Báo cáo Y học: Cloning and characterization of the mammalian-specific nicolin 1 gene (NICN1) encoding a nuclear 24 kDa protein doc

Cloning and characterization of the mammalian-specific nicolin 1
gene (
NICN1
) encoding a nuclear 24 kDa protein
Bianca Backofen
1,
*, Ralf Jacob
2,
*, Katrin Serth
3
, Achim Gossler
3
, Hassan Y. Naim
2
and Tosso Leeb
1
1
Institute of Animal Breeding and Genetics and
2
Institute of Physiological Chemistry, School of Veterinary Medicine Hannover;
3
Institute of Molecular Biology, Medical School Hannover, Hannover, Germany
We have identified a novel mammalian gene, termed nicolin 1
gene (NICN1), that is present in human, dog and mouse,
whereas it is absent from the available genome sequences of
nonmammalian organisms. The NICN1 gene consists of six
exons and spans about 6 kb of genomic DNA. It encodes a
213 amino acid protein that does not belong to any known
protein family. Experiments using green fluorescent protein
(GFP)-tagged nicolin 1 fusion proteins indicate that nicolin 1
is a nuclear protein. Northern analysis and semiquantitative

RT-PCR demonstrated that the 2.5 kb NICN1 mRNA is
expressed in a tissue-specific manner. The highest NICN1
expression levels are found in brain, testis, liver, and kidney.
On the other hand the NICN1 expression is weak in spleen,
leukocytes, small intestine and colon. The NICN1 gene is
also expressed during development.
Keywords: nicolin, comparative genomics, human, mouse,
dog.
The initial completion of the human genome sequence
revealed that the function of only about 15 000 of the
estimated 35 000 genes in the human genome is known [1].
Systematic approaches have been undertaken to identify
expressed sequences and full length cDNAs in several model
organisms, which generated a wealth of sequence informa-
tion on previously unidentified genes [2]. However, at
present a most immediate task is the functional character-
ization of all the newly identified genes. In contrast to
genomic and cDNA sequencing, no universal high-through-
put parallel approach is currently available to functionally
characterize mammalian genes. It is therefore still necessary
to investigate single genes experimentally in order to learn
more about their functions.
We have previously identified a novel gene on dog
chromosome 20q15.1-q15.2 by aligning the dog genomic
sequence to expressed sequence tag (EST) sequences from
human and mouse [3,4]. In order to further characterize this
gene, for which we propose the name NICN1,wehavenow
analyzed the human and murine orthologs and provide
initial data on the expression profiles and cellular localiza-
tion of the protein product.

MATERIALS AND METHODS
General methods
Standard molecular biological techniques were performed
as described elsewhere [5]. DNA sequencing using dye
primer sequencing chemistry was performed with the
thermosequenase kit (Amersham Biosciences, Freiburg,
Germany) and a LICOR 4200 L automated sequencer.
Isolation of cDNA and genomic clones of the
NICN1
gene
The isolation of the canine genomic BAC contig containing
the canine NICN1 gene has been described previously [3].
BLAST searches against the human and murine EST
databases with the canine NICN1 cDNA sequence derived
from DDBJ/EMBL/GenBank accession AJ012166 identi-
fied a human (IMAGE: 433564) and a murine (IMAGE:
1349406) cDNA clone that harbored the complete open
reading frame of the NICN1 gene. These clones were
obtained through the Resource Center/Primary Database
of the German Human Genome Project (http://
www.rzpd.de). The inserts of these two clones were com-
pletely sequenced and submitted to the EMBL nucleotide
database under accession AJ299740 and AJ299741. For the
isolation of a murine genomic clone with the Nicn1 gene the
murine RPCI-21 PAC library made from a female 129S6/
SvEvTac mouse [6] was initially screened with PCR primers
Nicn1V (5¢-TTCGGGCTAGTCACACTTC-3¢)and
Nicn1R (5¢-CTAGATGGGCACAGAAAGC-3¢), which
were derived from the murine Nicn1 cDNA sequence. The
PCR was performed at an annealing temperature of 58 °C

