Báo cáo khoa học: Catalytic residues Lys197 and Arg199 ofBacillus subtilis phosphoribosyl diphosphate synthase Alanine-scanning mutagenesis of the flexible catalytic loop ppt

Catalytic residues Lys197 and Arg199 of Bacillus subtilis
phosphoribosyl diphosphate synthase
Alanine-scanning mutagenesis of the flexible catalytic loop
Bjarne Hove-Jensen, Ann-Kristin K. Bentsen and Kenneth W. Harlow*
Department of Biological Chemistry, Institute of Molecular Biology and Physiology, University of Copenhagen, Denmark
The compound 5-phospho-d-ribosyl a-1-diphosphate
(PRibPP) is an important component of the metabo-
lism of most organisms. PRibPP is a precursor for the
biosynthesis of purine, pyrimidine and pyridine nucleo-
tides, as well as of the amino acids tryptophan and his-
tidine [1,2]. Microorganisms like Bacillus subtilis and
Escherichia coli typically contain 10 enzymes that use
PRibPP as a substrate [3]. In addition, methanogenic
archaea utilize PRibPP for the biosynthesis of metha-
nopterin, a folate analogue involved in C1 metabolism
[4], and Methanocaldococcus jannaschii utilizes PRibPP
as a precursor of ribose 1,5-bisphosphate and subse-
quently, ribulose 1,5-bisphosphate [5]. Finally, myco-
bacteria utilize PRibPP for the biosynthesis of
polyprenylphosphate-pentoses [6]. PRibPP is synthes-
ized by transfer of the b,c-diphosphoryl group of ATP
to the C-1 hydroxyl of ribose 5-phosphate (Rib5P),
in a reaction which is catalysed by PRibPP synthase
(ATP:d-ribose 5-phosphate pyrophosphotransferase,
EC 2.7.6.1) [7,8]: Rib5P + ATP fi PRibPP + AMP.
PRibPP synthase is encoded by the prs gene [9,10].
Several crystal forms of B. subtilis PRibPP synthase
have been obtained and the structure was solved to
high resolution. The analysis revealed a two-domain
subunit structure, which assembles to form a hexamer.
Each domain contains a central five-stranded parallel

b-sheet surrounded by a-helices, and thus, the overall
folds of the domains resemble those of type I phospho-
ribosyltransferases. Initially the flexible catalytic loop,
KRRPRPNVAEVM(197–208), which contains several
charged residues, remained unresolved, except for
Lys197, Arg198 and Met208 [11]. Among the amino
Keywords
flexible loop; nucleotide metabolism; PRPP
Correspondence
B. Hove-Jensen, Department of Biological
Chemistry, Institute of Molecular Biology
and Physiology, University of Copenhagen,
DK-1307 Copenhagen K, Denmark
Fax: +45 3532 2040
Tel: +45 3532 2027
E-mail:
Website:
*Present address
Novo Nordisk A ⁄ S, Drug Metabolism, Novo
Nordisk Park, DK-2760 Ma
˚
løv, Denmark
(Received 7 April 2005, revised 12 May
2005, accepted 20 May 2005)
doi:10.1111/j.1742-4658.2005.04785.x
Eleven of the codons specifying the amino acids of the flexible catalytic
loop [KRRPRPNVAEVM(197–208)] of Bacillus subtilis phosphoribosyl
diphosphate synthase have been changed individually to specify alanine.
The resulting variant enzyme forms, as well as the wildtype enzyme, were
produced in an Escherichia coli strain lacking endogenous phosphoribosyl

diphosphate synthase activity and purified to near homogeneity. The
B. subtilis phosphoribosyl diphosphate synthase mutant variants K197A
and R199A were studied in detail. The physical properties of the two
enzymes were similar to those of the wildtype enzyme. Kinetic characteriza-
tion showed that the V
max
values of the K197A and R199A mutant
enzymes were more than 30 000- and more than 24 000-fold reduced,
respectively, compared to the wildtype enzyme. The K
m
values for ATP
and ribose 5-phosphate of the two mutant enzymes were essentially
unchanged. V
app
values of the remaining mutant enzymes were much less
affected, ranging from 20 to 100% of the V
max
value of the wildtype
enzyme. The data presented show that Lys197 and Arg199 are important
in stabilization of the transition state.
Abbreviations
AMP, adenosine 5¢-monophosphate; PRibPP, 5-phospho-
D-ribosyl a-1-diphosphate; Rib5P, ribose 5-phosphate.
FEBS Journal 272 (2005) 3631–3639 ª 2005 FEBS 3631
acids of the loop, Lys197 and Arg199 are highly con-
served, whereas the remaining 10 amino acids are only
moderately conserved. Crystallization of the enzyme in
the presence of the transition state analogue AlF
3
, the

substrate Rib5P and the product AMP resulted in a
structure with a bend arrangement of AMP-AlF
3
-AMP
and with Rib5P attached in a manner that is believed
to resemble the transition state with the exception of
the addition of an adenosyl group [12]. In this crystal
form the flexible catalytic loop is fixed in a closed con-
formation that appears to shield the transition state
analogue AlF
3
from the solvent. Closure of the loop is
stabilized by interaction of Lys197 through the e-amino
group and Arg199 through the guanidino group with
two of the fluoride atoms, which are analogous to oxy-
gen atoms of the b-phosphorus of the substrate ATP. A
transient negative charge that may develop on the b-
phosphoryl oxygen atoms could be stabilized by Lys197
and Arg199 [12]. Furthermore, analysis of a crystal
form with the inhibitor analogue a,b-methylene GDP
bound at the allosteric site as well as the substrate
Rib5P and the reaction-inert substrate analogue a,b-
methylene ATP present revealed a tight interface
between two subunits. This interface is primarily
formed by reciprocal interaction of hydrophobic amino
acids of b-strands located on either side of the flexible
catalytic loop. The tightly packed interface prevents the
closure of the loop, and thus, prevents the interaction
of Lys197 and Arg199 with the phosphate chain of
ATP. Release of this tight interaction following release

