Báo cáo khoa học: Expression profiling reveals differences in metabolic gene expression between exercise-induced cardiac effects and maladaptive cardiac hypertrophy pot

Expression profiling reveals differences in metabolic gene
expression between exercise-induced cardiac effects and
maladaptive cardiac hypertrophy
Claes C. Strøm
1
, Mark Aplin
1
, Thorkil Ploug
2
, Tue E. H. Christoffersen
1
, Jozef Langfort
3
,
Michael Viese
2
, Henrik Galbo
2
, Stig Haunsø
1
and Søren P. Sheikh
1
1 CHARC (Copenhagen Heart Arrhythmia Research Center), Department of Medicine B, H:S Rigshospitalet, University of Copenhagen
Medical School, Denmark
2 Copenhagen Muscle Research Centre, Department of Medical Physiology, Panum Institute, University of Copenhagen, Denmark
3 Laboratory of Experimental Pharmacology, Polish Academy of Science, Warsaw, Poland
Keywords
adaptive; DNA microarray; gene expression;
hypertrophy; maladaptive
Correspondence
S. P. Sheikh, Laboratory of Molecular

Cardiology, Department of Medicine B,
H:S Rigshospitalet, University of
Copenhagen, 20 Juliane Mariesvej,
DK-2100 Copenhagen, Denmark
Fax: +45 3545 6500
Tel: +45 3545 6730
E-mail:
(Received 10 October 2004, revised 15
March 2005, accepted 22 March 2005)
doi:10.1111/j.1742-4658.2005.04684.x
While cardiac hypertrophy elicited by pathological stimuli eventually leads
to cardiac dysfunction, exercise-induced hypertrophy does not. This sug-
gests that a beneficial hypertrophic phenotype exists. In search of an under-
lying molecular substrate we used microarray technology to identify
cardiac gene expression in response to exercise. Rats exercised for seven
weeks on a treadmill were characterized by invasive blood pressure mea-
surements and echocardiography. RNA was isolated from the left ventricle
and analysed on DNA microarrays containing 8740 genes. Selected genes
were analysed by quantitative PCR. The exercise program resulted in car-
diac hypertrophy without impaired cardiac function. Principal component
analysis identified an exercise-induced change in gene expression that was
distinct from the program observed in maladaptive hypertrophy. Statistical
analysis identified 267 upregulated genes and 62 downregulated genes in
response to exercise. Expression changes in genes encoding extracellular
matrix proteins, cytoskeletal elements, signalling factors and ribosomal pro-
teins mimicked changes previously described in maladaptive hypertrophy.
Our most striking observation was that expression changes of genes
involved in b-oxidation of fatty acids and glucose metabolism differentiate
adaptive from maladaptive hypertrophy. Direct comparison to maladaptive
hypertrophy was enabled by quantitative PCR of key metabolic enzymes

including uncoupling protein 2 (UCP2) and fatty acid translocase (CD36).
DNA microarray analysis of gene expression changes in exercise-induced
cardiac hypertrophy suggests that a set of genes involved in fatty acid and
glucose metabolism could be fundamental to the beneficial phenotype of
exercise-induced hypertrophy, as these changes are absent or reversed in
maladaptive hypertrophy.
Abbreviations
ACE, angiotensin converting enzyme; ALP, actinin a2 associated LIM protein; EST, expressed sequence tag; FABP4, fatty acid binding
protein 4; FACL, fatty acid CoA ligase; FDR, false discovery rate; GCKR, glucokinase regulatory protein; HR, heart rate; LVEDP, left
ventricular end diastolic pressure; MAP, mean arterial pressure; MBE, model based expression; MYL, fast myosin alkali light chain; PCA,
principal component analysis; PDC, pyruvate dehydrogenase complex; PDP, pyruvate dehydrogenase phosphatase; Slc27a1, fatty acid
transport protein 4; UCP2, uncoupling protein 2.
2684 FEBS Journal 272 (2005) 2684–2695 ª 2005 FEBS
Heart disease is a leading cause of death in the West-
ern world and is commonly associated with cardiac
hypertrophy. Sustained cardiac hypertrophy leads to
cardiac dysfunction, heart failure, arrhythmia and
sudden death. As a result, cardiac hypertrophy is an
independent risk factor for cardiac morbidity and
mortality [1].
Exercise-induced cardiac hypertrophy is distinct
from the hypertrophy seen in different pathological
settings, as it is not accompanied by cardiac dysfunc-
tion or increased morbidity [2,3]. This intriguing dis-
tinction has led to the concepts of maladaptive and
adaptive forms of cardiac hypertrophy. While gene
expression changes in maladaptive cardiac hypertrophy
have been extensively investigated, much less is known
about transcriptional regulation in exercise-induced
hypertrophy. Identification of a set of genes unique to

this condition would enhance our understanding of the
molecular differences between maladaptive and adap-
tive cardiac hypertrophy.
Exercise training increases the functional capacity of
the cardiovascular system. The adaptations include
increases in cardiac mass and dimension, maximum oxy-
gen consumption and coronary blood flow [4]. Also,
exercise results in a balanced growth of cardiomyocytes
with normal myofibril to mitochondrial ratio [5,6]. In
the setting of maladaptive hypertrophy, a shift from
fatty acids to glucose as the main fuel in the myocar-
dium has been described, and is in part caused by down-
regulation of gene products involved in b-oxidation of
fatty acids [7]. Whether this metabolic shift also occurs
in adaptive hypertrophy remains to be established.
Although the physiological and morphological chan-
ges during cardiac adaptations to exercise are well
characterized, little is known about the underlying
molecular changes.
Evidence that adaptive and maladaptive hypertrophic
cardiac phenotypes result from activation of distinct sig-
nalling pathways has come from studies demonstrating
that exercise-induced hypertrophy is not prevented by
angiotensin II receptor blockade or cyclosporine treat-
ment [8,9]. Also, several authors have demonstrated that
expression of marker genes including atrial natriuretic
peptide, myosin heavy chain isoforms and thyroid
hormone receptor isoforms differ between adaptive
and maladaptive hypertrophy [10–12]. A comprehensive
analysis of the gene expression changes in exercise-

