Báo cáo Y học: Fusion of farnesyldiphosphate synthase and epi-aristolochene synthase, a sesquiterpene cyclase involved in capsidiol biosynthesis in Nicotiana tabacum docx

Fusion of farnesyldiphosphate synthase and
epi
-aristolochene
synthase, a sesquiterpene cyclase involved in capsidiol biosynthesis
in
Nicotiana tabacum
Maria Brodelius
1
, Anneli Lundgren
1
, Per Mercke
2,†
and Peter E. Brodelius
1
1
Department of Chemistry and Biomedical Sciences, University of Kalmar, Sweden;
2
Department of Plant Biochemistry,
Lund University, Sweden
A clone encoding farnesyl diphosphate synthase (FPPS)
was obtained by PCR from a cDNA library made from
young leaves of Artemisia annua. A cDNA clone encoding
the tobacco epi-aristolochene synthase (eAS) was kindly
supplied by J. Chappell (University of Kentucky, Lex-
ington, KY, USA). Two fusions were constructed, i.e. FPPS/
eAS and eAS/FPPS. The stop codon of the N-terminal en-
zyme was removed and replaced by a short peptide (Gly-Ser-
Gly) to introduce a linker between the two ORFs. These two
fusions and the two single cDNA clones were separately
introduced into a bacterial expression vector (pET32).
Escherichia coli was transformed with the expression vectors

and enzymatically active soluble proteins were obtained after
induction with isopropyl thio-b-
D
-thiogalactoside. The
recombinant enzymes were purified using immobilized metal
affinity chromatography on Co
2+
columns. The fusion
enzymes produced epi-aristolochene from isopentenyl
diphosphate through a coupled reaction. The K
m
values of
FPPS and eAS for isopentenyl diphosphate and farnesyl
diphosphate, respectively, were essentially the same for the
single and fused enzymes. The bifunctional enzymes showed
a more efficient conversion of isopentenyl diphosphate to
epi-aristolochene than the corresponding amount of single
enzymes.
Keywords: bifunctional enzyme; epi-aristolochene synthase;
farnesyl diphosphate synthase; gene fusion; recombinant
expression.
The enzymatic machinery of a living cell is very complex.
Thousands of enzymes are present and the flow of
metabolites has to be tightly regulated. Consequently,
enzymes are localized to different organelles and within a
specific organelle the enzymes are organized in different
ways. They may be found as soluble, membrane-associated
or membrane-integrated enzymes. In order to make meta-
bolism more efficient, enzymes catalysing sequential reac-
tions are often found in close proximity to each other. They

may form aggregates, be immobilized close to each other by
adsorption to cellular structures or they may be organized in
bi- or multifunctional enzymes within one single polypep-
tide chain. Such enzymes exhibit substrate channelling
which is a process by which two or more sequential enzymes
of a pathway interact to transfer a metabolite directly from
one active site to the next without allowing free diffusion of
the intermediate [1,2]. Channelling is believed to play an
important role in metabolic regulation and cellular control
of enzymatic activities. The three-dimensional structures of
bifunctional enzymes indicate that channelling can be
achieved in different manners. In tryptophan synthase from
Salmonella typhimurium, a hydrophobic 25 A
˚
tunnel, which
matches the dimensions of the intermediate indole, connects
the two active sites [2]. In the bifunctional enzyme thymidine
synthase/dihydrofolate reductase from the protozoan Leish-
mania major, the dihydrofolate intermediate is channelled
on the basis of electrostatic interactions at the protein
surface [3]. In abietadiene synthase from grand fir, two
distinct active sites within a structural domain catalyse two
sequential, mechanistically different cyclizations to form the
tricyclic perhydrophenanthrene-type structure of abietadi-
ene from the universal diterpene precursor geranylgeranyl
diphosphate [4]. The copalyl diphosphate intermediate
diffuses between the two active sites in this monomeric
enzyme.
Artificial bi- or multi-functional enzymes may be
obtained by fusion of two or more structural genes [5].

The translational 3¢ terminus of the first gene is deleted
along with any prosequence at the 5¢ terminus of the second
gene and the genes are ligated in-frame. A small linker
sequence coding for a few amino acids is often introduced
between the two structural genes. This linker separates the
two proteins in space by a small distance allowing each of
them to fold properly without constrains from the other
protein molecule. Linkers of different length have been used
but it has been shown that if a too long linker is used the
proximity effect is abolished [6]. Direct fusion of enzymes
Correspondence to P. E. Brodelius, Department of Chemistry and
Biomedical Sciences, University of Kalmar, S-39182 Kalmar, Sweden.
Fax: + 46 480 446262, Tel.: + 46 480 447358,
E-mail:
Abbreviations: ADS, amorpha-4,11-diene synthase; eAS, epi-aristo-
lochene synthase; FPP, farnesyl diphosphate; FPPS, farnesyl diphos-
phate synthase; GPP, geranyl diphosphate; IPP, isopentenyl
diphosphate; IMAC, immobilized metal affinity chromatography;
IPTG, isopropyl thio-b-
D
-thiogalactoside.
Enzymes: farnesyl diphosphate synthase (EC 2.5.1.10); epi-aristolo-
chene synthase (EC 4.1.99.7).
Present address: Plant Research International, Business Unit Cell
Cybernetics, PO Box16, 6700 AA Wageningen, the Netherlands.
(Received 18 February 2002, revised 13 May 2002,
accepted 13 June 2002)
Eur. J. Biochem. 269, 3570–3577 (2002) Ó FEBS 2002 doi:10.1046/j.1432-1033.2002.03044.x
without a linker may also result in an active bifunctional
enzyme [7].