of allosteric inhibitor binding causes a 7 A
˚
displace-
ment of the b-strands, which is expected to allow the
closure of the loop followed by catalysis. Closure of the
loop is furthermore stabilized by hydrogen bonds
formed between Asn203 and substrate-bound water
molecules [12]. Finally, a role of the flexible catalytic
loop residue Arg198 in allosteric regulation was sugges-
ted. This arginine residue interacts primarily with
Asp196 of the same subunit, but also with Asp186 of a
neighbouring subunit, and in doing so assists in main-
taining the tightly packed interface that prevents the
closure of the flexible catalytic loop [12]. The flexible
catalytic loop of PRibPP synthase is topologically and
functionally equivalent to a loop, variously designated
the flexible loop, the catalytic loop, or loop II of the
class I phosphoribosyltransferases. This loop is
involved in the catalytic function of these enzymes by
closing down on the bound substrates and thereby
forming the active site (reviewed in [13,14]).
Evidence for the importance of Lys197 in catalysis
also comes from results of chemical modification
of PRibPP synthase from E. coli with the substrate
analogue 2¢,3¢-dialdehyde-ATP. Lysine residues 181,
193 and 230 were identified as possible reactive site
residues. Of these, Lys193 is homologous to B. subtilis
PRibPP synthase Lys197. It was suggested that this
lysine residue might interact with the triphosphate
chain of ATP either directly or indirectly through the

Mg
2+
ion chelated to the phosphate chain of the
MgATP complex or it might form hydrogen bonds
with the C-2¢ or the C-3¢ hydroxyl group of ATP [15].
We report here the characterization of B. subtilis
PRibPP synthase mutant forms with the individual
amino acids of the flexible catalytic loop altered to
alanine with emphasis on the two catalytic residues
Lys197 and Arg199.
Results
Complementation of Dprs by mutant alleles
specifying alanine substitutions of the flexible
catalytic loop
The codons of the flexible catalytic loop were altered
individually to specify alanine as described in Experi-
mental procedures. Each of the plasmids harbouring a
prs-allele specifying an alanine variant was transformed
to strain HO1088 (Dprs) and the growth of the trans-
formants were analysed (Table 1). The results showed
Table 1. Complementation of Dprs by various prs mutant alleles.
Complementation was performed as described in Experimental pro-
cedures. Minimal medium contained glucose as the carbon source,
thiamine and the indicated compounds. Tetracycline and ampicillin
were added to maintain episome and plasmid, respectively. Growth
was recorded after 24 h of incubation at 37 °C. +, growth; –, lack
of growth.
Plasmid
PRibPP
synthase

Growth in minimal medium with
supplements
None
Guanosine,
uridine,
histidine,
tryptophan
Guanosine, uridine,
histidine,
tryptophan,
NAD
pAB600 Wildtype + + +
pAB700 K197A – – +
pAB701 R198A + + +
pHO377 R199A – – +
pHO378 P200A + + +
pHO379 R201A + + +
pHO380 P202A + + +
pHO392 N203A + + +
pHO393 V204A + + +
pHO382 E206A + + +
pHO383 V207A + + +
pHO385 M208A + + +
pUHE23-2 None – – +
PRibPP synthase flexible catalytic loop B. Hove-Jensen et al.
3632 FEBS Journal 272 (2005) 3631–3639 ª 2005 FEBS
that the mutant alleles specifying K197A and R199A
were unable to complement Dprs, as the transformants
HO1088 (Dprs) ⁄ pAB700 (specifying K197A) and
HO1088 (Dprs) ⁄ pHO377 (specifying R199A) grew only

with all of the components of the PRibPP-consuming
pathways present. This indicates the acquisition of
PRibPP synthase with no or very low activity. In con-
trast, all of the remaining mutant alleles complemented
the Dprs allele as the transformants grew without any
of the compounds present.
Kinetic analysis of K197A and R199A PRibPP
synthases
Each mutant variant enzyme was purified to near
homogeneity, i.e., more than 98% purity as evaluated
by SDS ⁄ PAGE. Their kinetic constants were deter-
mined together with those of wildtype PRibPP. Initial
velocity vs the concentration of either ATP or Rib5P
followed typical Michaelis–Menten kinetics. Kinetic
parameters of the forward reaction of wildtype,
K197A and R199A PRibPP synthases were obtained
by measuring initial reaction rates under conditions
where ATP and Rib5P were varied against each other.
Double reciprocal plots of initial velocity vs ATP and
fixed concentrations of Rib5P and vice versa showed a
series of intersecting lines for both the wildtype
enzyme, the K197A enzyme and the R199A enzyme.
The K-values, obtained by fitting the data to Eqn (1),
and assuming the binding of ATP before Rib5P (see
below), are presented in Table 2. The two mutant
enzymes displayed a large decrease in the maximal
velocity. The V
max
value of the K197A enzyme was
more than 30 000-fold reduced compared to that of

the wildtype enzyme, whereas that of the R199A
enzyme was more than 24 000-fold reduced. In con-
trast, K
ATP
and K
Rib5P
values of the mutant enzymes
were much less altered, if at all, compared to those of
the wildtype enzyme. The K
i(ATP)
value of the K197A
mutant was reduced six-fold compared to that of the
wildtype enzyme, whereas that of the R199A enzyme
was three-fold reduced.
Inhibition of K197A, R198A and R199A PRibPP
synthases
The mode of inhibition by ADP of wildtype PRibPP
synthase was analysed. Double reciprocal plots of
activity vs ATP concentration at fixed concentration
of ADP were used to calculate values of slopes and
intercepts. Fitting of the slope and intercept values as
parabolic inhibition [16] failed to give a reasonable
description of the data. Instead the data were fitted
to Eqn (5). Replots of intercepts and slopes revealed
parabolic curves which are characteristic for binding
of ADP to both an active site and to an independent,
allosteric site of PRibPP synthase [17,18]. A similar
analysis was performed with the K197A, R199A, and
R198A mutant enzymes. The Arg198 residue has been
proposed to be involved in allosteric regulation due

to its involvement in subunit–subunit interactions
[12]. The inhibition constants obtained from this ana-
lysis are given in Table 3. Although the inhibition
pattern appeared similar for the wildtype, the R198A
and the R199A enzyme species, i.e., the inhibition by
ADP was nonlinear noncompetitive with respect to
ATP, the inhibition of the K197A mutant PRibPP
synthase was altered. The K¢
is
value of the K197A
mutant enzyme was only three-fold higher than that
of the wildtype enzyme, but the K¢
ii
value of the
mutant enzyme was 12-fold higher than that of the
wildtype enzyme. The apparent Hill coefficient n indi-
cates that ADP binds to nonidentical sites on the
Table 2. Kinetic constants of wildtype, K197A and R199A PRibPP
synthases. The data were fitted to Eqn (1). Standard errors are
those given by the computer program. Wildtype, the concentration
of ATP was varied from 0.10 to 2.0 m
M in the presence of 0.25–
2.0 m
M Rib5P and 10 mM MgCl
2
. K197A, the concentration of ATP
was varied from 0.05 to 2.0 m
M in the presence of 0.10–5.0 mM
Rib5P and 10 mM MgCl
2