and produced a product of 181 bp on mouse genomic
DNA. Three independent Nicn1 PAC clones were identi-
fied. DNA from the PAC clone RPCI-21 469L13 was
isolated using the Qiagen plasmid maxi kit (Qiagen, Hilden,
Germany). To determine the genomic sequence of the
murine Nicn1 gene a primer walking strategy was used until
Correspondence to T. Leeb, Institute of Animal Breeding and Genetics,
School of Veterinary Medicine Hannover, Bu
¨
nteweg 17p,
30559 Hannover, Germany.
Fax: + 49 511 9538582, Tel: + 49 511 9538874,
E-mail:
Abbreviations: GFP, green fluorescent protein; NICN1, nicolin 1 gene;
NLS, nuclear localization signal.
*Note: These authors have contributed equally to the work of this
manuscript.
Note: The sequence data described in this paper have been submitted
to the EMBL nucleotide database under accession numbers
AJ012166, AJ299740, AJ299741, and AJ422131.
(Received 4 July 2002, revised 30 August 2002,
accepted 6 September 2002)
Eur. J. Biochem. 269, 5240–5245 (2002) Ó FEBS 2002 doi:10.1046/j.1432-1033.2002.03232.x
both strands in the region of interest were completely
sequenced. Sequence data were analyzed with
SEQUENCHER
4.0.5 (GeneCodes, Ann Arbor, MI, USA) and deposited
with the EMBL nucleotide database under accession
AJ437692. Further analyses were performed with the online
tools of the European Bioinformatics Institute (http://

www.ebi.ac.uk/), BLAST database searches in the Gen-
Bank database of the National Center for Biotechnology
Information NCBI ( and the
RepeatMasker searching tool for repetitive elements (Smit,
A.F.A. and Green, P., h
ington.edu/).
Northern blot analysis
Northern blot analyses were performed using membranes
with 2 lg poly(A) RNA per lane from Clontech (BD
Biosciences Clontech, Heidelberg, Germany) according to
the manufacturer’s protocols. With the human RNA filter
the 1194 bp EcoRI/NotI insert from the IMAGE 433564
clone was used as NICN1 probe. With the mouse filter an
829-bp EcoRI fragment derived from the IMAGE 1349406
clone was used as Nicn1 probe. For control experiments, the
human b-actin probes provided by Clontech were used. The
probes were labeled with
32
P using the RadPrime labeling
kit (Invitrogen, Karlsruhe, Germany). After hybridization,
the membranes were exposed with intensifying screens
to Kodak Biomax MS films (Amersham Biosciences,
Freiburg, Germany) at )80 °C.
RT-PCR analysis
Semiquantitative RT-PCR experiments were performed
using commercially available multiple tissue panels
(MTC
TM
) panels of first-strand cDNAs (BD Biosciences
Clontech). The concentration of the cDNAs in the used

panels is normalized to four different housekeeping genes.
The PCR analyses of the panels was carried out according
to the manufacturer’s instruction. For the human and
murine NICN1 RT-PCR, a fragment of 194 bp was
amplified using the primers NICN1_V362 (5¢-CAT
CACCACTGTGGCTGTC-3¢) and NICN1_R555
(5¢-CTCTGTCAGTGCCCACATC-3¢) and an annealing
temperature of 60 °C. This experiment was performed two
times independently. In control experiments glyceraldehyde-
3-phosphate dehydrogenase (GADPH) primers supplied
with the human and murine MTC
TM
panels were used to
amplify an 800 bp fragment from the housekeeping gene
GADPH using an annealing temperature of 68 °C. Aliquots
were taken from the PCR reactions during thermal cycling
and loaded on agarose gels for analysis.
In situ
hybridization on whole-mount mouse embryos
A digoxigenin-labeled antisense RNA probe for NICN 1
was generated using a 971-bp XhoI/SacI subfragment from
the murine IMAGE 1349406 clone and T7-RNA poly-
merase (Roche, Mannheim Germany). A sense RNA probe
using T3-RNA Polymerase (Roche, Mannheim, Germany)
was used as a negative control in the experiment. Mouse
embryos at days 8.5, 9.5 and 10.5 were dissected in NaCl/P
i
and fixed overnight at 4 °C in 4% paraformaldehyde. After
washing once with NaCl/P
i