Fused genes may be expressed in a suitable host (e.g.
Escherichia coli) and the recombinant bi- or multi-
functional enzyme used to study the effects of fusion
on enzyme kinetics and stability. In a number of studies,
it has been shown that recombinant fused enzymes
exhibit a higher catalytic efficiency than the correspond-
ing mixture of single enzymes. Some examples are
D
-hydantoinase/N-carbamylase [7], b-galactosidase/galac-
tokinase [8], citrate synthase/malate dehydrogenase [9],
aminocyclopropane-carboxylic acid synthase/aminocyclo-
propane-carboxylic acid oxidase [10], and trehalose-6-
phosphate synthetase/trehalose-6-phosphate phosphatase
[11]. However, it has recently been argued, based on
kinetic studies, that these bifunctional enzymes do not
exhibit substrate channelling [12,13]. The higher catalytic
efficiency, observed for these bifunctional enzymes, is
entirely due to proximity effects.
The use of fused enzymes for metabolic engineering at
a branching point of a biosynthetic pathway is of great
potential. However, so far this approach has been used
to a relatively limited extent. The lactose utilization [6]
and the osmotolerance of E. coli [14] have been
influenced by introduction of the bifunctional enzymes
b-galactosidase/galactokinase and c-glutamyl kinase/
c-glutamyl phosphate reductase, respectively. The starch
degrading bifunctional enzyme a-amylase/glucose isom-
erase was expressed in potato tubers and upon heating
(65 °C for 45 min) of the crushed fresh tubers, glucose
and fructose was produced from the starch present in the

tubers [15]. The a-amylase/glucose isomerase fusion is not
active at ambient temperatures and therefore it did not
have any adverse effects on plant development and
metabolism.
We are involved in studies on the biosynthesis of
sesquiterpenoids in plants with the aim of improving by
metabolic engineering the amount of sesquiterpenes pro-
duced. The common precursor for sesquiterpenoids is
farnesyl diphosphate (FPP), which is also a substrate for
the biosynthesis of other terpenoid metabolites such as
sterols (Fig. 1). Sesquiterpene and sterol biosynthesis occurs
in the cytosol while the biosynthesis of mono- and
diterpenes take place in plastids.
From studies with cell cultures of tobacco, it is well
established that the sesquiterpene synthase, epi-aristolo-
chenesynthase(eAS), involved in biosynthesis of the
phytoalexin capsidiol, is induced upon treatment of the
culture with a fungal elicitor [16,17]. A coordinated
reduction in activity of squalene synthase (SS), an enzyme
catalysing the formation of squalene from two molecules of
FPP, is observed. Obviously, a shift in flow of metabolites,
i.e. FPP, is achieved by these changes of enzyme activities
and the conversion of FPP to epi-aristolochene is a
regulatory step in sesquiterpene biosynthesis. FPP is
produced from isopentenyl diphosphate/dimethylallyl
diphosphate by farnesyl diphosphate synthase (FPPS).
Thus, fusion of the two enzymes, FPPS and eAS, would
give a bifunctional enzyme that catalyses the conversion of
the C
5

-substrate isopentenyl diphosphate (IPP) to the
complex C
15
-product epi-aristolochene (Fig. 1). The
expression of this bifunctional enzyme in plant cells
may result in an increased metabolic flow into sesquit-
erpene biosynthesis. This phenomenon may be even more
pronounced as the enzymes are located on each side of
an important branching point of terpene metabolism.
Transformation of tobacco with a gene construct enco-
ding the FPPS/eAS will lead to increased formation of
epi-aristolochene and possibly the phytoalexin capsidiol
with a simultaneous decrease in biosynthesis of sterols.
We have constructed, expressed in E. coli and partially
characterized fusions of FPPS and eAS as a step in our
efforts to increase the yield of sesquiterpenes in plants by
metabolic engineering.
MATERIALS AND METHODS
Reagents
Restriction enzymes, [1-
14
C]IPP (55 mCiÆmmol
)1
)and
[1-
3
H]FPP (16 CiÆmmol
)1
) were from Amersham-Pharma-
cia Biotech. Isopropyl thio-b-

D
-thiogalactopyranoside
(IPTG), IPP, geranyl diphosphate (GPP) and FPP were
from Sigma. The tobacco eAS cDNA clone (TEAS) was
kindly provided by J. Chappell, University of Kentucky,
Lexington.
PCR cloning of FPPS from
Artemisia annua
A cDNA library, previously constructed from poly(A
+
)
RNA extracted from young leaves of A. annua,wasusedto
amplify a fragment encoding FPPS by PCR [18]. Primers
for the PCR reaction were designed according to a
published sequence of FPPS from A. annua [19]. Primers
P1 (forward) and P2 (reverse) contained an NcoIandaXhoI
restriction site, respectively (Table 1).
PCR was carried out in a total volume of 50 lLwiththe
following reagents: 1 · cloned Pfu polymerase buffer
(Stratagene), 0.2 m
M
dNTPs (Pharmacia), 20 pmol of each
primer and 1 U Turbo Pfu polymerase (Stratagene). PCR
cycling was: two cycles of 94 °C(0.5min),50°C(1.0min),
72 °C (1.5 min); 29 cycles of 94 °C (0.5 min), 56 °C(1 min),
72 °C (1.5 min); 72 °C (5 min). The amplified fragment was
resolved on a 1% agarose gel and visualized by staining with
ethidium bromide.
The FPPS-wild type fragment was digested with NcoIand
XhoI. The bacterial expression vector pET32c (Novagen)