induced cardiac hypertrophy, however, is lacking. Such
an approach may identify shared and divergent mole-
cular networks between adaptive and maladaptive
hypertrophy and point to new therapeutic strategies.
The microarray technology allows simultaneous
analysis of the expression level of thousands of genes
making this technology well suited for comprehensive
analysis of gene expression changes in response to phy-
siological challenges. DNA microarrays have been use-
ful in analysis of cellular responses to stimuli, animal
models of human disease and cancer classification
[13,14].
We used DNA microarrays to define gene expression
changes that characterize exercise-induced cardiac
hypertrophy. We identified 305 genes with differential
expression in response to cardiac exercise, the majority
of which have not previously been associated with
exercise. The most directly interpretable and poten-
tially biologically important finding was a reversed
metabolic shift in response to exercise suggesting that
genes involved in fatty acid and glucose metabolism
are key regulatory points that distinguish adaptive
beneficial hypertrophy from more adverse maladaptive
forms elicited by pathological stimuli.
Results
Physiological response to exercise
Several pieces of data indicated that exercised rats had
cardiac hypertrophy as compared to the sedentary con-
trol animals. First, training resulted in an  25%
increase in left and right ventricular masses when nor-

malized to lean body weight (Table 1) and a 10%
increase when compared to tibial length (data not
shown). Other organ weights were unchanged (lungs,
kidney and stomach) after normalization (Table 1).
Absolute cardiac weights were increased but not signi-
ficantly, while other organ weights were significantly
Table 1. Organ weights. Values are mean ± SEM. Weights (W) of
heart (H), left ventricle (LV), right ventricle (RV), lungs (P), kidney (K)
and stomach (S) divided by lean (L) body (B) weight (mgÆg
0.78
)1
).
Exercised Sedentary
BW 350 ± 5* 429 ± 9
Tibia 40.2 ± 0.3 41.5 ± 0.7
HW 1.10 ± 0.04 1.07 ± 0.02
LVW 0.73 ± 0.02 0.69 ± 0.02
RVW 0.18 ± 0.01 0.17 ± 0.01
PW 1.18 ± 0.03* 1.32 ± 0.03
KW 1.20 ± 0.05* 1.36 ± 0.04
SW 1.70 ± 0.06* 1.91 ± 0.04
HW ⁄ BWL 11.4 ± 0.4* 9.5 ± 0.1
LVW ⁄ BWL 7.6 ± 0.2* 6.1 ± 0.1
RVW ⁄ BWL 1.9 ± 0.1* 1.5 ± 0.1
PW ⁄ BWL 12.3 ± 0.3 11.6 ± 0.1
KW ⁄ BWL 12.4 ± 0.5 12.0 ± 0.3
SW ⁄ BWL 17.7 ± 0.6 16.9 ± 0.3
*P < 0.05.
C. C. Strøm et al. Gene expression in exercise-induced cardiac hypertrophy
FEBS Journal 272 (2005) 2684–2695 ª 2005 FEBS 2685

reduced. A less intense training protocol resulted in
significant body weight reductions but no increase in
ventricular weights (data not shown). Secondly, echo-
cardiographic examination of the cardiac phenotype
revealed that exercised rats had increases in both left
ventricular wall thickness and left ventricular cavity
dimensions (Table 2). Anterior and posterior wall
thicknesses were both increased by 14% and left ven-
tricular area indexed to lean body mass increased 9%.
Cardiac function at rest, as determined by fractional
area of change (Table 2), left ventricular end diastolic
pressure (LVEDP), and maximal rate of isovolumetric
pressure development and decay (Table 3), was identi-
cal in the two groups, which is consistent with pre-
vious findings [15]. Mean arterial pressure showed
no differences between exercised and sedentary rats
(Table 3), but resting heart rate decreased 10% in
response to exercise. The decrease in resting heart rate
probably results from an increase stroke volume and
increased parasympathetic tone.
Thus, our exercise protocol resulted in a phenotype
of eccentric hypertrophy without impairment of car-
diac function.
Distinct global gene expression profiles between
exercised and sedentary animals
We first analysed the data for differences in global
gene expression patterns between exercised and con-
trol animals using a principal component analysis
(PCA). This type of analysis serves to reduce the
number of variables in multivariate data with mini-

mal loss of information. The PCA analysis based on
all 8740 genes clearly distinguished the gene expres-
sion profiles of hearts of exercised animals from
those of controls (Fig. 1). This finding indicated the
existence of a distinct gene expression program
induced by exercise.
Identification of individual genes that are
differentially expressed in response to exercise
Next, individual genes regulated by exercise were iden-
tified as described in Experimental procedures (Fig. 2).
The vast majority of genes were unchanged. At the
applied threshold [predefined to a false discovery rate
(FDR) of 5% or less], 329 genes were identified as dif-
ferentially regulated in response to exercise (marked
with grey in the figure). Of these, 267 genes were
upregulated while 62 genes were downregulated. The
upregulated genes represented 179 known genes, 66
expressed sequence tags (EST) and 22 replicate genes.
Among the downregulated genes were 43 known genes,
17 ESTs and two replicate probe sets. A subgroup of
the genes is listed in Table 4 and the full list of genes
is given in supplementary Table S1.
To demonstrate the specificity of the gene expression
changes, we randomly divided samples into two groups
of equal size and repeated the SAM analysis (see
Experimental procedures). This procedure was repeated
Table 2. Echocardiography. Values are mean ± SEM. AWT, Anter-
ior wall thickness; PWT, posterior wall thickness; d, diastole; LVA,
left ventricular area; BW, lean body weight; FAC, fractional area of
shortening.

AWTd
(cm)
PWTd
(cm)
LVAd ⁄ BW
(mm
2
Æg
)0.78
)
FAC
(%)
Exercised 0.205 ± 0.007* 0.195 ± 0.007* 4.97 ± 0.12* 77 ± 1
Sedentary 0.180 ± 0.003 0.171 ± 0.004 4.57 ± 0.09 78 ± 1
*P < 0.05.
Table 3. Left ventricular pressures. Values are mean ± SEM.
dP ⁄ dt-max, Maximal rates of isovolumetric pressure development;
dP ⁄ dt-min, maximal rates of isovolumetric pressure decay.
LVEDP
(mm Hg)
dP ⁄ dt-max
(m HgÆs
)1
)
dP ⁄ dt-min
(mHgÆs
)1
)
MAP
(mm Hg)