. R199A, the concentration of ATP was
varied from 0.05 to 1.8 m
M in the presence of 0.10–3.2 mM Rib5P
and 5.0 m
M MgCl
2
.
Enzyme
V
max
(lmolÆmin
)1
Æ
mg protein
)1
)
K
ATP
(lM)
K
Rib5P
(lM) K
i(ATP)
(lM)
Wildtype 108 ± 3.9 191 ± 33 230 ± 43 1089 ± 322
K197A 0.003 ± 0.0002 120 ± 24 217 ± 48 167 ± 99
R199A 0.004 ± 0.0002 57 ± 16 106 ± 27 323 ± 146
Table 3. Kinetic constants of ADP inhibition vs ATP of wildtype and
mutant PRibPP synthases. The concentration of Rib5P and MgCl
2

was 5.0 and 6.0 mM, respectively. Results of activity determina-
tions were plotted as double reciprocal plots, and slopes and inter-
cepts were determined. The data were fitted to Eqn (5). Standard
errors are those given by the computer program. Wildtype, the con-
centration of ATP was varied from 0.1 to 2.0 m
M in the presence
of 0–0.3 m
M ADP. K197A, the concentration of ATP was varied
from 0.1 to 2.0 m
M in the presence of 0–1.0 mM ADP.
R198A ⁄ 199A, the concentration of ATP was varied from 0.1 to
0.8 m
M in the presence of 0–0.75 mM ADP.
Enzyme K ¢
is
(lM) nK¢
ii
(lM) n
Wildtype 99 ± 7.0 3.32 ± 0.07 116 ± 3.0 4.47 ± 0.34
K197A 296 ± 34 2.77 ± 0.12 1490 ± 430 1.93 ± 1.39
R198A 56 ± 1.0 2.31 ± 0.02 190 ± 54 4.05 ± 0.9
R199A 224 ± 30 3.91 ± 0.08 186 ± 83 2.87 ± 0.25
B. Hove-Jensen et al. PRibPP synthase flexible catalytic loop
FEBS Journal 272 (2005) 3631–3639 ª 2005 FEBS 3633
enzyme, consistent with ADP binding both to the act-
ive and the allosteric site. From the data it appears
that the cooperativity of ADP binding is reduced for
the K197A mutant enzyme.
Stability of K197A and R199A PRibPP synthases
To see if the mutations had an influence on the qua-

ternary structure, the K197A and R199A mutant as
well as wildtype PRibPP synthases were subjected to
electrophoresis in nondenaturing gels. All three
PRibPP synthases migrated as single species, with a
slight increase in mobility of the K197A enzyme relat-
ive to that of the wildtype enzyme, and with a slight
increase in mobility of the R199A enzyme relative to
that of the K197A enzyme. This is the result expected
from the loss of six positively charged lysine or argin-
ine residues per hexamer (data not shown). In addi-
tion, the temperature of irreversible denaturation of
the three enzymes was analysed by differential scan-
ning calorimetry. This analysis revealed that the major
transition temperature of the wildtype and the two
mutant enzymes was quite similar, as the apparent
transition temperature was determined as 62.8 °C for
the wildtype enzyme, 61.2 °C for the K197A enzyme,
and 62.6 °C for the R199A enzyme (data not shown).
Altogether the results of native gel electrophoresis and
differential scanning calorimetry show that the pres-
ence of alanine rather than lysine at position 197, or
alanine rather than arginine at position 199 appeared
to have no effect on either structure or stability of the
enzyme.
Kinetic analysis of nine other mutants
of the flexible catalytic loop
The remaining mutants were less thoroughly analysed.
Values of V
app
as well as K

m
for ATP were determined
by varying the ATP concentration at a fixed Rib5P
concentration (Table 4). In general the V
app
values
were reduced compared to the V
max
value of the wild-
type enzyme. However, the reduction was much less
severe than that determined for the K197A or R199A
mutant enzymes. The V
app
values ranged between 20
and 100% of the V
max
value of the wildtype enzyme.
The R201A, N203A, E206A and M208A enzymes had
V
app
values similar to the V
max
value of the wildtype.
The K
m
values for ATP varied somewhat, but the
values were not significantly different from the K
ATP
value of the wildtype enzyme reported above, with the
exception of the R201A, N203A and E206A enzymes,

which revealed an approximate 3.0-, 4.5- and 2.5-fold
increase, respectively, in apparent K
m
.
Reaction mechanism of B. subtilis PRibPP
synthase
As mentioned above, the double reciprocal plots of ini-
tial velocity vs ATP and fixed concentrations of Rib5P
or vice versa showed intersecting lines, which indicated
a sequential mechanism. To determine if the binding
of the substrates was ordered or random, product inhi-
bition was analysed. Measurements were made with
both of the products, PRibPP and AMP, varied
against different concentrations of ATP at fixed Rib5P
concentrations and vice versa. Inhibition by AMP was
noncompetitive with respect to Rib5P and competitive
with respect to ATP. Inhibition by P RibPP was com-
petitive with respect to ATP and noncompetitive with
respect to Rib5P. The calculated inhibition constants
are given in Table 5. These are the results predicted
for an ordered binding of the substrates with ATP
binding first and a random release of the products
[16].
Discussion
The kinetic analysis of the K197A and R199A mutant
PRibPP synthases indicates that these amino acids are
vitally important for catalysis because more than
30 000- and 24 000-fold reductions in V
max
values were