the embryos were dehydrated
throughamethanolseriesandstoredin100%methanolat
)20 °C. Whole-mount in situ hybridization was performed
following a standard procedure [7] with minor modifications
using an InsituPro #10.000 (INTAVIS Bioanalytical
Instruments AG, Bergisch Gladbach, Germany). In brief,
the hybridization was carried out at 65 °C. After extensive
washes, alkaline phosphatase-conjugated anti-digoxigenin
antibody Fab fragment (Roche, Mannheim, Germany) was
diluted 1 : 5000 and applied. The coloration was performed
in BM Purple substrate (Roche, Mannheim, Germany) for
several hours at 37 °C.
Expression constructs and transient transfection
of COS-1 cells
The entire protein coding sequence of the human NICN1
cDNA was PCR amplified with Pfu turbo DNA poly-
merase (Stratagene, Heidelberg, Germany) and cloned into
the BamHI/XhoI sites of the pEGFP-C1 or pEGFP-N1
vector (BD Biosciences Clontech). The resulting expression
constructs were termed pEGFPNICN1 [green fluorescent
protein (GFP) is fused to the N-terminus of nicolin 1] or
pNICN1EGFP (GFP is fused to the C-terminus of nicolin
1). The protein coding regions of these two constructs were
verified by DNA sequencing.
COS-1 cells were transiently transfected with DNA by
using DEAE-dextran essentially as described previously [8].
The plasmids were diluted in 1.5 mL of serum-free DMEM
(Gibco Life Technologies, Eggenstein, Germany), contain-
ing 500 lg of DEAE-dextran and incubated at room
temperature for 30 min. The cells were rinsed twice with

NaCl/P
i
and overlaid with the DNA–complex solution
followed by incubation at 37 °Cfor1.5hinaCO
2
incubator. Subsequently, the solution was removed and
10 mL of DMEM containing 600 lg chloroquine was
added for 3 h. The cells were used 48–60 h after transfection
for immunoprecipitation. Cells for confocal analysis were
treated in the same manner except that no chloroquine was
added.
Biosynthetic labeling of transfected cells
and immunoprecipitation of cell extracts
COS-1 cells were cultured in DMEM supplemented with
10% fetal calf serum, 50 UÆmL
)1
penicillin and 50 mgÆmL
)1
streptomycin (denoted complete medium). They were
transfected without DNA (mock) or with 2 lgofthe
appropriate recombinant DNA using DEAE-dextran as
described above. Transiently transfected COS-1 cells were
labeled 48–60 h post-transfection for 2 h with 80 lCi of
[
35
S]methionine in methionine-free DMEM containing 2%
fetal calf serum, 50 UÆmL penicillin and 50 mgÆmL
)1
streptomycin (denoted met-free medium). Cells were solu-
bilized with 1 mLÆdish

)1
of cold lysis buffer essentially as
described before [8]. The lysates were incubated with the
mouse anti-GFP antibody B34 (Babco) and precipitated
with protein A-Sepharose. Following immunoprecipitation,
the protein A-Sepharose beads were washed three times
with washing buffer A (0.5% Triton X-100, 0.05% sodium
deoxycholate in NaCl/P
i
) and three times with washing
buffer B (500 m
M
NaCl, 10 m
M
EDTA, 0.5% Triton X-100
in 125 m
M
Tris/HCl pH 8.0) prior to analysis of the samples
by SDS/PAGE and phosphorimaging.
Ó FEBS 2002 Nicolin 1 gene (NICN1)(Eur. J. Biochem. 269) 5241
Confocal fluorescence microscopy
Confocal images of living cells were acquired 2 days after
transfection on a Leica TCS SP2 microscope with an · 63
water planapochromat lens (Leica Microsystems). GFP-
images of transfected COS-1 cells on coverslips were
obtained with the 488 nm excitation line of an argon laser
and an emission range between 505 and 525 nm for
fluorescence detection as described previously [9].
RESULTS AND DISCUSSION
Analysis of the NICN1 cDNA sequence

During the detailed analysis of a 162-kb dog genomic DNA
sequence [3,4], we observed the presence of a previously
undescribed gene that showed highly significant matches to
several ESTs in the databases. The novel gene was termed
nicolin 1 (NICN1). A BLAST search against the EST-
database with the NICN1 cDNA resulted in 85 exclusively
mammalian hits with E-values < 10
)10
. The database
searches clearly verified the existence of NICN1 transcripts
in different mammalian species such as human, mouse, rat,
cattle and pig, whereas homologous sequences are absent
from nonmammalian species including the completely
sequenced model organisms. We obtained a human and a
murine NICN1 cDNA clone from the IMAGE collection
and determined the complete sequences of these cDNAs.
The comparative analysis of the human, canine, and murine
NICN1 cDNA revealed a highly conserved open reading
frame in all three species. In all three species, the encoded
NICN1 protein consists of 213 amino acids and has a
calculated molecular weight of 24 kDa (Fig. 1). The amino
acid sequences of the NICN1 proteins are 94% identical
between human and dog, and 89% identical between
human and mouse. The NICN1 protein does not belong to
any known protein family. It does not possess a signal
sequence at the N-terminal end for translocation into the
endoplasmic reticulum and it does not contain a hydro-
phobic transmembrane region, which could function as a
membrane-anchoring domain.
Genomic organization of the NICN1 gene