HR
(min
)1
)
Exercised 6.0 ± 0.7 7.9 ± 0.3 ) 10.1 ± 0.4 113 ± 2 347 ± 8*
Sedentary 4.1 ± 0.5 9.3 ± 0.6 ) 11.0 ± 0.6 111 ± 6 383 ± 9
*P < 0.05.
Fig. 1. Global gene expression in the hearts of exercised rats is dif-
ferent from that of sedentary controls. A principal component analy-
sis was performed on all genes (n ¼ 8740) to find trends in the
microarray data. The two first components (PC1 and PC2) from the
analysis are shown in the figure. Exercised rats clearly cluster sep-
arate from the sedentary controls indicating the existence of a dis-
tinct gene expression program induced by exercise.
Gene expression in exercise-induced cardiac hypertrophy C. C. Strøm et al.
2686 FEBS Journal 272 (2005) 2684–2695 ª 2005 FEBS
several times. No genes were identified as differentially
expressed in the randomized data sets as shown in
Fig. 3.
Confirmation of differential expression of
selected metabolic genes by quantitative PCR
From the interesting metabolic genes, six were chosen
for validation by quantitative PCR analysis. CD36,
fatty acid binding protein 4 (FABP4), fatty acid trans-
port protein (Slc27a1), and glucokinase regulatory pro-
tein (GCKR) were upregulated and uncoupling protein
2 (UCP2) was downregulated confirming the DNA
microarray data (Fig. 4). Expression of fatty acid CoA
ligase (FACL) was not significantly upregulated in the
quantitative PCR analysis of exercise-induced hyper-

trophy.
Expression of selected genes in maladaptive
hypertrophy
To compare expression of CD36 and UCP2 in adap-
tive and maladaptive hypertrophy we analysed expres-
sion of CD36 and UCP2 in the noninfarcted region of
the left ventricle 3 weeks after myocardial infarction
as compared to sham-operated animals. Contrary to
adaptive hypertrophy, where CD36 was upregulated
and UCP2 downregulated, CD36 expression was
unchanged and UCP2 expression increased (26%) in
maladaptive hypertrophy (Fig. 5).
Discussion
In this work, we present a comprehensive analysis of
transcriptional changes in response to exercise-induced
cardiac hypertrophy, thereby for the first time provi-
ding an overview of molecular clues to the adaptive
cardiac phenotype. We identified a distinct global gene
expression pattern of myocardium adapting to the
physiological challenge of exercise, and statistical ana-
lysis identified 267 upregulated and 62 downregulated
gene transcripts, providing a host of potential novel
diagnostic and therapeutic targets for further investiga-
tion.
The exercise resulted in a relatively small increase in
left ventricular mass (6%), which was in the same
range as that found by others after isotonic exercise
[10,16]. When normalized to body weight or tibial
length the increase in left ventricular mass was larger
and significant. Taken together with the fact that the

absolute weights of all other organs were significantly
reduced in the exercised animals, these data do support
that the exercise regime elicited cardiac hypertrophy.
The reduction in body weight seen in the exercised
animals most likely resulted from a combination of
reduced body fat and growth retardation. In line with
this, a pilot series of less intense exercise resulted in a
reduction in body weight (exercise 313 g vs. sedentary
403 g), concurrent reductions in absolute cardiac
weights, and no hypertrophy after normalization to
body weight or tibial length.
Fig. 2. Identification of differentially expres-
sed genes. A scatter plot of the observed
relative difference in gene expression vs.
the expected difference based on permuta-
tion of samples. At the solid line, observed
values are identical to expected values. The
applied threshold (delta ¼ 1.20) is shown as
dotted lines. Corresponding values of signifi-
cance threshold (delta), FDRs, number of
genes identified as differentially expressed
and the expected number of false positives
are listed in the lower right quadrant.
C. C. Strøm et al. Gene expression in exercise-induced cardiac hypertrophy
FEBS Journal 272 (2005) 2684–2695 ª 2005 FEBS 2687
Table 4. Expression changes in response to exercise. Gene names are listed with GenBank accession number; SAM score, fold change
(FC) and P-values calculated by a Welch t-test are listed for comparison.
Gene Accession number Score(d) FC P-value
Metabolism
Palmitoyl-protein thioesterase L34262 5.5 1.2 3.75E-04

Fatty acid binding protein 4 AI169612 3.8 1.2 3.34E-03
Fatty acid Coenzyme A ligase, long chain 4 AI236284 5.1 1.3 5.17E-04
Cd36 AA925752 4.5 1.3 1.21E-03
Fatty acid transport protein U89529 3.2 1.2 1.88E-02
Uncoupling protein 2, mitochondrial AB010743 ) 4.7 0.7 8.25E-04
Glucokinase regulatory protein AA945442 4.4 1.1 1.72E-03
Pyruvate dehydrogenase phosphatase AF062740 3.3 1.4 8.97E-03
Solute carrier 16 (monocarboxylic acid transporter), member 1 D63834 4.3 1.4 1.78E-03
Hexokinase 1 AI012593 3.3 1.2 8.41E-03
Phosphofructokinase, liver, B-type X58865 3.8 1.1 3.61E-03
Extracellular matrix
Biglycan U17834 3.3 1.3 1.74E-02
Matrix Gla protein AI012030 3.2 1.3 1.01E-02
Integrin alpha 7 X65036 3.4 1.2 7.93E-03
Laminin receptor 1 D25224 5.3 1.2 3.67E-04
Cystatin B AI008888 3.9 1.2 3.25E-03
Cystatin C AI231292 5.9 1.4 1.54E-04
Cathepsin L AI176595 3.8 1.1 5.88E-03
Cathepsin S L03201 3.5 1.5 7.97E-03
Cytoskeletal
Sarcosin AI639444 3.2 1.4 8.74E-03
Fast myosin alkali light chain (MYL1) L00088 3.4 1.5 1.03E-02
Talin AA800962 3.3 1.2 8.57E-03
Actinin alpha 2 associated LIM protein AF002281 3.2 1.2 1.13E-02
Arg ⁄ Abl-interacting protein (ArgBP2) AF026505 4.1 1.3 2.48E-03
Myosin light chain alkali, smooth-muscle isoform (MYL6) AA875523 4.4 1.3 1.29E-03
Non-muscle myosin alkali light chain, new-born, heart ventricle (MYL4) S77858 4.1 1.2 2.08E-03
Actin-related protein complex 1b AF083269 3.5 1.3 5.85E-03
Growth
Eukaryotic translation elongation factor 1 alpha 1 AI008852 4.4 1.2 3.83E-03