determined in the absence of significant effects on
substrate binding, respectively. The K
ATP
and K
Rib5P
values of both mutant enzymes were similar to those
of the wildtype PRibPP synthase. These results
strongly support the hypothesis that Lys197 and
Arg199 are involved in catalysis by interacting with
Table 4. Kinetic constants of wildtype and mutant PRibPP syn-
thases. The concentration of Rib5P was 5.0 m
M. The ATP concen-
tration was varied from 0.025 to 0.8 m
M. The MgCl
2
concentration
exceeded the ATP concentration by at least 2.0 m
M. The data
were fitted to Eqn (4). Standard errors are those given by the
computer program.
Enzyme
V
app
(lmolÆmin
)1
Æ
mg protein
)1
)
K

m(ATP)
(lM)
Wildtype 108 ± 3.9
a
191 ± 33
b
R198A 52 ± 4.6 190 ± 45
P200A 48 ± 10 130 ± 82
R201A 83 ± 14 560 ± 200
P202A 76 ± 8.0 290 ± 110
N203A 130 ± 20 870 ± 210
V204A 24 ± 2.1 190 ± 36
E206A 110 ± 20 480 ± 150
V207A 32 ± 3.0 160 ± 44
M208A 88 ± 8.0 230 ± 55
a
V
max
value from Table 2.
b
K
ATP
value from Table 2.
PRibPP synthase flexible catalytic loop B. Hove-Jensen et al.
3634 FEBS Journal 272 (2005) 3631–3639 ª 2005 FEBS
the b-phosphorus oxygen atoms of the ATP triphos-
phate chain after formation of the enzyme–substrate
complex. According to this hypothesis, this interaction
results in a closure of the flexible catalytic loop, a
requisite for stabilization of the transition state, which

causes a large spatial displacement of the two amino
acids [12]. The remaining nine mutant variants of the
flexible catalytic loop were much less affected and were
of two types. The first type, represented by R201A,
N203A and E206A, and possibly also P202A and
M208A, had V
app
values similar to the V
max
of the
wildtype, whereas their K
m(ATP)
values were signifi-
cantly increased compared to the K
ATP
value of the
wildtype enzyme. This result seems to indicate an
involvement of these residues in the binding of the
substrate ATP. The second type, represented by
R198A, P200A, V204A, and V207A, had reduced V
app
values compared to the V
max
value of the wildtype
enzyme, whereas their K
m(ATP)
values were similar to
the K
ATP
value of the wildtype enzyme.

A flexible loop is also found in several phosphoribo-
syltransferases [19–21]. The conformation of the flag
region, of which the flexible loop is a part, varies con-
siderably; the loop is either completely unresolved or
in a very flexible state [13,14,22]. Furthermore, the act-
ive site of Salmonella enterica serovar Typhimurium
orotate phosphoribosyltransferase is rather solvent-
exposed in the crystal structure [23]. Analysis of
mutant variants of a lysine residue located in this dis-
ordered loop resulted in an enzyme that had a 600- to
1000-fold reduction in the k
cat
value but only a minor
increase of the K
m
values for the substrates, orotate
and PRibPP [24]. Characterization of alanine variants
of the remaining amino acid residues of the flexible
loop revealed an effect on the K
m
values, whereas the
effect on the k
cat
values was minor [22]. It is possible
therefore that Lys197 or Arg199 in the PRibPP syn-
thase-catalysed reaction may play a role similar to that
of this lysine residue in the orotate phosphoribosyl-
transferase-catalysed reaction.
ADP is the primary allosteric inhibitor of PRibPP
synthase and also acts as a competitive inhibitor of the

enzyme from several bacterial species [18,25–27]. ADP
competes with P
i
for binding to the allosteric site of
E. coli PRibPP synthase [28]. Consistent with this pat-
tern of inhibition the K197A and R199A mutant and
the wildtype PRibPP synthases all displayed a noncom-
petitive pattern of ADP inhibition when varied against
ATP. The secondary inhibition plots of the slopes and
intercepts vs the ADP concentration for both enzymes,
which yielded parabolic functions, is consistent with a
complex inhibition mode including a competitive and
a noncompetitive component. However, the K197A
mutant enzyme appeared to be less sensitive to ADP,
because higher ADP concentration was required to
produce the same degree of inhibition as the wildtype
enzyme. This was further confirmed by the kinetic con-
stants for the K197A mutant enzyme, where K
ii
for the
mutant enzyme was increased 12-fold and K
is
was less
altered. These results indicate that the competitive inhi-
bition mechanism is more or less unchanged, whereas
the noncompetitive inhibition mechanism is altered.
Furthermore, the apparent degree of cooperativity of
the K197A mutant enzyme in response to ADP in the
allosteric site is decreased, and Lys197 appears to be
also involved in the allosteric mechanism, which could

be a consequence of an altered structure of the flexible
catalytic loop. Thus, the inhibition mode of ADP (vs
ATP) for the K197A mutant enzyme may involve an
unchanged competitive and an altered noncompetitive
mechanism. The K¢
is
value for the R199A mutant
enzyme was increased similarly to that of the K197A
enzyme, whereas the K¢
ii
value resembled that of the
wildtype enzyme. Consequently the R199A enzyme
appeared to be little or not at all altered with respect to
inhibition by ADP, although a minor reduction in
cooperativity was observed. The R198A enzyme also
resembled the wildtype enzyme in properties. Thus, the
lack of interaction in the R198A enzyme of Arg198
with the Asp186 and Asp196, revealed by the three-
dimensional structure of the wildtype enzyme [12],
apparently did not weaken the tight interactions
between the subunits. Possibly other amino acids might
substitute Arg198, with Arg182 being a candidate for
this interaction. Therefore, in the R198A mutant
enzyme stabilization might be provided by interaction
of Arg182 with Asp186 of the same chain and with
Asp196 of another chain.
Table 5. Mode of inhibition and inhibition constants of wildtype
PRibPP synthase. Inhibition constants were determined as des-
cribed in Experimental procedures. The concentration of MgCl
2

was 10 mM. The data were fitted to Eqn (2) or (3). Standard errors
are those given by the computer program.
Inhibitor Substrate Mode of inhibition K
is
(lM) K
ii
(lM)
AMP ATP
a
Competitive 131 ± 35 –
Rib5P
b
Noncompetitive 353 ± 108 2365 ± 709
PRibPP ATP
c
Competitive 157 ± 50 –
Rib5P
d
Noncompetitive 2877 ± 763 1548 ± 680
a
The concentration of ATP was varied from 0.1 to 2.0 mM in the
presence of 0–1.0 m
M AMP and 5.0 mM Rib5P.
b
The concentration
of Rib5P was varied from 0.1 to 5.0 m
M in the presence of
0–1.0 m
M AMP and 1.5 mM ATP.
c

