Báo cáo khoa học: Ets-1/ Elk-1 is a critical mediator of dipeptidyl-peptidase III transcription in human glioblastoma cells pdf

Ets-1/ Elk-1 is a critical mediator of dipeptidyl-peptidase III
transcription in human glioblastoma cells
Abhay A. Shukla, Misti Jain and Shyam S. Chauhan
Department of Biochemistry, All India Institute of Medical Sciences, New Delhi, India

Keywords
5¢-RACE; electrophoretic mobility shift
assays; promoter; site-directed
mutagenesis; transcription factors
Correspondence
S. S. Chauhan, Room No. -3009,
Department of Biochemistry, All India
Institute of Medical Sciences, New Delhi
110029, India
Fax: +91 11 2658 8663
Tel: +91 11 2659 3272
E-mail:
Database
The nucleotide sequence of the human
DPP-III promoter has been submitted to the
GenBank database under the accession
number FJ793449
(Received 9 November 2009, revised 25
December 2009, accepted 1 February 2010)
doi:10.1111/j.1742-4658.2010.07603.x

Dipetidyl-petidase III is a metallopeptidase involved in a number of physiological processes and its expression has been reported to increase with the
histological aggressiveness of human ovarian primary carcinomas. Because
no information regarding the regulation of its expression was available,
experiments were designed to clone, define and characterize the promoter
region of the human dipeptidyl-peptidase III (DPP-III) gene. In this study,

we cloned a 1038 bp 5¢-flanking DNA fragment of the human DPP-III
gene for the first time and demonstrated strong promoter activity in this
region. Deletion analysis revealed that as few as 45 nucleotides proximal to
the transcription start site retained  40% of the activity of the full-length
promoter. This promoter lacked the TATA box but contained multiple GC
boxes and a single CAAT box. Similarly, two Ets-1 ⁄ Elk-1-binding motifs
are present in the first 25 nucleotides from the transcription start site. Binding of Ets-1 ⁄ Elk-1 proteins to these motifs was visualized by electrophoretic mobility shift and chromatin immunoprecipitation assays. Mutations
of these binding sites abolished not only binding of the Ets protein, but
also the intrinsic promoter activity. Increased DNA-binding activity of
Ets-1 ⁄ Elk-1 by v-Ha-ras also augmented the mRNA level and promoter
activity of this gene. Similarly, co-transfection of DPP-III promoter–reporter constructs with Ets-1 expression vector led to a significant increase in
promoter activity. From these results, we conclude that Ets-1 ⁄ Elk-1 plays a
critical role in transcription of the human DPP-III gene.

Introduction
Dipeptidyl-peptidase III (DPP-III), a cytosolic aminopeptidase has been purified and characterized from different tissues of various animal species such as rat and
human skin [1,2], bovine and human cataractous lens
[3], rabbit and human erythrocytes [4], rat brain [5]
and pancreas [6], monkey brain [7], human placenta
[8], neutrophils [9], Saccharomyces cerevisiae [10] and
Drosophila melanogaster [11]. All mammalian DPP-IIIs
require zinc ions for their maximum activity and have
therefore been termed metalloaminopeptidases. The
crystal structure of yeast DPP-III has been described

by Baral et al. [12], providing an insight into its catalytic mechanism and mode of substrate binding. No
endogenous substrate for this enzyme has yet been
identified. However, it has broad specificity for a number of polypeptides, suggesting its involvement in the
terminal stage of intracellular protein catabolism.
Interestingly, DPP-III activity has been reported to

increase in retroplacental serum [8] suggesting that it is
synthesized in placental cells and released into the
maternal circulation. In view of its high affinity for
angiotensin II and III [13], the potential role of this

Abbreviations
ChIP, chromatin immunoprecipitation; CLR, Chang liver Ras cells; CLDR, Chang liver DRas cells; DPP-III, dipeptidyl-peptidase III; EMSA,
electrophoretic mobility shift assay; ERK, extracellular regulated kinase; Inr, initiator element; MEK, mitogen-activated protein kinase kinase.