Eukaryotic translation elongation factor 2 AI178750 4.1 1.1 2.00E-03
Polymerase (RNA) II (DNA directed)polypeptide G Z71925 3.7 1.2 4.01E-03
Ribosomal protein L10a X93352 6.3 1.3 2.31E-04
Ribosomal protein S16 X17665 3.9 1.2 5.05E-03
Ribosomal protein L12 X53504 3.7 1.2 6.43E-03
Ribosomal protein S27 X59375 4.5 1.3 1.28E-03
PRKC, apoptosis, WT1, regulator U05989 ) 5.0 0.8 5.69E-04
BCL2-like 11 (apoptosis facilitator) AF065433 ) 4.4 0.9 1.25E-03
Discs, large homolog 3 (Drosophila) (Dlgh3) U50147 ) 3.9 0.8 3.56E-03
Disabled homolog 2 (doc2) U95178 4.9 1.4 7.47E-04
Rgc32 protein AF036548 3.4 1.4 6.47E-03
Growth differentiation factor 10 D49494 ) 3.9 0.8 4.60E-03
Inflammation
Superoxide dismutase 3 Z24721 4.2 1.2 2.04E-03
Lysozyme AA892775 4.7 2.3 3.13E-03
Complement component 1q b X71127 3.6 1.4 5.36E-03
Complement component 1 s D88250 5.2 1.4 9.23E-04
Signalling
Annexin 1 AI171962 3.9 1.4 3.67E-03
Cbp ⁄ p300-interacting transactivator AA900476 4.0 1.5 2.69E-03
2¢,3¢- Cyclic nucleotide 3¢-phosphodiesterase (CNP) L16532 5.0 1.2 9.14E-04
Protein tyrosine phosphatase 4a1 L27843 5.2 1.4 4.02E-04
AKAP4 AF008114 3.4 1.1 7.40E-03
Gene expression in exercise-induced cardiac hypertrophy C. C. Strøm et al.
2688 FEBS Journal 272 (2005) 2684–2695 ª 2005 FEBS
Overall, gene expression patterns in adaptive cardiac
hypertrophy were quite similar to previously published
data from maladaptive cardiac hypertrophy. A general
upregulation of signalling, cytoskeletal and extracellular
matrix genes was evident and the isoform shifts in

sarcomeric proteins resembled those of maladaptive
hypertrophy. The most prominent difference from the
maladaptive response was differential expression of a set
of metabolic genes not previously associated with exer-
cise-induced cardiac hypertrophy. While downregula-
tion of genes involved in lipid oxidation is typical of
maladaptive hypertrophy, we found upregulation of sev-
eral of these genes in adaptive hypertrophy. Expression
levels of glycolytic enzymes indicated both enhanced
glycolysis and glucose oxidation to contrast the impair-
ments of glucose oxidation in maladaptive hypertrophy.
We also identified several differences in expression of
Fig. 3. A scatter plot of the number of differentially expressed
genes compared to the number of false-positive genes at different
levels of delta. The black line represents the actual data while the
three grey lines represent data from three random divisions of
samples into two groups. The dotted black line represents unity,
where the number of called genes is identical to the number of
false positives.
Fig. 4. Expression of selected metabolic genes by quantitative PCR
confirming the microarray data. Expression was normalized to
GAPDH. Bars represent SEM and *P < 0.05.
Table 4. (Continued).
Gene Accession number Score(d) FC P-value
Cathechol-O-methyltransferase M93257 4.2 1.3 5.89E-03
Guanine nucleotide binding protein, alpha inhibiting polypeptide 3 AI228247 3.3 1.1 8.47E-03
N-myristoyltransferase 1 AA859942 4.0 1.2 3.58E-03
ADRBK1 (GRK2) M87854 ) 4.3 0.9 2.83E-03
MAP-kinase phosphatase (cpg21) AF013144 ) 7.8 0.9 1.87E-04
Calcium ⁄ calmodulin-dependent protein kinase 1 D86556 ) 4.3 0.9 3.47E-03

Cholecystokinin B receptor M99418 ) 4.2 0.8 1.98E-03
5-hydroxytryptamine (serotonin) receptor 2B X66842 ) 4.3 0.8 3.41E-03
Prolactin receptor M19304 ) 4.7 0.7 9.43E-04
GABA-A receptor alpha-6 subunit L08495 ) 4.5 0.9 1.49E-03
Munc13–3 AA943677 ) 4.5 0.8 1.41E-03
C. C. Strøm et al. Gene expression in exercise-induced cardiac hypertrophy
FEBS Journal 272 (2005) 2684–2695 ª 2005 FEBS 2689
signalling proteins between adaptive and maladaptive
hypertrophy including important modulators of adren-
ergic signalling.
Perhaps the most striking and potentially physiologi-
cally meaningful observation was the shift in metabolic
gene expression. This finding is especially interesting as
it differentiates adaptive from maladaptive hypertro-
phy and could be the molecular mechanism underlying
earlier findings of a balanced growth of cardiomyo-
cytes with a normal ratio of mitochondria to cell num-
ber [10,17] and normal myofibril to mitochondrial
ratio [5,6] in adaptive hypertrophy.
In our study, several genes involved in b-oxidation
of lipids (CD36, FACL, fatty acid binding protein)
were upregulated. Genes involved in b-oxidation are
downregulated in maladaptive cardiac hypertrophy
[18,19]. One gene, CD36 or Fat, encoding a fatty acid
translocase, was upregulated in response to exercise
but not regulated after maladaptive hypertrophy.
CD36 has recently been shown to be responsible for
the defect in fatty acid metabolism seen in spontane-
ously hypertensive rats [20], and myocardial recovery
from ischaemia is impaired in CD36 knockout mice

[21]. Thus the differential expression of CD36 between
maladaptive and adaptive hypertrophy might be of key
importance for the difference in clinical outcome in the
two conditions.
Glucose utilization through glycolysis is enhanced in
hypertrophic hearts [22,23]. However, there is no cor-
responding increase in rates of glucose oxidation
[22,23]. The consequent low coupling of glucose oxida-
tion to glycolysis is functionally relevant, as it contri-
butes to the contractile dysfunction in hypertrophic
hearts [23]. The multienzyme pyruvate dehydrogenase
complex (PDC) catalyses the oxidative decarboxylation
of pyruvate and contributes strongly to flux control of
myocardial glucose oxidation. The activity of PDC is
continuously regulated by balance of inhibiting pyru-
vate dehydrogenase kinase and activating pyruvate
dehydrogenase phosphatase (PDP) reactions [24]. We
found upregulation of the PDP gene, thus, suggesting
an increased glucose oxidation in exercise-induced
hypertrophy. GCKR was upregulated; this has been
shown to increase both glucokinase protein and enzy-
matic activity levels, leading to improved glucose toler-
ance and lowered plasma glucose in diabetic mice [25].
In accordance with these data, we found upregulation
of glucokinase (hexokinase 1) in hearts of exercised
rats. Further evidence of enhanced glycolysis came
from the upregulation of 6-phosphofructo-2-kinase ⁄
fructose-2,6-bisphosphatase that stimulates 6-phospho-
fructo-1-kinase [26], a key enzyme of glycolysis, which
was also upregulated in our experiments. Collectively,