The concentration of ATP was
varied from 0.1 to 2.0 m
M in the presence of 0–1.0 mM PRibPP and
5.0 m
M Rib5P.
d
The concentration of Rib5P was varied from 0.1 to
5.0 m
M in the presence of 0–1.0 mM PRibPP and 1.5 mM ATP.
B. Hove-Jensen et al. PRibPP synthase flexible catalytic loop
FEBS Journal 272 (2005) 3631–3639 ª 2005 FEBS 3635
The kinetic constants obtained here for the wildtype
B. subtilis PRibPP synthase are somewhat lower than
those reported earlier, which were 660 lm for K
m(ATP)
,
480 lm for K
m(Rib5P)
and 250 lmolÆmin
)1
Æmg protein
)1
for V
app
[26]. The kinetic mechanism of B. subtilis
PRibPP synthase was shown to be sequential as the
products PRibPP and AMP were competitive inhibi-
tors of the enzyme with respect to ATP and noncom-
petitive inhibitors with respect to Rib5P. These results
indicate that binding of the substrates is ordered with

initial binding of ATP followed by binding of Rib5P.
In contrast, the leaving order of the products appears
to be random. A possible sequential mechanism for
B. subtilis PRibPP synthase is summarized in
Scheme 1.
Experimental procedures
Site-directed mutagenesis
Overlap extension PCR was employed to alter the desired
codons using AmpliTaq DNA polymerase (PE Applied Bio-
systems, Foster City, CA) and the four deoxyribonucleotides
(Amersham Biosciences, Hillerød, Denmark) in a Trio-
Thermoblock (Biometra, Go
¨
ttingen, Germany) with stand-
ard cycle settings [29]. The template was DNA of pAB600
harbouring a wildtype B. subtilis prs gene [30]. Two specific
oligodeoxyribonucleotides were used as primers in PCR to
produce a mutant allele. With K197A PRibPP synthase as
an example, these oligodeoxyribonucleotides were 5¢-CGAT
TATCGAT
GCACGCCG (designated K197Ap) and the
complementary 5¢-CGGCG
TGCATCGATAATCG (desig-
nated K197Am) where the underlined codons represent the
altered codon. Two additional oligodeoxyribonucleotides
were used for all mutations: 5¢-CGTTCTGAACAAATC
CAGATGG (designated UHE3) and 5¢-CACACAGAATT
CTCTAGAGG (designated UHE51), which anneal outside
of the region of mutagenesis. PCR was performed with the
oligodeoxyribonucleotides UHE51 and K197Am and with

K197Ap and UHE3. The resulting two DNA fragments
were purified (Qiagen, Hilden, Germany) following agarose
gel electrophoresis and were used as template in a second
round of PCR with the oligodeoxyribonucleotides UHE51
and UHE3 as primers. The DNA fragment resulting from
this second round of PCR was digested by restriction endo-
nucleases EcoRV and NsiI and ligated by T4 DNA ligase
(Amersham Biosciences) to similarly digested DNA of
pAB600. The ligated DNA was transformed to strain
HO1088 [araC
am
araD D(lac)U169 trp
am
mal
am
rpsL relA thi
supF deoD gsk-3 udp Dprs-4] [31] and the resulting plasmid,
pAB700, was isolated and the insert sequenced and com-
pared to the nucleotide sequence of the wildtype prs gene
[32], which confirmed introduction of the mutation. DNA
sequencing was performed using a Thermo Sequenase dye
terminator cycle premix kit (Amersham Biosciences), fol-
lowed by analysis in an Abi Prism 377 DNA Sequencer (PE
Applied Biosystems). A similar procedure was used for each
mutation. The specific primers were 5¢-GCGATTATCGA
TAAA
GCGCGTCCGCGTCC and 5¢-GGACGCGGACG
CGCTTTATCGATAATCGC for R198A, which resulted
in pAB701, 5¢-CGATAAACGC
GCGCCGCGTCC and 5¢-

GGACGCGG
CGCGCGTTTATCG for R199A (pHO377),
5¢-CGCCGT
GCGCGTCCAAACGTGG and 5¢-CCACGT
TTGGACG
CGCACGGCG for P200A (pHO378), 5¢-CGC
CGTCCG
GCACCAAACGTGG and 5¢-CCACGTTTGG
TGCCGGACGGCG for R201A (pHO379), 5¢-CGTCCG
CGT
GCAAACGTGG and 5¢-CCACGTTTGCACGCGG
ACG for P202A (pHO380), 5¢-CGCCGTCCGCGTCCA
GCTGTGGCGGAAGTCATGAATATTGTAGGTAACATC
GAAGGG and 5¢-CCCTTCGATGTTACCTACAATATTC
ATGACTTCCGCCAC
AGCTGGACGCGGACGGCG for
N203A (pHO392), 5¢-CGCCGTCCGCGTCCAAAC
GCCG
CGGAAGTCATGAATATTGTAGGTAACATCGAAGGG
and 5¢-CCCTTCGATGTTACCTACAATATTCATGACT
TCCGC
GGCGTTTGGACGCGGACGGCG for V204A
(pHO393), 5¢-CGTGGCG
GCGGTCATGAATATTGTAGG
and 5¢-CCTACAATATTCATGAC
CGCCGCCACG for
E206A (pHO382), 5¢-CGTGGCGGAA
GCGAGTAGG and
5¢-CCTACAATATTCAT
CGCTTCCGCCACG for V207A