The genomic DNA sequences of the canine and murine
NICN1 genes were determined from genomic BAC or PAC
clones and submitted to the EMBL nucleotide database
(accessions AJ012166, AJ422131). Partial genomic
sequences of the human NICN1 gene were available from
the human genome draft sequence (contig accession
NT_022439). A comparison between the genomic sequences
and the previously obtained cDNA sequences revealed a
conserved genomic organization of six closely spaced exons
for the canine [3,4] and murine NICN1 gene. Southern
blotting confirmed that the murine Nicn1 gene is a single
copy gene (data not shown), whereas in the human genome
a processed pseudogene of the NICN1 gene, termed
NICN2P, is located at HSA Xp11.22–11.3 (EMBL acces-
sion AL591503). According to the current human and
murine genome sequences the human NICN1 gene is
located at HSA 3p21 while the murine ortholog Nicn1 is
located at MMU 9F.
The location of the exon/intron boundaries in the
NICN1 gene with respect to the protein coding sequence is
completely conserved between human, dog and mouse
(Table 1). In dog, all the introns have the canonical
GT-AG dinucleotides at the splice junctions, whereas in
mouse, the third intron belongs to the rare class of
GC-AG introns that are also recognized by U1/U2
containing spliceosomes [10]. In human, dog and mouse
the NICN1 gene is immediately followed by the AMT gene
for aminomethyltransferase, an enzyme of glycine meta-
bolism [4,11]. The promoters of the canine and murine
NICN1 genes lack a TATA box-motif. In both species, the

sequences in the promoter regions fulfill the criteria of
CpG islands (CpG obs/exp > 0.6 and GC > 50%)
although the GC content is just barely above 50%. In
the mouse the transcription start site could be tentatively
assigned as a full length murine cDNA sequence is
available through the RIKEN mouse cDNA project [2;
EMBL accession AK013602].
Expression of the
NICN1
gene
To investigate the expression profile of the NICN1 gene in
different adult tissues, we performed Northern blot analyses
with human and murine RNAs (Fig. 2). In human and
mouse, specific signals were obtained at a size of approxi-
mately 2.5 and 2.3 kb, respectively. The size of the murine
transcript is in good agreement with our murine genomic
data, which allow the calculation of a cDNA size of 2133 nt
without the poly(A) tail. Expression levels of the NICN1
gene were measured from the signal intensities on the
autoradiograms. To validate the expression analysis we also
performed semiquantitative RT-PCR analysis on normal-
ized RNAs from different tissues (Fig. 3). The expression
data from these two experiments are summarized in Fig. 4.
Although there is some variation between the expression
level seen in the Northern analyses and in the RT-PCRs, the
two experiments clearly indicate a tissue-specific expression
pattern of the NICN1 gene. Tissues with strong NICN1
expression are brain, testis, liver and kidney. Intermediate
expression was observed in heart, skeletal muscle, placenta,
pancreas and lung, whereas in peripheral blood leukocytes,

spleen, thymus, small intestine and colon the observed
Fig. 1. Alignment of the nicolin 1 amino acid sequences of human,
mouse, and dog. Dashes represent identical amino acids. The positions
of the exon boundaries with respect to the protein sequence are indi-
cated by arrows.
5242 B. Backofen et al. (Eur. J. Biochem. 269) Ó FEBS 2002
expression was weak. Independent evidence from separate
experiments provides confirmation for these rough classifi-
cations in many of the investigated tissues. However, in liver
strong NICN1 expression was observed in both mouse
experiments and in the human RT-PCR analysis but not in
the human Northern analysis. One possible explanation for
this apparent discrepancy could be that the NICN1
expression in liver is not constantly high but dependent on
the metabolic state of the organ. As the RNA for the
Northern blot and the RT-PCR analysis had been derived
from two different anonymous human donors the differ-
ences in the observed NICN1 expression levels in these two
samples might reflect differences in the physiological liver
conditions.
In addition to the analysis of adult tissues, the RT-PCR
analysis provided evidence that the murine Nicn1 gene is also
expressed during development (Fig. 3). A more detailed
analysis of the expression of the Nicn1 gene at days 8.5, 9.5,
and 10.5 of murine development was performed by in situ
hybridization of digoxigenin-labeled riboprobes to whole-
mount mouse embryos. These experimentsshowed auniform
staining of the mouse embryos (data not shown) indicating
the presence of Nicn1 transcripts in all tissues of the
developing embryosat the investigateddevelopmental stages.