Fig. 1. Biosynthetic pathway from IPP to the sesquiterpene epi-aristo-
lochene and squalene. The reaction carried out by the bifunctional
enzymes described here is depicted within the shaded area.
Ó FEBS 2002 Fusions of FPPS and epi-aristolochene synthase (Eur. J. Biochem. 269) 3571
was cleaved with the same enzymes and treated with alkaline
phosphatase. Vector and the fragment were isolated from
agarose gel bands using the JETQUICK gel extraction spin
kit (Genomed). Ligation of the fragment in frame with a
multifunctional tag (including a hexa-His) in the vector was
carried out according to standard procedures using T4 DNA
ligase (Boehringer). The plasmid obtained, pET32FPPS,
was transformed into E. coli NovaBlue (Novagen). Colonies
were analysed by PCR using primers P1 and P2 to confirm
the presence of the FPPS gene. Cells were grown in Luria–
Bertani medium containing 50 lgÆmL
)1
ampicillin and the
plasmid was purified using the JETQUICK plasmid puri-
fication spin kit (Genomed) and used as template for PCR
amplification as described below.
PCR amplification of FPPS and
e
AS
For fusions of FPPS and eAS a number of DNA fragments
were prepared by PCR amplification using the same
conditions as above. Two sets of primers (P6/P2 and P1/
P5) were used for amplification of FPPS using the
pET32FPPS as template (Table 1). In a similar manner
three sets of primers (P3/P4, P3/P7 and P8/P4) were used to
amplify the eAS gene using the TEAS cDNA as template

(Table 1).
Construction of expression vectors for production
of single and fused enzymes
Wild type eAS was digested and cloned into pET32c as
described for FPPS above. The resulting plasmid
pET32eAS was transformed into E. coli NovaBlue.
Ligation of FPPS and eAS was achieved by sequential
cloning into the bacterial expression vector pET32c. Two
fused enzymes, i.e. FPPS/eAS and eAS/FPPS, were con-
structed. First, fragments FPPS-nsc and eAS-nsc were
digested with NcoIandBamHI and separately cloned into
pET32c as described above yielding the plasmids
pET32FPPS-nsc and pET32eAS-nsc. These two plasmids
were transformed into E. coli NovaBlue for production of
the plasmids. The plasmids were purified using the
JETQUICK plasmid purification spin kit.
Subsequently the fragments FPPS-L and eAS-L were
digested with BamHI and XhoI and cloned into the plasmid
pET32eAS-nsc and pET32FPPS-nsc, respectively, as des-
cribed above yielding plasmids pET32FPPS/eAS and
pET32eAS/FPPS. These two plasmids were transformed
into E. coli NovaBlue.
DNA sequencing
DNA sequencing of cloned PCR fragments was performed
using a DNA BigDye
TM
Terminator Cycle Sequencing Kit
(Perkin Elmer) for the labelling of the sequencing reactions.
Analyses were then carried out on an ABI PRISM
TM

310
Genetic Analyzer. Oligonucleotides (15-mers) were synthes-
ized according to sequence information and were used as
primers for sequencing.
Expression of the recombinant proteins
and preparation of bacterial extracts
NovaBlue cells carrying the plasmids pET32FPPS,
pET32eAS, pET32FPPS/eAS and pET32eAS/FPPS were
grown overnight in Luria–Bertani medium containing
ampicillin (50 lgÆmL
)1
)at37°C. The plasmids were
purified using the JETQUICK plasmid purification spin
kit and transferred into E. coli strain BL21(DE3) pLysS.
The BL21 cells were grown at 37 °Cin20mLLuria–
Bertani medium containing ampicillin (50 lgÆmL
)1
)toan
D
660
of  0.6. IPTG was then added to the final concen-
tration of 1 m
M
. The cells were harvested after 4 h of
cultivation at 30 °C by centrifugation at 200 g for 10 min at
room temperature and the pellet was resuspended in 2 mL
extraction buffer (50 m
M
Tris/HCl pH 8.0, containing
15 m

M
MgCl
2
and 20% glycerol). The cells were disrupted
by sonication (Braun-Sonic 2000 microprobe at maximum
power for 3 · 20 s bursts with 0.5 min chilling period on ice
between bursts). The extract was centrifuged at 10 000 g for
15 min at 4 °C. The supernatant was collected and
analysed.
Optimization of expression
Optimization of expression was carried out for the
pET32eAS/FPPS construct. The parameters investigated
were IPTG concentration (0, 0.2, 0.4, 0.6, 0.8 and 1.0 m
M
)
used for induction, induction temperature (12, 22 and
30 °C) and time of harvest after induction (90, 135, 210, 295
and 330 min). BL21 cells carrying the pET32eAS/FPPS
plasmid were grown at 37 °C in 20 mL Luria–Bertani
medium containing ampicillin (50 lgÆmL
)1
)toanD
660
of
 0.6. Induction under various conditions was subsequently
carried out. The cells were harvested by centrifugation at
200 g for 10 min at room temperature and the pellet was
resuspended in 2 mL extraction buffer. The cells were
disrupted by sonication. The extract was centrifuged at
Table 1. Primers used in cloning. Restriction sites are underlined.