(pHO383), and 5¢-CGTGGCGGAAGTC
GCGAATATTG
TAGG and 5¢-CCTACAATATT
CGCGACTTCCGCCACG
for M208A (pHO385). Oligodeoxyribonucleotides were pur-
chased from Hobolt DNA Syntese (Hillerød, Denmark).
Complementation
E. coli strain HO1088 harbours a deletion of the chromoso-
mal prs gene and therefore requires compounds that may
be converted to the products of the PRibPP-consuming
pathways, guanosine, uridine, histidine, tryptophan and
NAD. The acquisition in strain HO1088 of a prs gene
specifying active PRibPP synthase relieves one or more of
these requirements. Complementation was analysed by pla-
ting transformed cells of strain HO1088 in AB minimal
medium [33] with glucose (0.2%, w ⁄ v) as the carbon source.
Supplements were used at the following concentrations:
E
E E
ATP
[E
Rib5P
ATP
E]
PRibPP
AMP
E
PRibPP
E
AMP

Scheme 1. Possible reaction mechanism of B. subtilis PRibPP syn-
thase with ordered sequential binding of substrates and random
release of products. ‘E’ represents the enzyme.
PRibPP synthase flexible catalytic loop B. Hove-Jensen et al.
3636 FEBS Journal 272 (2005) 3631–3639 ª 2005 FEBS
guanosine, 30 mgÆL
)1
; uridine, 20 mgÆL
)1
; histidine,
40 mgÆL
)1
; tryptophan, 40 mgÆL
)1
; NAD, 40 mgÆL
)1
; thi-
amine, 1.0 mgÆL
)1
. Tetracycline and ampicillin were added
to 10 and 100 mgÆL
)1
, respectively.
Gene expression and enzyme purification
Procedures for expression of the B. subtilis prs gene as well
as purification of PRibPP synthase have been described
previously [30]. E. coli strain HO1088 harbouring the var-
ious plasmids was grown at 37 °C in NZY medium supple-
mented with ampicillin and tetracycline [34]. Cultures of
cells harbouring pAB700 or pHO377 also contained NAD.

At an attenuance at 436 nm of 1–2, prs gene expression
was induced by the addition of isopropyl thio-b-d-galacto-
side (50 lm) and cultures were incubated overnight with
shaking. An attenuance at 436 nm of 1 (1-cm path length)
corresponds to approximately 3 · 10
11
cellsÆL
)1
. Cells were
harvested and stored frozen at )20 °C. Purification of the
mutant variants was performed essentially as previously
described [30], except that the final anion-exchange chroma-
tographic step was modified as follows: the protein solution
in 50 mm Na
2
HPO
4
⁄ NaH
2
PO
4
, pH 7.5 was applied to a
20 mL anion exchange Hiload Q-Sepharose column (Amer-
sham Biosciences), previously equilibrated with the same
buffer, at a rate of 1.0 mLÆmin
)1
and washed with five vol-
umes of the same buffer. PRibPP synthase was eluted by
applying a salt gradient of 0–100% Salt Buffer (1.0 m NaCl
in 50 mm Na

2
HPO
4
⁄ NaH
2
PO
4
, pH 7.5) at a rate of
2.0 mLÆmin
)1
over 60 min. The gradient was an initial lin-
ear increase from 0 to 20% Salt Buffer, followed by a hold
for two column volumes. This was followed by an increase
to 35% Salt Buffer over approximately six column volumes.
The salt concentration was then raised to 100% Salt Buffer.
The enzyme eluted at an NaCl concentration of approxi-
mately 0.30 m. Fractions were collected across the peak of
PRibPP synthase activity and analysed by SDS ⁄ PAGE.
The fractions with highest purity were pooled and dialysed
against multiple changes of 50 mm Na
2
HPO
4
⁄ NaH
2
PO
4
,
pH 7.5. The enzyme was stored refrigerated at protein con-
centrations of 5–10 gÆL

)1
.
Analysis of physical properties of PRib PP
synthases
Hydrodynamic properties of K197A and R199A mutant
PRibPP synthases were analysed by nondenaturing gel elec-
trophoresis in 7.5% (w ⁄ v) polyacrylamide gels (pH 8.8) pre-
pared as described previously with the omission of SDS
[35]. Samples containing 5–10 lgofPRibPP synthase in
50 mm Na
2
HPO
4
⁄ NaH
2
PO
4
, pH 7.5, were loaded in the
gel. The loading dye contained 50 mm Tris ⁄ HCl, pH 6.8,
10% (v ⁄ v) glycerol and 0.025% (v ⁄ v) bromophenol blue.
Electrophoresis was performed at 60 V at room tempera-
ture. The stability of PRibPP synthase was analysed by
differential scanning calorimetry (Microcal, Northampton,
MA) with cell volumes of 1.16 mL. The temperature range
was 15–90 °C, the scan rate was 1 °C per min. Before meas-
urement a protein sample (at a concentration of  1gÆL
)1
)
was dialysed against 50 mm Na
2

HPO
4
⁄ NaH
2
PO
4
, pH 7.5
and degassed by stirring in an evacuated chamber for
5–10 min at room temperature and then immediately loa-
ded into the calorimeter. Buffer (50 mm Na
2
HPO
4
⁄
NaH
2
PO
4
, pH 7.5) was loaded in the reference cell. A pres-
sure of two bars of nitrogen gas was maintained over the
liquids in the cells throughout the scans to prevent degas-
sing during heating. The program origin 3.1 (Microcal)
was used to evaluate the scans.
Assay of PRibPP synthase activity
PRibPP synthase activity was assayed at 37 °C as previously
described [36]. The amount of radioactivity in ATP and
PRibPP spots on thin-layer chromatograms was quantitated
with an Instant Imager model 2024 or with the Cyclone
Storage Phosphor System (PerkinElmer, Wellesley, MA).
The assay components were 50 mm Tris ⁄ HCl pH 8.0 (adjus-

ted at 37 °C), 50 mm NaH
2
PO
4
⁄ Na
2
HPO
4
, 2.0 mm EGTA
and MgCl
2
, which exceeded the nucleotide concentration by
at least 2.0 mm. The ATP and Rib5P concentrations were
varied appropriately. Standard concentrations were 3.0 mm
for ATP and 5.0 mm for Rib5P. Reaction was initiated by
the addition of Rib5P or enzyme, which was appropriately
diluted in 50 mm Tris ⁄ HCl pH 8.0 (adjusted at 37 °C),
50 mm NaH
2
PO
4
⁄ Na
2
HPO
4
, 2.0 mm EGTA and 1.0 gÆL
)1
BSA, to a reaction volume of 100 lL. Protein content was
determined by the bicinchoninic acid procedure (Pierce
Chemical Company Rockford, IL) with BSA as the standard.