these findings support the notion that cardiac capacity
for glucose utilization is in fact increased by adapta-
tion to exercise and that a transcriptional explanation
for this aspect of functional improvement exists.
We found significant downregulation of UCP2 in
response to exercise, while UCP2 was upregulated in
maladaptive hypertrophy. Uncoupling proteins dissipate
the proton electrochemical gradient formed during mito-
chondrial respiration and generate heat production
instead of ATP [27]. Thus, ATP production through
oxidative phosphorylation might be more effective in
adaptive than in maladaptive hypertrophy due to differ-
ences in UCP2 expression. In line with this, UCP2 was
recently found to be upregulated in several different
transgenic models of cardiomyopathy induced by chro-
nic b-adrenergic receptor signalling [28]. The upregula-
tion of UCP2 was partly reversed by b-adrenergic
receptor blockade. In response to volume overload,
UCP2 expression was increased and this increase was
partly reversed by an angiotensin converting enzyme
(ACE)-inhibitor [29]. UCP2 has previously been found
Fig. 5. Expression of UCP2 and CD36 by quantitative PCR in mal-
adaptive hypertrophy 3 weeks after myocardial infarction (mi).
UCP2 was significantly upregulated while CD36 expression was
unchanged contrasting the findings in adaptive hypertrophy. Expres-
sion was normalized to GAPDH. Bars represent SEM and
*P < 0.05.
Gene expression in exercise-induced cardiac hypertrophy C. C. Strøm et al.
2690 FEBS Journal 272 (2005) 2684–2695 ª 2005 FEBS
to be downregulated in response to exercise [30]. Thus,

upregulation of UCP2 seems a general feature of mal-
adaptive cardiac remodelling, and the well documented
beneficial effects of ACE-inhibitors and b-adrenergic
receptor-blockade are accompanied by decreased UCP2
expression. These findings indicate that the downregula-
tion of UCP2 in adaptive hypertrophy constitutes a
molecular feature of ‘adaptiveness’ and that upregula-
tion of UCP2 may be a key factor underlying defective
energetics in diseased hearts.
In accordance with previous reports we did not find
activation of the typical neonatal gene expression pat-
tern found in pathological hypertrophy, which includes
uprelation of atrial natriuretic peptide, B-type natriure-
tic peptide, a-skeletal and smooth muscle actin, and
b-myosin heavy chain [16]. However, exercise-induced
hypertrophy was accompanied by a marked upregula-
tion of genes involved in extracellular matrix remode-
ling (biglycan, matrix gla protein, cathepsins, cystatins,
integrin a7 and laminin receptor). These genes are con-
sistently upregulated in pathological models of cardiac
hypertrophy indicating that these genes are necessary
to the cardiac growth response [18,31,32]. In contrast
to pathological models of cardiac hypertrophy we
found no increase in collagen mRNA expression.
We found upregulation of a number of cytoskeletal
genes. Several of these genes were previously described
to be upregulated in pathological hypertrophy
(MYL 1, 4 and 6, sarcosin, talin, actin-related protein
complex 1b and ArgBP2) [31,33]. Upregulation of acti-
nin a2 associated Lim11/rat Isl-1/Mec3 (LIM) protein

(ALP) in cardiac hypertrophy has not been described
previously but ALP– ⁄ – mice develop cardiomyopathy
[34]. In the only microarray study on exercise-induced
cardiac hypertrophy reported to date, MYL 4 upregu-
lation was also found and confirmed by 2D gel electro-
phoresis [35]. The study only employed three DNA
microarrays in each group and did not use a statistical
method to identify differentially expressed genes.
We found prominent upregulation of proteins
involved in protein synthesis (eukaryotic translation
elongation factor 1 alpha 1, eukaryotic translation
elongation factor 2, RNA polymerase II polypeptide G
and several ribosomal proteins). These findings are
consistent with the increased demand for protein syn-
thesis in response to cardiac hypertrophy.
In accordance with previous studies on maladap-
tive hypertrophy [18,36] we found upregulation of
inflammatory genes (superoxide dismutase 3, comple-
ment component 1qb and 1c, lysozyme and others)
indicating that inflammation is a general feature of
cardiac hypertrophy. We cannot exclude the possibil-
ity that the strong physical stress induced by the
exercise contributed to the inflammatory response
and exercise of more moderate extent with slower
and continuous time course may induce hypertrophy
without inflammation.
Several of the differentially regulated signalling pro-
teins have also been reported to change in maladaptive
hypertrophy (Cbp ⁄ p300-interacting transactivator, pro-
tein tyrosine phosphatase 4a1, annexin 1 and cyclic

nucleotide 3¢-phosphodiesterase) [18,32,33]. Adrenergic
signalling is important in cardiac hypertrophy and we
found differential expression of several genes involved
in adrenergic signal transduction (catechol-O-methyl
transferase, GRK2, AKAP4 and Gai3). GRK2 desen-
sitizes G-protein coupled receptors and is upregulated
[37] in maladaptive hypertrophy. We found downregu-
lation of GRK2 in adaptive hypertrophy pointing to a
potentially important difference in adrenergic signal-
ling between maladaptive and adaptive hypertrophy.
In conclusion, we have used DNA microarrays to
map gene expression in adaptive hypertrophy. While
expression of extracellular matrix proteins and sarco-
meric proteins was similar to the changes known to
occur in maladaptive hypertrophy, we found striking
differences in expression of genes involved in metabo-
lism between adaptive and maladaptive hypertrophy.
Experimental procedures
Animal handling and training procedure
Twenty-four male Wistar rats (Taconic M & B, Ejby,
Denmark) weighing 285 ± 10 g (mean ± SD; n ¼ 24) were
randomly assigned to either a seven-week treadmill running
program (n ¼ 12) or served as sedentary controls (n ¼ 12).
The animals had free access to food (standard rodent pel-
lets) and water. Rats in the running group were exercised
on a custom-built 12-lane treadmill with an 8° inclination
for 2 hÆday
)1
, 5 daysÆweek
)1