Fig. 2. Northern blot analysis of the human and murine NICN1 genes.
Membranes containing 2 lg poly(A) RNA per lane from different
tissues were hybridized with
32
P-labeled probes. After the hybridiza-
tions with human or murine NICN1 probes, control experiments with
b-actin probes were performed to verify the amounts of target RNA
that had been present in different lanes. Exposure times were 24 h for
the NICN1 hybridizations, 2 h for the human b-actin control hybrid-
ization, and 30 min for the b-actin control hybridization on the mouse
blot.
Fig. 3. Semiquantitative RT-PCR analysis of human and murine NICN1
genes. Normalized cDNAs from different tissues were used as templates
in semiquantitative RT-PCR experiments. In the upper five panels, the
amplification of a NICN1 fragment after 24, 26, 30, 34 and 38 cycles of
PCR is shown. The NICN1 amplification was performed with identical
primers and conditions on the human and murine cDNA panel. In the
lower panel the amplification of a GADPH control fragment after 26
cycles of PCR is shown to verify that similar amounts of cDNA had
been present. Note that the used cDNA panels are normalized to four
different housekeeping genes, therefore slight differences in the amount
of GADPH are expected. M, size standard (1 kb ladder); neg, negative
control without cDNA template.
Table 1. Exon-intron junctions of the murine Nicn1 gene. Exon sequences are shown in uppercase letters and intron sequences in lowercase letters.
Untranslated parts of the exons are shown in italics. The conserved dinucleotides at exon-intron junctions are shown in bold. Note that intron 3
belongs to the rare class of GC-AG introns while all the other introns have the typical GT-AG splice junctions. For the first exon the transcription
start site is shown instead of a 3¢ splice site. For the last exon the polyadenylation signal (underlined) and the most common polyadenylation site
(bold underlined) are shown instead of a 5¢ splice site. Numbers refer to the corresponding positions in the Nicn1 cDNA with +1 at the adenosine of
the translation initiation codon.
3¢-splice site Exon 5¢-splice site

Intron
phase
Intron
size
)102 132
aaacgttatgtggccT
GGGAG
… (exon 1, 234 bp) … TTCGAGgtgagcaacccccca 0 2647 bp
133 309
tcgtttgtattct
agTTGCAG … (exon 2, 177 bp) … CACCAG
gt
cagctgggcctca 0 418 bp
310 423
tggtatgtgtgtc
agATGCTG … (exon 3, 114 bp) … CCAAAGgcaagtgactttgca 0 401 bp
424 495
gcctttgctttgc
agAGCCCC … (exon 4, 72 bp) … CTTGAGgtaagctctctaaca 0 371 bp
496 600
ttccttctggagc
agGGTCTC … (exon 5, 105 bp) … TTCGACgtgagtaacagtgtc 0 74 bp
601 2031
tttcttgtgttgc
agGTGGAT … (exon 6, 1431 bp) …
AATAAATACTTGTGGAATAT
G
Ó FEBS 2002 Nicolin 1 gene (NICN1)(Eur. J. Biochem. 269) 5243
Cellular localization of nicolin 1
Expression constructs were prepared, in which the GFP was

fused to the N- or C-terminal ends of human nicolin 1.
COS-1 cells were transiently transfected with these two
constructs termed pEGFPNICN1 and pNICN1EGFP. To
assess the expression of the full length fusion proteins,
transfected COS-1 cells were metabolically labeled with
[
35
S]methionine and the cellular extracts were immunopre-
cipitated using an anti-GFP antibody. As shown in Fig. 5, a
NICN1-GFP fusion protein with an apparent molecular
weight of about 53 kDa was detected, which corresponds
well to the expected size of 53 143 Da.
We next investigated the potential localization of the
NICN1-GFP fusion protein in transfected COS-1 cells
using confocal laser microscopy. A strong nuclear fluores-
cence became visible 48 h after transfection of cells with
either pEGFPNICN1 or with pNICN1EGFP but not with
the pEGFP-C1 control vector (Fig. 5). A strong GFP-
staining of the fusion proteins was detected in the nuclei,
whereas staining of the cytosol and the nucleoli of trans-
fected cells was less intensive. These data provide strong
evidence for a nuclear localization of nicolin 1 regardless of
the mode of fusion with the GFP (i.e. N- or C-terminal).
Apparently the fusion of GFP had no substantial influences
on the structural features or on putative signals that sort the
Fig. 4. Quantification of NICN1 expression in
different tissues. Thegraphswerecalculated
from the experiments shown in Figs 2 and 3.
In each experiment the tissue with the highest
expression level was set to 100. The height of