Primer Sequence Template
P1 5¢-TAGAT
CCATGGGTAGTACCGATCTG-3¢ FPPS N-terminal
P2 5¢-CTA
CTCGAGCTACTTTTGCCTCTTGTA-3 FPPS C-terminal
P3 5¢-TAGAG
CCATGGCCTCAGCAGCAGTT¢-3¢ eAS N-terminal
P4 5¢-CTACTCGAGTCAAATTTTGATGGAGTC-3¢ eAS C-terminal
P5 5¢-TA
GGATCCCTTTTGCCTCTTGTAAAT-3¢ FPPS C-terminal
P6 5¢-AT
GGATCCGGAATGAGTAGTACCGATCTG-3¢ FPPS N-terminal
P7 5¢-TA
GGATCCAATTTTGATGGAGTCCAC-3 eAS C-terminal
P8 5¢-AT
GGATCCGGAATGGCCTCAGCAGCAGTT-3¢ eAS N-terminal
3572 M. Brodelius et al. (Eur. J. Biochem. 269) Ó FEBS 2002
10 000 g for 15 min at 4 °C. The supernatant was collected
and enzyme activities determined.
Production and purification of recombinant proteins
BL21 cells were grown and induced (0.4 m
M
IPTG) as
described above in 600 mL Luria–Bertani medium contain-
ing ampicillin. Proteins were extracted with 40 mL buffer.
Purification of recombinant proteins was carried out in a
single step using immobilized metal affinity chromato-
graphy (IMAC). The supernatant was applied to a 5-mL
HiTrap Chelating HP column (Amersham Pharmacia
Biotech) loaded with Co

2+
. Nonbound proteins were
removed by washing with buffer. Elution of adsorbed
recombinant proteins was achieved with extraction buffer
containing 500 m
M
imidazole. Fractions of 0.5 mL were
collected and fractions showing enzyme activity were pooled
and frozen in liquid nitrogen in aliquots (0.5 mL) and stored
at )80 °C until used.
Electrophoresis and Western blotting
SDS/PAGE electrophoresis was carried out on 4–20% Tris/
glycine gels or on NuPAGE 4–12% Bis/Tris gels from
Invitrogen according to instructions supplied by the manu-
facturer. After electrophoresis, the gels were either stained
with Coomassie blue or the proteins transferred to nitro-
cellulose membranes. Blotted proteins were detected with
the Stag Alkaline Phosphatase Western blot kit (Novagen)
according to the instructions supplied by the manufacturer.
Enzyme assays
FPPS. An aliquot of bacterial extract (10–46 lL) or
purified enzyme (2–10 lL)wasassayedin50m
M
Tris/
HCl pH 8.0, containing 15 m
M
MgCl
2
,10m
M

2-mercap-
toethanol, 20% glycerol, 55 l
M
GPP and 50 l
M
[1-
14
C]IPP
(1.8 lCiÆmmol
)1
) in a total volume of 50 lL. The
samples were incubated for 10 min at 30 °C and subse-
quently an aliquot of 6
M
HCl (5 lL)wasaddedtostopthe
reaction and incubation was continued for 30 min to
hydrolyse FPP formed to extractable farnesol (the substrate
IPP is stable under these conditions). Neutralization was
performed with 6
M
NaOH (7.5 lL). The mixture was first
extracted with hexane (400 lL) and subsequently the
hexane phase (350 lL) was removed and extracted with
water (300 lL). An aliquot (200 lL) of the hexane phase
was taken into a scintillation vial and measured in a
scintillation counter.
eAS. An aliquot of bacterial extract (10–48 lL) or purified
enzyme (2–10 lL) was assayed in 50 m
M
Tris/HCl pH 8.0,

containing 15 m
M
MgCl
2
,10m
M
2-mercaptoethanol, 20%
glycerol and 20 l
M
[1-
3
H]FPP (0.1 CiÆmmol
)1
)inatotal
volume of 50 lL. After a 10-min incubation at 30 °C, the
reactions were stopped by addition of an equal volume of
0.2
M
KOH containing 0.1
M
EDTA. Subsequently, the
reaction mixture was extracted with hexane (2 · 0.4 mL)
and the hexane extracts were passed over a small column
filled with 200–250 mg silica (Merck; size: 0.2–0.5 lm) and
the column was rinsed with additional hexane (1.0 mL). The
hexane extract was examined for radioactivity by scintilla-
tion counting.
Coupled enzyme assay. The coupled enzyme reaction was
analysed for the bifunctional enzymes. An aliquot of
bacterial extract (10–46 lL) or purified enzyme (2–10 lL)

wasassayedin50m
M
Tris/HCl pH 8.0, containing 15 m
M
MgCl
2
,10m
M
2-mercaptoethanol, 20% glycerol, 55 l
M
GPP and 50 l
M
[1-
14
C]IPP (1.8 lCiÆmmol
)1
) in a total
volume of 50 lL. The samples were incubated for 10 min at
30 °C. Two sets of samples were made. In one set, the
reaction was stopped with 0.2
M
KOH and the final product
was analysed according to the eAS assay description. To the
other set, HCl was added and the evaluation of the
FPPS activity was performed as described for the FPPS
assay.
Protein concentrations
Protein concentrations of extracts and partly purified
recombinant enzymes were determined according to
Bradford [20] using BSA as standard.