, for 7½ weeks between 12 : 00
and 17 : 30. Each training session started with a 20-min
warm-up at 11 mÆmin
)1
the first week gradually increasing
to 18 mÆmin
)1
the last 3 weeks. Running speed was set to
15 mÆmin
)1
the first week, gradually increasing to level at
32.5 mÆmin
)1
the final 2½ weeks, while the duration was
reduced from 100 min to 80 min for the final 2½ weeks.
After 1 week of training one rat had a small injury to one
of its feet and was therefore withdrawn from further exer-
cise and excluded from the study. The experiments were
approved by the Animal Experimentation Inspectorate of
the Danish Ministry of Justice and the investigation con-
forms to the Guide for the Care and Use of Laboratory
Animals published by the US National Institutes of Health
(NIH publication no. 85-23, revised 1996). The day after
completion of the training protocol, all animals were sub-
C. C. Strøm et al. Gene expression in exercise-induced cardiac hypertrophy
FEBS Journal 272 (2005) 2684–2695 ª 2005 FEBS 2691
jected to echocardiography and hemodynamic examination
under isoflurane anesthesia before being killed. Hearts were
excised, rinsed in ice-cold saline, weighed, dissected into left
and right ventricles, frozen in liquid nitrogen and stored at

)80 °C until mRNA extraction.
As exercise resulted in a significantly reduced body
weight (BW) when compared to sedentary controls, normal-
ization of organ weights to BW would result in apparent
hypertrophy of all organs in the training animals. For valid
comparison of experimental groups, organ weights were
instead normalized to lean body mass, estimated as BW
0.78
[38], rendering only weights of total heart and left and right
ventricles different between groups, while lung, kidney and
stomach were not.
Echocardiography
Echocardiography was performed during anesthesia with
1–1.5% isoflurane using a Vivid Five Echocardiograph
(GE Medical Systems Ultrasound, Little Chalfont, UK).
Recordings were stored digitally for off-line analysis. Left
ventricular cavity and wall dimensions were measured in 2D
short axis recordings at the level of the papillary muscles.
Hemodynamic examination
A microtip transducer catheter (Millar Instruments, Hous-
ton, TX, USA) was introduced from the right carotid
artery and placed in the left ventricle for measurements of
LVEDP and maximal rates of isovolumetric pressure devel-
opment (dP ⁄ dt
max
) and decline (dP ⁄ dt
min
). After retraction
from the left ventricle, mean arterial pressure (MAP) was
measured. Simultaneous elecrocardiography was performed

from subcutaneously placed needle electrodes and heart rate
(HR) was calculated.
Myocardial infarction
Myocardial infarction was induced by ligating the left cor-
onary artery. Sham-operated animals served as controls
[39]. After 3 weeks, animals were killed and total RNA was
isolated from the noninfarcted part of the left ventricle as
described in [36]. Despite large thinned fibrotic scars, the
weight of the left ventricle was increased in infarcted ani-
mals compared to controls, indicating left ventricular
hypertrophy of the noninfarcted ventricle.
Gene expression profiling
The GeneChip RGU34A from Affymetrix containing 8740
probe sets (and 59 control probe sets which were excluded
from further analysis) was used for all hybridizations. The
probe sets represent approximately 6000 known rat genes,
the rest being ESTs (see for a
more detailed description). Standard protocols for chip
hybridizations available at were
used. Briefly, cDNA was synthesized from total RNA
extracted from the tissue samples by Trireagent (Molecular
Research Center, Inc., OH, USA). cDNA was then used
for in vitro transcription to produce biotin-labelled cRNA.
The cRNA was fragmented before hybridization. RNA
from individual animals was hybridized to each chip and
six randomly chosen samples were analysed from each
group. Chip hybridizations were performed at a core facil-
ity with ample experience in microarray handling to ensure
quality. Raw data are available at .
nih.gov/geo as series number GSE739 (access by username:

revstro90, password: revstro90).
Array data analysis
Array data were normalized using the nonlinear invariant
rank fitting method of Li and Wong available at http://
www.dchip.org [40]. Model based expression (MBE) values
were calculated for each gene using dChip (perfect
match only model). Differentially expressed genes were
identified using SAM available at http://www-stat.
stanford.edu ⁄ tibs ⁄ SAM ⁄ [41]. Briefly, SAM is a statistical
approach to identify differentially expressed genes by con-
trolling the FDR. The FDR is the percentage of genes iden-
tified by chance. SAM identifies the differentially regulated
genes by assimilating a set of gene specific t-tests. Each
gene is assigned a score by dividing the average difference
in gene expression between groups by the pooled SD.
Genes with scores greater than threshold delta (Fig. 2, grey)
are deemed potentially significant. By permutation of the
Table 5. Primer sets used in quantitative PCR. Sequences are shown in the 5¢)3¢ orientation.
Gene Forward Reverse Target position Product size
GAPDH GTCGGTGTGAACGGATTTG CTTGCCGTGGGTAGAGTCAT 859–1008 150
FABP4 GGAAAGTGAAGAGCATCATAACC ATGACACATTCCACCACCAG 289–412 124
CD36 GCAAAGAAGGGAAACCTGTG TCCAGTTATGGGTTCCACATC 1071–1207 137
FACL4 CCTGGATTAGGACCAAAGGA ATTTTGCTGGACTGGTCAGA 981–1126 146
GCKR TGCAGAGGTTCTCTGGACAGT GTGGGGATCACCTTTTCCTT 1589–1739 151
Slc27a1 CCACTCAGCAGGGAACATCA GGCATATTTCACCGATGTACTGC 950–1098 149
UCP2 GAAAGGGACCTCTCCCAATG GGAGGTCGTCTGTCATGAGG 872–987 116
Gene expression in exercise-induced cardiac hypertrophy C. C. Strøm et al.
2692 FEBS Journal 272 (2005) 2684–2695 ª 2005 FEBS
samples and recalculation of the scores, the FDR is estima-
ted at different values of delta. Log

2
MBE values were ana-
lysed using a two-class unpaired approach with an FDR of
less than 5%. For comparison, we calculated P-values for
each gene by a Welch t-test, which allows for inequality of
variances between groups. P-values ranged from 2.0 · 10
)7
to 0.02.
Quantitative PCR
RNA was extracted de novo from all the cardiac tissue sam-
ples (exercised, n ¼ 11; sedentary, n ¼ 12). Reverse tran-
scription was performed using the Omniscript RT Kit
(Qiagen, Valencia, CA, USA) on 2 lg total RNA samples
and random hexamer primers according to manufacturer’s
instructions. Primers were designed using PRIMER3 (MIT
and available online at />bin/primer/primer3.cgi/primer3_www.cgi) and sequence
information retrieved from the NCBI database. Intron
spanning pairs were used to avoid amplification of genomic
sequences, and primer specificity and emergence of only
one product of the predicted size were ascertained by
agarose gel electrophoresis and real-time melting curve ana-
lysis of all PCR products. Each sample reaction contained
cDNA synthesized from 10 ng heart RNA. Standard curve
reactions contained cDNA pooled from all samples and
diluted 1 : 2, 1 : 4, 1 : 10, 1 : 50 and 1 : 100 (corresponding
to 50, 25, 10, 2 and 1 ng of total heart RNA, respectively).
DNA amplification was carried out using the RotorGene
(Corbett Research, Sydney, Australia) and the SYBR green
PCR Master Mix (Quantitect, Berkely, CA, USA). The
reactions were set up in 0.1 mL microtubes in a total vol-