the other bars indicates the relative amount of
NICN1 mRNA in the other tissues. (A) In the
human Northern blot, NICN1 signal intensi-
ties were normalized with respect to the
b-actin signals. (B) In the human RT-PCR
analysis NICN1 signal intensities after 34
cycles were normalized with respect to the
GADPH signals after 26 cycles. (C) In the
mouse Northern blot, Nicn1 signal intensities
were normalized with respect to the b-actin
signals. (D) In the mouse RT-PCR analysis,
Nicn1 signal intensities after 30 cycles were
normalized with respect to the Gapdh signals
after 26 cycles.
Fig. 5. Cellular localization of the nicolin 1 protein. (A) Confocal
images of representative COS-1 cells transfected with pNICN1EGFP
or pEGFPNICN1 48 h after transfection. The cells show a strong
nuclear fluorescence indicating a translocation of the fusion proteins
into the nucleus. Nuclear translocation is seen with both N- and
C-terminal NICN1-GFP fusion proteins. In contrast, cells that were
transfected with the control plasmid pEGFP-C1 encoding GFP
without any fused sequences showed only cytoplasmic fluorescence.
(B) To confirm the correct expression of full-length fusion proteins an
immunoprecipitation of COS-1 cell extracts was performed. Transi-
ently transfected COS-1 cells were labeled for 2 h with [
35
S]methionine.
Following immunoprecipitation with mAb anti-GFP the samples were
analyzed by SDS/PAGE on a 10% slab gel. After electrophoresis the
gels were fixed and analyzed on a phosphorimaging device. The

observed size of the precipitated material corresponds to the expected
size of the fusion protein. Similar results were obtained with the con-
struct pNICN1EGFP.
5244 B. Backofen et al. (Eur. J. Biochem. 269) Ó FEBS 2002
nicolin 1 protein to the nucleus. Interestingly, translation of
the cDNA sequence did not reveal a canonical basic nuclear
localization signal (NLS) that has been found for many
other nuclear proteins [12]. This indicates that NICN1 is
translocated into the nucleus by a pathway different from
that utilizing the classical NLS signal [13]. For instance,
nuclear targeting may occur through O-linked N-acetylglu-
cosaminyl residues, which have been demonstrated to direct
neoglycoproteins to the nucleus [14].
In conclusion, we have identified a novel mammalian
protein designated nicolin 1. The nicolin 1 genes (NICN1)
were characterized in human, mouse and dog. The observed
tissue-specific expression of the NICN1 gene and the nuclear
localization of the nicolin 1 protein provide initial evidence
for future studies to investigate the function of this novel
protein.
ACKNOWLEDGMENTS
We thank H. Klippert and S. Neander for expert technical assistance.
WewouldalsoliketothankF.Martins-WessforhelpwiththeRT-
PCR experiments.
REFERENCES
1. International Human Genome Sequencing Consortium (2001)
Initial sequencing and analysis of the human genome. Nature 409,
860–921.
2. Kawai, J., Shinagawa, A., Shibata, K., Yoshino, M., Itoh, M.,
Ishii, Y., Arakawa, T., Hara, A., Fukunishi, Y., Konno, H.,