FEBS Journal 277 (2010) 1861–1875 ª 2010 The Authors Journal compilation ª 2010 FEBS

1861


Ets-1 ⁄ Elk-1 key regulators of DPP-III transcription

A. A. Shukla et al.

peptidase in elevating the level of plasma angiotensin
hydrolysing activity during pregnancy has been
described. Similarly, it exhibits high affinity for Leuenkephalins [5]. These features suggest a potential role
for DPP-III in the regulation of blood pressure [10]
and in pain modulation [14]. Human DPP-III has been
shown to increase with the histological aggressiveness
of human ovarian primary carcinomas [15]. Because
levels of DPP-III alter in several physiological and
pathological conditions it must necessarily be amenable to regulated expression. However, no systematic
study has been carried out to elucidate the regulatory
molecular mechanisms associated with its expression.
Therefore, this study was designed to clone and characterize the human DPP-III promoter in order to elucidate the transcriptional regulation of the gene. In this

regard, we identified the region that plays an impor-

tant role in determining the basal promoter activity of
the gene. Furthermore, with the help of binding assays
and site-directed mutagenesis, we established that
Ets-1 ⁄ Elk-1 play a key role in the regulation of DPP-III
transcription in human glioblastoma cells.

Results
PCR amplification, sequence analysis and
demonstration of promoter activity in the
5¢ upstream region of the human DPP-III gene
Using primer designs based upon the DPP-III gene
located on chromosome 11q 12 fi q13.1 of the human
genome sequence (accession number NT_033903.7), we
were able to amplify a single 1038 bp DNA fragment
by PCR (data not shown). This fragment was cloned

Fig. 1. Nucleotide sequence of the 5¢-flanking region of the human DPP-III gene. The
transcriptional initiation site determined by
5¢-RACE in U87MG cells is denoted as +1.
Different primers were used for amplification of the 1038 bp full-length promoter and
its deletion fragments, 5¢-RACE and ChIP
assays are shown by arrows. The most 5¢end base of the full-length promoter and the
different deletion constructs are shown in
bold and indicated by arrows ( fi ) with
respect to the transcription initiation site
(; +1). The translation initiation codon ATG is
underlined. Potential cis-element regulatory
motifs are in italics and marked by dashed

arrows. Two AT-rich sequences present at
positions )24 and )29 are written in bold.
The intronic sequences are written in lower
case. Primers used for the amplification
of DPP-III promoter sequence are also
underlined.

1862

FEBS Journal 277 (2010) 1861–1875 ª 2010 The Authors Journal compilation ª 2010 FEBS


Ets-1 ⁄ Elk-1 key regulators of DPP-III transcription

A. A. Shukla et al.

As a first step towards characterization of the human
DPP-III promoter, the transcriptional start site in
U87MG cells was mapped using 5¢-RACE. Resolution
of RACE products on agarose gel revealed the amplification of a single  200 bp fragment (Fig. 3). This
fragment was cloned into a TA cloning vector and six
representative clones were subjected to double-stranded
DNA sequencing. All clones exhibited 100% homology
to DPP-III mRNA and contained the same nucleotide
(G) corresponding to the 33rd nucleotide upstream of
the translation initiation codon in the reported mRNA
sequence (accession number NM_005700). These
results suggested that this nucleotide is the transcription initiation site (marked +1 in Fig. 1).

A

Oligo dT-anchor primer

(T)nTTTV
(A)nAAA

AAS2

PCR anchor
Primer

t
oduc
E pr
RAC

PCR
cont negativ
e
rol

x796.23

AAS1

00

Luciferase activity
fold increase over pGl3-basic

Mapping of the transcriptional start site

B

1000
900
800

These results established that the cloned fragment is a
functional DPP-III promoter.

DL1

into a TA cloning vector and sequenced. Analysis of
its nucleotide sequence showed 100% homology to the
upstream region and part of the reported 5¢-end of
DPP-III mRNA. These results indicated that the
amplified region is physically linked to exon 1 of the
DPP-III gene. Nucleotide sequence analysis of
the cloned 1038 bp human DPP-III promoter revealed
that it contained 63.19% G + C nucleotides, no
detectable TATA box, a single CAAT box and several
GC boxes (Sp1-binding sites). Multiple putative transcription factor binding sites were identified in this
region using the motif finder program (http://motif.
genome.jp/) with high-stringency parameters for core
similarity of 0.85 and matrix similarity of 0.85. As
shown in Fig. 1, these motifs include NF-jB, USF,
C ⁄ EBP, CREB, NF-1 and multiple binding sites for
the Sp1 and Ets family of transcription factors, suggesting that the amplified region is a potential
promoter. To demonstrate promoter activity in the

amplified fragment, we cloned it upstream of the luciferase reporter gene in the pGL3-Basic vector. Transfection of the resulting construct (pAAS-1) into
U87MG, Caov-2, Chang liver, Panc1 and NIH 3T3
cells yielded  800-,  200-,  100-,  80- and
25-fold higher luciferase activity respectively, compared with the pGL3-Basic transfected cells (Fig. 2).

