) Pathways of ubiquitin
conjugation. FASEB J 11, 1257–1268.
30 Hershko A & Heller H (1985) Occurrence of a polyubi-
quitin structure in ubiquitin-protein conjugates. Biochem
Biophys Res Commun 128, 1079–1086.
31 Corydon TJ, Bross P, Jensen TG, Corydon MJ, Lund TB,
Jensen UB, Kim JJ, Gregersen N & Bolund L (1998)
Rapid degradation of short-chain acyl-CoA dehydrogen-
ase variants with temperature-sensitive folding defects
occurs after import into mitochondria. J Biol Chem 273,
13065–13071.
32 Waters PJ (2003) How PAH gene mutations cause hyper-
phenylalaninemia and why mechanism matters: insights
from in vitro expression. Hum Mutat 21, 357–369.
33 Blagosklonny MV, Toretsky J & Neckers L (1995) Gel-
danamycin selectively destabilizes and conformationally
alters mutated p53. Oncogene 11, 933–939.
34 Feldman DE, Spiess C, Howard DE & Frydman J
(2003) Tumorigenic mutations in VHL disrupt folding
in vivo by interfering with chaperonin vinding. Mol Cell
12, 1213–1224.
35 Ory K, Legros Y, Auguin C & Soussi T (1994) Analysis
of the most representative tumour-derived p53 mutants
reveals that changes in protein conformation are not
correlated with loss of transactivation or inhibition of
cell proliferation. EMBO J 13, 3496–3504.
36 Qu BH & Thomas PJ (1996) Alteration of the cystic
fibrosis transmembrane conductance regulator folding
pathway. J Biol Chem 271, 7261–7264.

37 Vicart P, Caron A, Guicheney P, Li Z, Prevost MC,
Faure A, Chateau D, Chapon F, Tome F, Dupret JM
et al. (1998) A missense mutation in the alphaB-crystal-
lin chaperone gene causes a desmin-related myopathy.
Nat Genet 20, 92–95.
38 Sanbe A, Osinska H, Saffitz JE, Glabe CG, Kayed R,
Maloyan A & Robbins J (2004) Desmin-related cardio-
myopathy in transgenic mice: a cardiac amyloidosis.
Proc Natl Acad Sci USA 101, 10132–10136.
39 Craig EA (2003) Eukaryotic chaperonins: lubricating the
folding of WD-repeat proteins. Curr Biol 13, R904–R905.
40 Nollen EA, van Garcia SMHG, Kim S, Chavez A,
Morimoto RI & Plasterk RH (2004) Genome-wide
RNA interference screen identifies previously unde-
scribed regulators of polyglutamine aggregation. Proc
Natl Acad Sci USA 101, 6403–6408.
41 Johnston JA, Ward CL & Kopito RR (1998) Aggre-
somes: a cellular response to misfolded proteins. J Cell
Biol 143, 1883–1898.
42 Chiti F, Stefani M, Taddei N, Ramponi G & Dobson
CM (2003) Rationalization of the effects of mutations
on peptide and protein aggregation rates. Nature 424,
805–808.
43 Thulasiraman V, Ferreyra RG & Frydman J (2000)
Monitoring actin folding. Purification protocols for
labeled proteins and binding to DNase I-sepharose
beads. Methods Mol Biol 140, 161–167.
44 Koradi R, Billeter M & Wu
¨
thrich K (1996) MOLMOL:

a program for display and analysis of macromolecular
structures. J Mol Graph 14 , 51–32.
S. Vang et al. Misfolding of actin variants in cardiomyopathies
FEBS Journal 272 (2005) 2037–2049 ª 2005 FEBS 2049