Adachi, J., Fukuda, S., Aizawa, K., Izawa, M., Nishi, K., Kiyo-
sawa,H.,Kondo,S.,Yamanaka,I.,Saito,T.,Okazaki,Y.,
Gojobori, T., Bono, H., Kasukawa, T., Saito, R., Kadota, K.,
Matsuda, H., Ashburner, M., Batalov, S., Casavant, T., Fleisch-
mann, W., Gaasterland, T., Gissi, C., King, B., Kochiwa, H.,
Kuehl, P., Lewis, S., Matsuo, Y., Nikaido, I., Pesole, G., Quac-
kenbush, J., Schriml, L.M., Staubli, F., Suzuki, R., Tomita, M.,
Wagner, L., Washio, T., Sakai, K., Okido, T., Furuno, M., Aono,
H., Baldarelli, R., Barsh, G., Blake, J., Boffelli, D., Bojunga, N.,
Carninci, P., de Bonaldo, M.F., Brownstein, M.J., Bult, C., Flet-
cher, C., Fujita, M., Gariboldi, M., Gustincich, S., Hill, D.,
Hofmann,M.,Hume,D.A.,Kamiya,M.,Lee,N.H.,Lyons,P.,
Marchionni, L., Mashima, J., Mazzarelli, J., Mombaerts, P.,
Nordone, P., Ring, B., Ringwald, M., Rodriguez, I., Sakamoto,
N., Sasaki, H., Sato, K., Schonbach, C., Seya, T., Shibata, Y.,
Storch, K.F., Suzuki, H., Toyo-oka, K., Wang, K.H., Weitz, C.,
Whittaker, C., Wilming, L., Wynshaw-Boris, A., Yoshida, K.,
Hasegawa, Y., Kawaji, H., Kohtsuki, S. & Hayashizaki, Y. (2001)
Functional annotation of a full-length mouse cDNA collection.
Nature 409, 685–690.
3. Leeb, T., Neumann, S., Deppe, A., Breen, M. & Brenig, B. (2000)
Genomic organization of the dog dystroglycan gene DAG1 locus
on chromosome 20q15.1-q15.2. Genome Res. 10, 295–301.
4. Leeb, T., Breen, M. & Brenig, B. (2000) Genomic structures and
sequences of two closely linked genes (AMT, TCTA)ondog
chromosome 20q15.1 fi q15.2. Cytogenet. Cell Genet. 89, 98–100.
5. Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seid-
man,J.G.,Smith,J.A.&Struhl,K.(1995)Current Protocols in
Molecular Biology. John Wiley & Sons Inc, New York.
6. Osoegawa,K.,Tateno,M.,Woon,P.Y.,Frengen,E.,Mammoser,

A.G., Catanese, J.J., Hayashizaki, Y. & de Jong, P.J. (2000)
Bacterial artificial chromosome libraries for mouse sequencing
and functional analysis. Genome Res. 10, 116–128.
7. Wilkinson, D.G. (1992) In Situ Hybridization: a Practical
Approach (Wilkinson, D.G., ed.), pp. 75–83. IRL, Oxford, UK.
8. Jacob, R., Alfalah, M., Gru
¨
nberg, J., Obendorf, M. & Naim, H.Y.
(2000) Structural determinants required for apical sorting of an
intestinal brush-border membrane protein. J. Biol. Chem. 275,
6566–6572.
9. Jacob, R., Weiner, J.R., Stadge, S. & Naim, H.Y. (2000) Addi-
tional N-glycosylation and its impact on the folding of intestinal
lactase-phlorizin hydrolase. J. Biol. Chem. 275, 10630–10637.
10. Burset, M., Seledtsov, I.A. & Solovyev, V.V. (2001) SpliceDB:
database of canonical and non-canonical mammalian splice sites.
Nucleic Acids Res. 29, 255–259.
11. Backofen, B. & Leeb, T. (2002) Genomic organization of the
murine aminomethyltransferase gene (Amt). DNA Sequence 13,
179–183.
12. Kalderon, D., Roberts, B.L., Richardson, W.D. & Smith, A.E.
(1984) A short amino acid sequence able to specify nuclear loca-
tion. Cell 39, 499–509.
13. Jans, D.A., Xiao, C.Y. & Lam, M.H. (2000) Nuclear targeting
signal recognition: a key control point in nuclear transport?
Bioessays 22, 532–544.
14. Duverger, E., Pellerin-Mendes, C., Mayer, R., Roche, A.C. &
Monsigny, M. (1995) Nuclear import of glycoconjugates is distinct
from the classical NLS pathway. J. Cell Sci. 108, 1325–1332.
SUPPLEMENTARY MATERIAL

The following material is available from http://www.
blackwell-science.com/products/journals/suppmat/EJB/
EJB3232/EJB3232sm.htm
Fig. S1. Whole-mount in situ hybridization on mouse embryos
with Nicn1 riboprobes.
Ó FEBS 2002 Nicolin 1 gene (NICN1)(Eur. J. Biochem. 269) 5245