ume of 20 lL with 1 lL of template. Standard curves in
duplicate were included in every run, and quantification of
individual samples performed by normalization to GAP-
DH. Constant GADPH expression between exercised and
sedentary animals was confirmed by northern blotting (data
not shown). At least three independent runs were per-
formed for every target transcript. The primer sets used in
quantitative PCR are shown in Table 5.
Statistical analysis
Array data were analysed as described above. All other
comparisons were made by an unpaired Student’s t-test.
P-values ¼ 0.05 were considered significant.
Acknowledgements
We thank the staff at the Microarray Center, Rigshos-
pitalet, Denmark, for performing the microarray hy-
bridizations and scannings. We thank Peter Schjerling
for Northern blots of GAPDH and Pernille Gundelach
and Katrine Kastberg for technical assistance. The
work was supported by the John and Birthe Meyer
Foundation, the Danish Heart Foundation (01-1-2-59-
22907, 99-1-2-31-22684), the Villadsen Family Founda-
tion, the Foundation of 17.12.1981, the University of
Copenhagen, Rigshospitalet, the Novo-Nordisk Foun-
dation and the Danish National Research Foundation.
References
1 Agabiti-Rosei E & Muiesan ML (1997) Prognostic
significance of left ventricular hypertrophy regression.
Adv Exp Med Biol 432, 199–205.
2 Ehsani AA, Hagberg JM & Hickson RC (1978) Rapid
changes in left ventricular dimensions and mass in

response to physical conditioning and deconditioning.
Am J Cardiol 42, 52–56.
3 Shapiro LM (1984) Physiological left ventricular hyper-
trophy. Br Heart J 52, 130–135.
4 Kozakova M, Galetta F, Gregorini L, Bigalli G,
Franzoni F, Giusti C & Palombo C (2000) Coronary
vasodilator capacity and epicardial vessel remodeling in
physiological and hypertensive hypertrophy. Hyperten-
sion 36, 343–349.
5 Weber KT, Clark WA, Janicki JS & Shroff SG (1987)
Physiologic versus pathologic hypertrophy and the pres-
sure-overloaded myocardium. J Cardiovasc Pharmacol
10, S37–S50.
6 Tomanek RJ (1979) Quantitative ultrastructural aspects
of cardiac hypertrophy. Tex Rep Biol Med 39, 111–122.
7 Barger PM & Kelly DP (2000) PPAR signaling in the
control of cardiac energy metabolism. Trends Cardiovasc
Med 10, 238–245.
8 Hainsey T, Csiszar A, Sun S & Edwards JG (2002)
Cyclosporin A does not block exercise-induced cardiac
hypertrophy. Med Sci Sports Exerc 34, 1249–1254.
9 Geenen DL, Malhotra A & Buttrick PM (1996) Angio-
tensin receptor 1 blockade does not prevent physiologi-
cal cardiac hypertrophy in the adult rat. J Appl Physiol
81, 816–821.
10 Iemitsu M, Miyauchi T, Maeda S, Sakai S, Kobayashi T,
Fujii N, Miyazaki H, Matsuda M & Yamaguchi I
(2001) Physiological and pathological cardiac hypertro-
phy induce different molecular phenotypes in the rat.
Am J Physiol Regul Integr Comp Physiol 281, R2029–

R2036.
11 Calderone A, Murphy RJ, Lavoie J, Colombo F &
Beliveau L (2001) TGF-beta(1) and prepro-ANP
mRNAs are differentially regulated in exercise-induced
cardiac hypertrophy. J Appl Physiol 91, 771–776.
12 Wisloff U, Loennechen JP, Falck G, Beisvag V, Currie
S, Smith G & Ellingsen O (2001) Increased contractility
and calcium sensitivity in cardiac myocytes isolated
from endurance trained rats. Cardiovasc Res 50, 495–
508.
C. C. Strøm et al. Gene expression in exercise-induced cardiac hypertrophy
FEBS Journal 272 (2005) 2684–2695 ª 2005 FEBS 2693
13 Golub TR, Slonim DK, Tamayo P, Huard C,
Gaasenbeek M, Mesirov JP, Coller H, Loh ML,
Downing JR, Caligiuri MA, Bloomfield CD & Lander
ES (1999) Molecular classification of cancer: class
discovery and class prediction by gene expression
monitoring. Science 286, 531–537.
14 Roberts CJ, Nelson B, Marton MJ, Stoughton R,
Meyer MR, Bennett HA, He YD, Dai H, Walker WL,
Hughes TR, Tyers M, Boone C & Friend SH (2000)
Signaling and circuitry of multiple MAPK pathways
revealed by a matrix of global gene expression profiles.
Science 287, 873–880.
15 Buttrick PM & Scheuer J (1987) Physiologic, biochem-
ical, and coronary adaptation to exercise conditioning.
Cardiol Clin 5, 259–270.
16 Jin H, Yang R, Li W, Lu H, Ryan AM, Ogasawara
AK, Van Peborgh J & Paoni NF (2000) Effects of exer-
cise training on cardiac function, gene expression, and

apoptosis in rats. Am J Physiol Heart Circ Physiol 279,
H2994–H3002.
17 Hardie DG & Hawley SA (2001) AMP-activated protein
kinase: the energy charge hypothesis revisited. Bioessays
23, 1112–1119.
18 Stanton LW, Garrard LJ, Damm D, Garrick BL, Lam A,
Kapoun AM, Zheng Q, Protter AA, Schreiner GF &
White RT (2000) Altered patterns of gene expression in
response to myocardial infarction. Circ Res 86, 939–945.
19 Tan FL, Moravec CS, Li J, Apperson-Hansen C,
McCarthy PM, Young JB & Bond M (2002) The gene
expression fingerprint of human heart failure. Proc Natl
Acad Sci USA 99, 11387–11392.
20 Aitman TJ, Glazier AM, Wallace CA, Cooper LD,
Norsworthy PJ, Wahid FN, Al-Majali KM, Trembling
PM, Mann CJ, Shoulders CC, Graf D, St Lezin E,
Kurtz TW, Kren V, Pravenec M, Ibrahimi A,
Abumrad NA, Stanton LW & Scott J (1999) Identifica-
tion of Cd36 (Fat) as an insulin-resistance gene causing
defective fatty acid and glucose metabolism in
hypertensive rats. Nat Genet 21, 76–83.
21 Irie H, Krukenkamp IB, Brinkmann JF, Gaudette GR,
Saltman AE, Jou W, Glatz JF, Abumrad NA & Ibra-
himi A (2003) Myocardial recovery from ischemia is
impaired in CD36-null mice and restored by myocyte
CD36 expression or medium-chain fatty acids. Proc
Natl Acad Sci USA 100, 6819–6824.
22 Allard MF, Schonekess BO, Henning SL, English DR
& Lopaschuk GD (1994) Contribution of oxidative
metabolism and glycolysis to ATP production in hyper-