RESULTS AND DISCUSSION
Expression of recombinant enzymes
For production of single and fused enzymes the bacterial
expression vector pET32c was used. This expression vector
was selected because the target protein is expressed as a
fusion with a tag containing the thioredoxin for increased
protein solubility [21], a histidine tag sequence facilitating
protein purification and a Stag sequence for sensitive
protein quantification and detection. The sequence also
contains an enterokinase cleavage sites for removal of the
fusion tag.
The four plasmids pET32FPPS, pET32eAS,
pET32eAS/FPPS and pET32FPPS/eAS were isolated
and transferred into the E. coli BL21(DE3)pLysS for
production of the recombinant enzymes. The transformed
bacteria were grown and induced with IPTG (1 m
M
), and
cell-free extracts were prepared and evaluated for FPPS
and/or eAS activity. All extracts exhibited the expected
activities. Recombinant proteins of the predicted molecu-
larmassweredetectedinWesternblotsusingStag
alkaline phosphatase staining. The recombinant bifunc-
tional enzymes show both activities and obviously the
linker (Gly-Ser-Gly) is sufficiently long to permit the two
enzymes to fold properly. The three-dimensional structure
of eAS has been reported [22] but so far no structure for a
plant FPPS has been published. However, the three-
dimensional structure of chicken FPPS, which shows high
amino acid identity (46.6%) and similarity (67.2%) to the

Artemisia enzyme, has been reported [23]. Assuming a
conserved structure between the two FPPSs, these two
structures may be used to model the fusion enzyme. It is
evident from such models that the linker used is
sufficiently long to permit proper folding of the fused
enzymes. Linkers of different length have been used in
constructs of bifunctional enzymes [6,24,25]. However,
long linkers may be exposed and sensitive to proteolytic
attack and a too long distance between the two active sites
may lead to reduced or no channelling of substrate as has
been reported for the bifunctional b-galactosidase/galacto-
kinase [6]. The Gly-Ser-Gly linker is relatively short and
is convenient to use as the corresponding nucleotide
Ó FEBS 2002 Fusions of FPPS and epi-aristolochene synthase (Eur. J. Biochem. 269) 3573
sequence contains a BamHI site, which may be used for the
fusion of two genes. The Gly-Ser-Gly linker was used in a
functional fusion of citrate synthase and malate dehydrog-
enase [9].
Optimization of expression was carried out for one of
the constructs, i.e. pET32 eAS/FPPS. The amount of eAS
activity was determined as a function of incubation time
after addition of IPTG, concentration of IPTG and
induction temperature. The FPPS activity showed the
same pattern. Based on these results the following
conditions were selected for large-scale induction of all
four recombinant proteins: incubation time, 4 h; IPTG
concentration, 0.4 m
M
; induction temperature, 30 °C.
These conditions are consistent with the conditions used

for the production of a number of other recombinant
proteins in our laboratory.
It is interesting to note that the highest activity of the
relatively large recombinant protein (119.9 kDa) is
observed at 30 °C. We assume this to be due to the fact
that the fused enzyme is expressed as a fusion with the
thioredoxin protein, which is improving the solubility of the
expressed protein [21]. In fact, no recombinant protein
could be detected in the insoluble fraction by SDS/PAGE.
For expression in E. coli of eAS without any tag a
significant part of the recombinant protein was found in
inclusion bodies [26]. However, a twofold increase in
recombinant eAS activity was obtained when the induction
temperature was lowered from 37 to 27 °C. Similarly, an
increased amount of recombinant epi-cedrol synthase was
obtained by lowering the induction temperature to 20 °C
[18]. The high activity of the bifunctional enzyme in extracts
from cells grown at 30 °C is reflected in a higher total
protein content. The specific activity in extracts obtained at
30 °C is lower than for extracts prepared from cells induced
at lower temperatures. However, for large-scale production
of the recombinant proteins an induction temperature of
30 °C was used.
Production and purification of recombinant proteins
The four recombinant proteins were produced on a large
scale (2 · 600 mL cultures) using the conditions established
above. The proteins carrying a (His)
6
-tag were purified in a
one-step procedure by chromatography on IMAC-columns.

This convenient procedure is widely used to purify recom-
binant proteins [27]. Columns charged with three different
ions, i.e. Ni
2+
,Zn
2+
and Co
2+
, were tested. Some
unspecific binding of E. coli proteins appeared to occur on
all three ions, which may be due to the presence of metal
binding sites in some proteins. In fact, on SDS/PAGE the
same contaminating proteins appeared to be present in all
four purified proteins. The least unspecific binding was
observed for columns charged with Co
2+
, which were used
for the large-scale purifications. Analysis by SDS/PAGE of
proteinpurifiedonaCo
2+
column showed that they were at
least 95% pure (Fig. 2). No attempts were made to remove
the impurities by other purification steps.
During prolonged incubations with enterokinase at 30 °C
for removal of the affinity tag, a significant loss of enzyme
activity was observed for the recombinant proteins. There-
fore, the characterization of the recombinant proteins was
carried out on enzymes containing the thioredoxin-Stag-
His-tag as an N-terminal fusion.
Kinetic properties of recombinant enzymes