Enzyme activity is expressed as lmolÆmin
)1
Æmg protein
)1
.
Kinetic analysis
In kinetic experiments the concentration of substrates was
varied as indicated in Results. Initial velocities are averages
of at least duplicate determinations. For each experiment
determination of initial velocity parameters of the wildtype
and mutant enzymes were analysed by fitting the data to a
sequential mechanism with ATP binding as the first sub-
strate, Eqn (1) by use of the programs hyper [37] or
ultrafit (version 3.0; Biosoft, Cambridge, UK):
v ¼ V
max
½ATP½Rib5P =ðK
iðATPÞ
K
Rib5P
þ K
ATP
½Rib5P
þ K
Rib5P
½ATPþ½ATP½Rib5PÞ ð1Þ
where v is the initial velocity, V
max
is the maximal velocity,
K

i(ATP)
is the dissociation constant for the substrate ATP,
and K
ATP
and K
Rib5P
are the Michaelis–Menten constants
for the substrates ATP and Rib5P, respectively. For
noncompetitive inhibition or competitive inhibition the
initial velocities were fitted to Eqn (2) or (3), respectively.
B. Hove-Jensen et al. PRibPP synthase flexible catalytic loop
FEBS Journal 272 (2005) 3631–3639 ª 2005 FEBS 3637
Equation (4) is the Michaelis–Menten equation for hyper-
bolic substrate saturation kinetics:
v ¼ V
app
½S=fK
m
ð1 þ½I=K
is
Þþ½Sð1 þ½I=K
ii
Þg ð2Þ
v ¼ V
app
½S=fK
m
ð1 þ½I=K
is
Þþ½Sg ð3Þ

v ¼ V
app
½S=ðK
m
þ½SÞ ð4Þ
where V
app
is the apparent maximal velocity and K
m
is the
apparent Michaelis–Menten constant for the varied sub-
strate S. K
ii
and K
is
are the inhibitor constants for the
inhibitor I obtained from the effect on intercepts and
slopes, respectively. When ATP was varied against different
concentrations of ADP, a secondary plot was constructed
with slopes and intercepts from straight lines obtained from
double reciprocal plots. The reciprocal initial velocities were
weighted assuming relative errors [16]. The slopes and inter-
cepts vs ADP concentration were fitted without weighting
to Eqn (5):
Slope ¼ Qf1 þð½I=K
0
is
Þ
n
gð5Þ

where Q is the intercept (here representing K
m
⁄ V
app
), K¢
is
is
the concentration of inhibitor that causes a doubling of the
slope value and n is the apparent Hill coefficient [17]. The
intercepts vs ADP concentration were fitted without weight-
ing to Eqn (5), replacing K¢
is
with K¢
ii
and Q representing
1 ⁄ V
app
. In the experiments above, data were analysed with
ultrafit.
Acknowledgements
We are grateful to Robert L. Switzer and Martin
Willemoe
¨
s for careful reading of the manuscript and to
Bent W. Sigurskjold for performing the scanning dif-
ferential calorimetry. We thank Martin Willemoe
¨
s for
invaluable discussions and Tonny D. Hansen for excel-
lent technical assistance. This work was supported by

the Danish Natural Science Research Council.
References
1 Hove-Jensen B (1988) Mutation in the phosphoribosyl-
pyrophosphate synthetase gene (prs) that results in sim-
ultaneous requirements for purine and pyrimidine
nucleosides, nicotinamide nucleotide, histidine, and tryp-
tophan in Escherichia coli. J Bacteriol 170, 1148–1152.
2 Hove-Jensen B (1989) Phosphoribosylpyrophosphate
(PRPP)-less mutants of Escherichia coli. Mol Microbiol
3, 1487–1492.
3 Jensen KF (1983) Metabolism of 5-phosphoribosyl
1-pyrophosphate (PRPP) in Escherichia coli and
Salmonella typhimurium.InMetabolism of Nucleotides,
Nucleosides and Nucleobases (Munch-Petersen A, ed.),
pp. 1–25. Academic Press, London.
4 White RH (1996) Biosynthesis of methanopterin.
Biochemistry 35, 3447–3456.
5 Finn MW & Tabita FR (2004) Modified pathway to
synthesize ribulose 1,5-bisphosphate in methanogenic
archaea. J Bacteriol 186, 6360–6366.
6 Scherman MS, Kalbe-Bournonville L, Bush D, Xin Y,
Deng L & McNeil M (1996) Polyprenylphosphate-pen-
toses in mycobacteria are synthesized from 5-phospho-
ribose pyrophosphate. J Biol Chem 271, 29652–29658.
7 Kornberg A, Lieberman I & Simms ES (1955) Enzy-
matic synthesis and properties of 5-phosphoribosylpyro-
phosphate. J Biol Chem 215, 389–402.
8 Khorana HG, Fernandes JF & Kornberg A (1958)
Pyrophosphorylation of ribose 5-phosphate in the enzy-
matic synthesis of 5-phosphorylribose 1-pyrophosphate.