trophied hearts. Am J Physiol 267, H742–H750.
23 Wambolt RB, Lopaschuk GD, Brownsey RW & Allard
MF (2000) Dichloroacetate improves postischemic
function of hypertrophied rat hearts. J Am Coll Cardiol
36, 1378–1385.
24 Lydell CP, Chan A, Wambolt RB, Sambandam N,
Parsons H, Bondy GP, Rodrigues B, Popov KM,
Harris RA, Brownsey RW & Allard MF (2002) Pyru-
vate dehydrogenase and the regulation of glucose oxi-
dation in hypertrophied rat hearts. Cardiovasc Res 53,
841–851.
25 Slosberg ED, Desai UJ, Fanelli B, St Denny I, Connelly
S, Kaleko M, Boettcher BR & Caplan SL (2001) Treat-
ment of type 2 diabetes by adenoviral-mediated overex-
pression of the glucokinase regulatory protein. Diabetes
50, 1813–1820.
26 Beauloye C, Marsin AS, Bertrand L, Vanoverschelde JL,
Rider MH & Hue L (2002) The stimulation of heart
glycolysis by increased workload does not require
AMP-activated protein kinase but a wortmannin-sensi-
tive mechanism. FEBS Lett 531, 324–328.
27 Nicholls DG & Locke RM (1984) Thermogenic
mechanisms in brown fat. Physiol Rev 64, 1–64.
28 Gaussin V, Tomlinson JE, Depre C, Engelhardt S,
Antos CL, Takagi G, Hein L, Topper JN, Liggett SB,
Olson EN, Lohse MJ, Vatner SF & Vatner DE (2003)
Common genomic response in different mouse models
of beta-adrenergic-induced cardiomyopathy. Circulation
108, 2926–2933.
29 Murakami K, Mizushige K, Noma T, Tsuji T, Kimura

S & Kohno M (2002) Perindopril effect on uncoupling
protein and energy metabolism in failing rat hearts.
Hypertension 40, 251–255.
30 Boss O, Samec S, Desplanches D, Mayet MH, Seydoux
J, Muzzin P & Giacobino JP (1998) Effect of endurance
training on mRNA expression of uncoupling proteins 1,
2, and 3 in the rat. FASEB J 12, 335–339.
31 Jin H, Yang R, Awad TA, Wang F, Li W, Williams SP,
Ogasawara A, Shimada B, Williams PM, de Feo G &
Paoni NF (2001) Effects of early angiotensin-converting
enzyme inhibition on cardiac gene expression after acute
myocardial infarction. Circulation 103, 736–742.
32 Weinberg EO, Mirotsou M, Gannon J, Dzau VJ, Lee
RT & Pratt RE (2003) Sex dependence and temporal
dependence of the left ventricular genomic response to
pressure overload. Physiol Genomics 12, 113–127.
33 Hwang JJ, Allen PD, Tseng GC, Lam CW, Fananapazir
L, Dzau VJ & Liew CC (2002) Microarray gene expres-
sion profiles in dilated and hypertrophic cardiomyopathic
end-stage heart failure. Physiol Genomics 10, 31–44.
34 Pashmforoush M, Pomies P, Peterson KL, Kubalak S,
Ross J Jr, Hefti A, Aebi U, Beckerle MC & Chien KR
(2001) Adult mice deficient in actinin-associated
LIM-domain protein reveal a developmental pathway
for right ventricular cardiomyopathy. Nat Med 7,
591–597.
35 Diffee GM, Seversen EA, Stein TD & Johnson JA (2003)
Microarray expression analysis of effects of exercise
training: increase in atrial MLC-1 in rat ventricles. Am J
Physiol Heart Circ Physiol 284, H830–H837.

36 Strom CC, Kruhoffer M, Knudsen S, Stensgaard-Hansen F,
Jonassen TEN, Orntoft TF, Haunso S & Sheikh SP
Gene expression in exercise-induced cardiac hypertrophy C. C. Strøm et al.
2694 FEBS Journal 272 (2005) 2684–2695 ª 2005 FEBS
(2004) Identification of a core set of genes that signifies
pathways underlying cardiac hypertrophy. Comp Funct
Genom 5, 459–470.
37 Choi DJ, Koch WJ, Hunter JJ & Rockman HA (1997)
Mechanism of beta-adrenergic receptor desensitization
in cardiac hypertrophy is increased beta-adrenergic
receptor kinase. J Biol Chem 272, 17223–17229.
38 Batterham AM, George KP & Mullineaux DR (1997)
Allometric scaling of left ventricular mass by body
dimensions in males and females. Med Sci Sports Exerc
29, 181–186.
39 Theilade J, Strom C, Christiansen T, Haunso S &
Sheikh SP (2003) Differential G protein receptor kinase
2 expression in compensated hypertrophy and heart
failure after myocardial infarction in the rat. Basic Res
Cardiol 98, 97–103.
40 Li C & Hung Wong W (2001) Model-based analysis of
oligonucleotide arrays: model validation, design issues
and standard error application. Genome Biol 2,
RESEARCH0032 Epub.
41 Tusher VG, Tibshirani R & Chu G (2001) Significance
analysis of microarrays applied to the ionizing radiation
response. Proc Natl Acad Sci USA 98, 5116–5121.
Supplementary material
The following material is available from http://www.
blackwellpublishing.com/products/journal s/suppmat/

EJB/EJB4684/EJB4684sm.htm
Table S1. Expression changes in response to exercise.
Table S2. Raw gene expression data.
C. C. Strøm et al. Gene expression in exercise-induced cardiac hypertrophy
FEBS Journal 272 (2005) 2684–2695 ª 2005 FEBS 2695