The IMAC-purified enzymes were used to determine K
m
values according to standard techniques. The K
m
for IPP
was determined to be 3.3 for recombinant Artemisia FPPS.
No significant difference in K
m
values was observed for the
fused and single enzymes. The K
m
values for IPP was
calculated to be 3.8 and 4.0 l
M
for the two fusion enzymes
eAS/FPPS and FPPS/eAS, respectively. These K
m
values
are similar to those reported for FPPS from other sources
[28–31].
The K
m
value for FPP with the recombinant tobacco eAS
was estimated to be 1.7 l
M
, which is the same as the 2–5 l
M
reported for the purified wild-type tobacco eAS [32]. The K
m
values for FPP were calculated to be 1.6 and 2.6 l

M
for the
two fusion enzymes eAS/FPPS and FPPS/eAS, respectively.
The K
m
values for FPP of other wild-type and recombinant
plant sesquiterpene synthases have been reported to be in
the range 0.5–7 l
M
[18,33–37].
In conclusion, essentially the same K
m
values were
obtained for the single FPPS and eAS as for the two fusion
enzymes FPPS/eAS and eAS/FPPS and these K
m
were
similar to those reported previously for FPPS and
sesquiterpene synthases from other sources. Apparently,
the fusion of the two enzymes does not affect the affinity for
the substrates. Folding of recombinant single and bifunc-
tional enzymes is appropriate. Furthermore, these results
indicate that an N terminal tag does not affect the catalytic
properties of the recombinant enzymes.
Coupled activity
The fused enzymes FPPS/eAS and eAS/FPPS convert IPP
to epi-aristolochene via FPP (Fig. 1). With increasing
recombinant enzyme amount an increased formation of
epi-aristolochene from IPP is obtained (Fig. 3). It is evident
from Fig. 3 that the amount of enzyme used in an assay

must be carefully adjusted for linearity of the assay and that
the incubation time should not be too long under the
conditions used.
Fig. 2. SDS/PAGE of recombinant enzymes produced in E. coli. Lane 1,
molecular mass standards; lane 2, crude extract FPPS/eAS (14.0 lg
protein); lane 3, purified FPPS/eAS (5.1 lg);lane4,crudeextracteAS/
FPPS (11.2 lg); lane 5, purified eAS/FPPS (4.4 lg); lane 6, crude
extract FPPS (13.4 lg);lane7,purifiedFPPS(3.3lg); lane 8, crude
extract eAS (13.0 lg); lane 9, purified eAS (4.2 lg). The calculated
molecular weights of FPPS, eAS and the fusion enzymes are 57, 80 and
120 kDa, respectively.
3574 M. Brodelius et al. (Eur. J. Biochem. 269) Ó FEBS 2002
It is interesting to note that the relative amount of epi-
aristolochene formed by the bifunctional enzymes increases
at higher enzyme activities, i.e. a larger portion of the FPP
produced by the FPPS part of the enzyme is converted to
final product by eAS (Fig. 4). This may be expected as the
building-up of the intermediate FPP is more rapid at higher
amounts of FPPS and the subsequent eAS experiences a
higher substrate concentration, i.e. a steady-state condition
is approached. No difference can be observed between the
two bifunctional enzymes. Obviously, the order in which the
two enzymes are fused does not influence the activity of the
enzymes. This is also reflected in the K
m
values determined
for the two bifunctional enzymes.
Finally, to further evaluate the performance of the
bifunctional enzymes, the level of epi-aristolochene pro-
duced from IPP by the eAS/FPPS was compared with that

produced by the corresponding amounts of the two single
enzymes. As shown in Fig. 5 the amount of FPP produced
is essentially the same for the two systems. However, the
amount of epi-aristolochene produced is considerably
higher for the fusion enzyme than for the mixture of single
enzymes. Apparently, a proximity effect or substrate
channelling operates in the fusion enzyme and increases
the overall catalytic activity of the reaction. The FPP
produced by the first enzyme is transferred to the active site
of eAS with limited diffusion into the surrounding solution.
Similar substrate channelling has been observed for a
number of artificial bifunctional enzymes [7–11].
CONCLUDING REMARKS
The fused enzymes described above are fully active when
expressed in E. coli. Next these gene constructs will be
transferred to a plant transformation vector. Transgenic
tobacco plants producing the bifunctional enzymes will be
established and the effects on sesquiterpene and sterol
biosynthesis investigated. We are involved in studies on the
Fig. 3. Time course for formation of FPP and epi -aristolochene from
IPP and GPP as function of the amount of purified recombinant
bifunctional enzymes. (A) FPPS/eAS. (B) eAS/FPPS. Open symbols,
FPP; solid symbols, epi-aristolochene. s, d,2lL purified enzyme; n,
m,4lL purified enzyme; h, j,6lL purified enzyme. Each point is
the mean of two determinations. The protein concentrations of the
purified enzyme preparations were 1.9 and 3.0 mg proteinÆmL
)1
for
FPPS/eAS and eAS/FPPS, respectively.
Fig. 4. Amount of epi-aristolochene formed as function of FPP produced