J Biol Chem 230, 941–948.
9 Hove-Jensen B & Nygaard P (1982) Phosphoribosyl-
pyrophosphate synthetase of Escherichia coli. Identifica-
tion of a mutant enzyme. Eur J Biochem 126, 327–333.
10 Nilsson D & Hove-Jensen B (1987) Phosphoribosylpyro-
phosphate synthetase of Bacillus subtilis. Cloning, char-
acterization and chromosomal mapping of the prs gene.
Gene 53, 247–255.
11 Eriksen TA, Kadziola A, Bentsen AK, Harlow KW &
Larsen S (2000) Structural basis for the function of
Bacillus subtilis phosphoribosyl-pyrophosphate synthe-
tase. Nat Struct Biol 7, 303–307.
12 Nygaard FB (2001) The molecular mechanism of cata-
lysis and allosteric regulation in the phosphoribosyl-
diphosphate synthase from Bacillus subtilis. Thesis,
University of Copenhagen, Denmark.
13 Smith JL (1999) Forming and inhibiting PRT active
sites. Nat Struct Biol 6, 502–504.
14 Sinha SC & Smith JL (2001) The PRT protein family.
Curr Opin Struct Biol 11, 733–739.
15 Hilden I, Hove-Jensen B & Harlow KW (1995) Inacti-
vation of Escherichia coli phosphoribosylpyrophosphate
synthetase by the 2¢,3¢-dialdehyde derivative of ATP.
Identification of active site lysines. J Biol Chem 270,
20730–20736.
16 Cleland WW (1963) The kinetics of enzyme-catalyzed
reactions with two or more substrates or products.
II. Inhibition: Nomenclature and theory. Biochim Bio-
phys Acta 67, 173–187.
17 Willemoe

¨
s M & Hove-Jensen B (1997) Binding of diva-
lent magnesium by Escherichia coli phosphoribosyl
diphosphate synthetase. Biochemistry 36, 5078–5083.
18 Switzer RL & Sogin DC (1973) Regulation and mechan-
ism of phosphoribosylpyrophosphate synthetase.
V. Inhibition by end products and regulation by adeno-
sine diphosphate. J Biol Chem 248, 1063–1073.
19 Eads JC, Scapin G, Xu Y, Grubmeyer C & Sacchettini
JC (1994) The crystal structure of human hypoxanthine-
guanine phosphoribosyltransferase with bound GMP.
Cell 78, 325–334.
PRibPP synthase flexible catalytic loop B. Hove-Jensen et al.
3638 FEBS Journal 272 (2005) 3631–3639 ª 2005 FEBS
20 Scapin G, Grubmeyer C & Sacchettini JC (1994) Crystal
structure of orotate phosphoribosyltransferase. Biochem-
istry 33, 1287–1294.
21 Henriksen A, Aghajari N, Jensen KF & Gajhede M
(1996) A flexible loop at the dimer interface is a part of
the active site of the adjacent monomer of Escherichia
coli orotate phosphoribosyltransferase. Biochemistry 35,
3803–3809.
22 Schramm VL & Grubmeyer C (2004) Phosphoribosyl-
transferase mechanism and roles in nucleic acid
metabolism. Prog Nucleic Acid Res Mol Biol 75,
261–304.
23 Ozturk DH, Dorfman RH, Scapin G, Sacchettini JC &
Grubmeyer C (1995) Structure and function of Salmo-
nella typhimurium orotate phosphoribosyltransferase:
Protein complementation reveals shared active sites.

Biochemistry 34, 10755–10763.
24 Scapin G, Ozturk DH, Grubmeyer C & Sacchettini JC
(1995) The crystal structure of the orotate phosphoribo-
syltransferase complexed with orotate and a-d-5-phos-
phoribosyl-1-pyrophosphate. Biochemistry 34, 10744–
10754.
25 Hove-Jensen B, Harlow KW, King CJ & Switzer RL
(1986) Phosphoribosylpyrophosphate synthetase of
Escherichia coli. Properties of the purified enzyme and
primary structure of the prs gene. J Biol Chem 261,
6765–6771.
26 Arnvig K, Hove-Jensen B & Switzer RL (1990) Purifica-
tion and properties of phosphoribosyl-diphosphate
synthetase from Bacillus subtilis. Eur J Biochem 192,
195–200.
27 Hove-Jensen B & McGuire JN (2004) Surface exposed
amino acid differences between mesophilic and thermo-
philic phosphoribosyl diphosphate synthase. Eur J
Biochem 271, 4526–4533.
28 Willemoe
¨
s M, Hove-Jensen B & Larsen S (2000) Steady
state kinetic model for the binding of substrates and
allosteric effectors to Escherichia coli phosphoribosyl-
diphosphate synthase. J Biol Chem 275, 35408–35412.
29 Ho SN, Hunt HD, Horton RM, Pullen JK & Pease LR
(1989) Site-directed mutagenesis by overlap extension
using the polymerase chain reaction. Gene 77, 51–59.
30 Bentsen AK, Larsen TA, Kadziola A, Larsen S &
Harlow KW (1996) Overexpression of Bacillus subtilis

phosphoribosylpyrophosphate synthetase and crystalli-
zation and preliminary x-ray characterization of the free
enzyme and its substrate-effector complex. Proteins 24,
238–246.
31 Krath BN & Hove-Jensen B (2001) Class II recombi-
nant phosphoribosyl diphosphate synthase from spi-
nach. Phosphate independence and diphosphoryl donor
specificity. J Biol Chem 276, 17851–17856.
32 Nilsson D, Hove-Jensen B & Arnvig K (1989) Primary
structure of the tms and prs genes of Bacillus subtilis.
Mol Gen Genet 218, 565–571.
33 Clark DJ & Maaløe O (1967) DNA replication and the
division cycle in Escherichia coli. J Mol Biol 23, 99–112.
34 Hove-Jensen B & Maigaard M (1993) Escherichia coli
rpiA gene encoding ribose phosphate isomerase A.
J Bacteriol 175, 6852–6865.
35 Laemmli UK (1970) Cleavage of structural proteins
during the assembly of the head of bacteriophage T4.
Nature 227, 680–685.
36 Jensen KF, Houlberg U & Nygaard P (1979) Thin-layer
chromatographic methods to isolate
32
P-labeled 5-phos-
phoribosyl-a-1-pyrophosphate (PRPP): Determination
of cellular PRPP pools and assay of PRPP synthetase
activity. Anal Biochem 98, 254–263.
37 Cleland WW (1979) Statistical analysis of enzyme kin-
etic data. Methods Enzymol 63 , 103–138.
B. Hove-Jensen et al. PRibPP synthase flexible catalytic loop
FEBS Journal 272 (2005) 3631–3639 ª 2005 FEBS 3639