by the purified bifunctional enzymes FPPS/eAS and eAS/FPPS using
IPP and GPP as substrates. Each point corresponds to a separate
enzymatic assay containing either different amount of enzyme or being
incubation for different times. d, FPPS/eAS; j, eAS/FPPS.
Fig. 5. Time course for formation of FPP and epi-aristolochene from
IPP and GPP by the two purified recombinant single enzymes (open
symbols) or the purified recombinant bifunctional eAS/FPPS (solid
symbols) as a function of incubation time. The activities of the single
enzymes in the assay were carefully adjusted to the corresponding
activities of the bifunctional enzyme. h, j, FPP; s, d, epi-aristo-
lochene. Each point is the mean of two determinations.
Ó FEBS 2002 Fusions of FPPS and epi-aristolochene synthase (Eur. J. Biochem. 269) 3575
biosynthesis of the antimalarial sesquiterpene artemisinin in
A. annua. The sesquiterpene cyclase, amorpha-4,11-diene
synthase (ADS), converting FPP to the first intermediate of
artemisinin biosynthesis was recently cloned in our labor-
atory [33]. We will make fusions of FPPS and ADS and
introduce the bifunctional enzyme into plants of A. annua.
We expect to obtain an increased biosynthesis of artemisinin
in transgenic plants of A. annua expressing the FPPS/ADS
fusion.
ACKNOWLEDGEMENTS
The financial support to P.E.B. from the Swedish Research Council for
Engineering Sciences and the Swedish Council for Forestry and
Agricultural Research. During a part of this work M.B. received a
Marie Curie Scholarship from the European Union. We thank
professor J. Chappell for the kind gift of the TEAS cDNA clone.
REFERENCES
1. Meek, T.D., Garvey, E.P. & Santi, D.V. (1985) Purification and
characterization of the bifunctional thymidylate synthetas-dihy-

drofolate reductase from methotrexate-resistent Leishmania tro-
pica. Biochemistry 24, 678–686.
2. Hyde, C.C., Ahmed, S.A., Padlan, E.A., Miles, E.W. & Davies,
D.R. (1988) Three-dimensional structure of the tryptophan syn-
thase alpha 2 beta 2 multienzyme complex from Salmonella
typhimurium. J. Biol. Chem. 263, 17857–17871.
3. Knighton, D.R., Kan, C C., Howland, E., Janson, C.A.,
Hostomska, Z., Welsh, K.M. & Matthews, D.A. (1994) Structure
of and kinetic channelling in bifunctional dihydrofolate reductase-
thymidylate synthase. Nat. Struct. Biol. 1, 186–194.
4. Peters, R.J., Ravn, M.M., Coates, R.M. & Croteau, R.B. (2001)
Bifunctional abietadiene synthase: Free diffusive transfer of the
(+)-copalyl diphosphate intermediate between two distinct active
sites. J. Am. Chem. Soc. 123, 8974–8978.
5. Bu
¨
low, L. & Mosbach, K. (1991) Multienzyme systems obtained
by gene fusion. Trends Biotechnol. 9, 226–231.
6. Carlsson, H., Ljungcrantz, P., Bu
¨
low, L. & Mosbach, K. (1992)
Engineering of lactose metabolism in E. coli by introducing
b-galactosidase/galactokinase fusion enzymes. Biotechnol. Lett.
14, 439–444.
7. Kim, G J., Lee, D E. & Kim, H S. (2000) Construction and
evaluation of a novel bifunctional N-carbamylase-
D
-hydantoinase
fusion enzyme. Appl. Environ. Microbiol. 66, 2133–2138.
8. Bu

¨
low, L. (1987) Characterization of an artificial bifunctional
enzyme, b-galactosidase/galactokinase, prepared by gene fusion.
Eur. J. Biochem. 163, 443–448.
9. Lindbladh, C., Rault, M., Hagglund, C., Small, W.C., Mosbach,
K., Bu
¨
low, L., Evans, C. & Srere, P.A. (1994) Preparation and
kinetic characterization of a fusion protein of yeast mitochondrial
citrate synthase and malate dehydrogenase. Biochemistry 33,
11692–11698.
10. Li, N., Jiang, X.N., Cai, G.P. & Yang, S.F. (1996) A novel
bifunctional fusion enzyme catalyzing ethylene synthesis via
1-aminocyclopropane-1-carboxylic acid. J. Biol. Chem. 271,
25738–25741.
11. Seo, H.S., Koo, Y.J., Lim, J.Y., Song, J.T., Kim, C.H., Kim, J.K.,
Lee, J.S. & Choi, Y.D. (2000) Characterization of a bifunctional
enzyme fusion of trehalose-6-phosphate synthase and trehalose-
6-phosphate phosphatase of Escherichis coli. Appl. Environ.
Microbiol. 66, 2484–2490.
12. Pettersson, H., Olsson, P., Bulow, L. & Pettersson, G. (2000)
Kinetics of the coupled reaction catalysed by a fusion protein of
yeast mitochondrial malate dehydrogenase and citrate synthase.
Eur. J. Biochem. 267, 5041–5046.
13. Pettersson, H. & Pettersson, G. (2001) Kinetics of the coupled
reaction catalysed by a fusion protein of b-galactosidase and
galactose dehydrogenase. Biochim. Biophys. Acta 1549, 155–160.
14. Meijer, P L., Lilius, G., Holmberg, N. & Bu
¨
low, L. (1996) An

artificial bifunctional enzyme, c-glutamyl kinase/c-glutamyl
phosphate reductase, improves NaCl tolerance when expressed in
E. coli. Biotechnol. Lett. 18, 1133–1138.
15. Beaujean, A., Ducrocq-Assaf, C., Sangwan, R.S., Lilius, G.,
Bu
¨
low, L. & Sangwan-Norreel, B.S. (2000) Engineering direct
fructose production in processed potato tubers by expressing
a bifunctional alpha-amylase/glucose isomerase gene complex.
Biotechnol. Bioeng. 70, 9–16.
16. Vo
¨
geli, U. & Chappell, J. (1988) Induction of sesquiterpene cyclase
and suppression of squalene synthetase activities in plant cell
cultures treated with fungal elicitor. Plant Physiol. 88, 1291–1296.
17. Threlfall, D.R. & Whitehead, I.M. (1988) Coordinated inhibition
of squalene synthetase and induction of enzymes of sesquiterpe-
noid phytoalexin biosynthesis in cultures of Nicotiana tabacum.
Phytochemistry 27, 2567–2580.
18.Mercke,P.,Crock,J.,Croteau,R.&Brodelius,P.E.(1999)
Cloning, expression and characterization of epi-cedrol synthase, a
sesquiterpene cyclase from Artemisia annua L. Arch. Biochem.
Biophys. 369, 213–222.
19. Matsushita, Y., Kang, W. & Charlwood, B.V. (1996) Cloning and
analysis of a cDNA encoding farnesyl diphosphate synthase from
Artemisia annua. Gene 172, 207–209.
20. Bradford, M.M. (1976) A rapid and sensitive method for the
quantitation of microgram quantities of protein utilizing the
principle of protein dye binding. Anal. Biochem. 72, 248–254.
21. LaVallie, E.R., DiBlasio, E.A., Kovacic, S., Grant, K.L., Schen-

del, P.F. & McCoy, J.M. (1993) A thioredoxin gene fusion
expression system that circumvents inclusion body formation in
the E. coli cytoplasm. Bio/Technology 11, 187–193.
22. Starks, C.M., Back, K., Chappell, J. & Noel, J.P. (1997) Structural
basis for cyclic terpene biosynthesis by tobacco 5-epi-aristolochene
synthase. Science 277, 1815–1820.
23. Tarshis,L.C.,Yan,M.,Poulter,C.D.&Sacchettini,J.C.(1994)
Crystal structure of recombinant farnesyl diphosphate synthase at
2.6-A resolution. Biochemistry 33, 10871–10877.
24. Rock, F., Everett, M. & Klein, M. (1992) Overexpression and
structure-function analysis of a bioengineered IL-2/IL-6 chimeric
lymphokine. Protein Eng. 5, 583–591.
25. Carlsson, H., Ljung, S. & Bu
¨
low, L. (1996) Physical and kinetic
effects on induction of various linker regions in beta-galactosidase/
galactose dehydrogenase fusion enzymes. Biochim. Biophys. Acta.
1293, 154–160.
26. Back, K., Yin, S. & Chappell, J. (1994) Expression of a plant
sesquiterpene cyclase gene in Escherichia coli. Arch. Biochem.
Biophys. 315, 527–532.
27. Nilsson, J., Sta
˚
hl, S., Lundeberg, J., Uhle
´
n, M. & Nygren, P A
˚
.
(1997) Affinity fusion strategies for detection, purification, and
immobilization of recombinant proteins. ProteinExpressionPurif.

11, 1–16.
28. Eberhardt, N.L. & Rilling, H.C. (1975) Prenyltransferase from
Saccharomyces cerevisiae. Purification to homogeneity and mole-
cular properties. J. Biol. Chem. 250, 863–866.
29. Reed, B.C. & Rilling, H.C. (1976) Substrate Binding of avian liver
prenyltransferase. Biochemistry 15, 3739–3745.
30. Barnard, G.F. & Popjak, G. (1981) Human liver prenyltransferase
and its characterization. Biochim. Biophys. Acta 661, 87–99.
31. Ohnuma, S., Hirooka, K., Ohto, C. & Nishino, T. (1997) Con-
version from archaeal geranylgeranyl diphosphate synthase to
farnesyl diphosphate synthase. J. Biol. Chem. 272, 5192–5198.
32. Vo
¨
geli, U., Freeman, J.W. & Chappell, J. (1990) Purification and
characterization of an inducible sesquiterpene cyclase from
elicitor-treated tobacco cell suspension cultures. Plant Physiol. 93,
182–187.
3576 M. Brodelius et al. (Eur. J. Biochem. 269) Ó FEBS 2002
33. Mercke, P., Bengtsson, M., Bouwmeester, H.J., Posthumus, M.A.
& Brodelius, P.E. (2000) Cloning, expression and characterization
of amorpha-4,11-diene synthase, a key enzyme of artemisinin
biosynthesis in Artemisia annua L. Arch. Biochem. Biophys. 381,
173–180.
34. Zook, M.N., Chappell, J. & Kuc, J.A. (1992) Characterization of
elicitor-induction of sesquiterpene cyclase activity in potato tuber
tissue. Phytochemsitry 31, 3441–3445.
35. Crock,J.,Wildung,M.&Croteau,R.(1997)Isolationandbac-
terial expression of a sesquiterpene synthase cDNA clone from
peppermint (Mentha x piperita L.) that produce the aphid alarm
pheromone (E)-b-farnesene. Proc. Natl Acad. Sci. USA 94,

12833–12838.
36. Steele,C.L.,Crock,J.,Bohlmann,J.&Croteau,R.(1998)Ses-
quiterpene synthases from grand fir (Abies grandis). J. Biol. Chem.
273, 2078–2089.
37. Schmidt, C.O., Bouwmeester, H.J., Bu
¨
low, N. & Ko
¨
nig, W.A.
(1999) Isolation, characterization and mechanistic studies of
(–)-a-gurjunene synthase from Solidago canadensis. Arch. Bio-
chem. Biophys. 364, 167–177.
Ó FEBS 2002 Fusions of FPPS and epi-aristolochene synthase (Eur. J. Biochem. 269) 3577