700
600
500
400
300
200

x212.53
x102.28

100
0

500 bp

x77.88
x23.42

U87MG

Caov-2 Chang Liver Panc1

NIH3T3

Fig. 2. Demonstration of promoter activity in the 5¢ flanking region

of the human DPP-III gene in different cell lines. The PCR-amplified
5¢ flanking region of human DPP-III gene (1038 bp) was cloned
upstream of the luciferase reporter gene in promoter-less plasmid
pGL3-Basic. The resulting construct (pAAS-1) was transfected into
U87MG (human glioblastoma grade III), Caov-2 (ovarian carcinoma),
Chang liver (human liver), Panc1 (human pancreatic carcinoma) or
NIH 3T3 (mouse fibroblast) cells. After 48 h of transfection, cells
were washed three times with ice-cold NaCl ⁄ Pi, lysed and luciferase activity was assayed in the cell lysates. Cells transfected with
pGL3-Basic were processed in an identical way and served as the
negative control. Values are the mean ± SE of at least three independent experiments performed in triplicate. Other details are
given in Materials and methods.

~200 bp

100 bp

1

2

3

Fig. 3. Mapping of the transcription initiation site of the DPP-III
gene. (A) Schematic diagram showing the location of different
primers used for 5¢-RACE on U87MG cDNA. (B) Total cellular RNA
isolated from U87MG cells was reverse transcribed using a genespecific primer (AAS-2) and used in 5¢-RACE to map the transcription initiation site. PCR performed without a template served as the
negative control. RACE products were resolved on 2% agarose gel
and stained with ethidium bromide. The prominent 200 bp fragment (indicated on the right-hand side) was excised, cloned and
subjected to double-strand DNA sequencing. DL100 corresponds to
a 100 bp DNA ladder (MBI Fermentas, Vilnius, Lithuania).

FEBS Journal 277 (2010) 1861–1875 ª 2010 The Authors Journal compilation ª 2010 FEBS

1863


Ets-1 ⁄ Elk-1 key regulators of DPP-III transcription

A. A. Shukla et al.

from the 5¢-end resulted in a significant reduction in
promoter activity. Constructs which lacked 548 bp
()485 ⁄ +5, pAAS-3), 803 bp ()230 ⁄ +5; pAAS-4),
909 bp ()123 ⁄ +5; pAAS-5), 940 bp ()93 ⁄ +5; pAAS6), 980 bp ()53 ⁄ +5; pAAS-7) and 993 bp ()40 ⁄ +5;
pAAS-8) from the 5¢-end, retained 51, 48, 39, 42, 44
and 40% promoter activity, respectively, compared
with the full-length promoter (Fig. 4A). All these constructs exhibited > 300-fold promoter activity compared with pGL3-Basic. Thus, 45 nucleotides (minimal
promoter) from the 3¢-end of the DPP-III promoter
retained 40% of the full-length promoter (pAAS-1)
activity (320-fold over pGL3-Basic). Sequence analysis
of the minimal promoter region ()40 ⁄ +5) revealed no
obvious TATA or CAAT boxes. However, two perfect

Deletion analysis of human DPP-III promoter
In order to define the minimal promoter region and
identify the functional transcription factor binding
motif(s) in this region of the DPP-III gene, a series of
promoter–reporter constructs with varying lengths for
the 5¢-region were generated. The 5¢-ends of these
constructs are marked ( ) in Fig. 1. These constructs

were transfected into human glioblastoma cells
(U87MG) followed by estimation of the luciferase
activity. The construct pAAS-2 ()781 ⁄ +5), which
lacks first 252 bases from the 5¢-end of the full-length
promoter, retained 92% of the promoter activity
( 740-fold promoter activity over pGL3-Basic vector)
(Fig. 4A). Further deletion of 548 or more bases

B

x816.25

800

x741.11

x824.23

x352.61
x312.07

x337.31

*

*

300

*

x319.48

*

200
100

x312.07

b

400
300
200
100

x4.22

0

–1033
pAAS–1

pAAS–8 –40 +5 Luc

+5 Luc
pAAS–7 –53

Luc

+5
pAAS–6 –93

Luc
+5
pAAS–5 –124

Luc
+5
pAAS–4 –230

Luc
+5
pAAS–3 –485

Luc
+5
–781
pAAS–2

–1033
pAAS–1

+5 Luc

0

600
500

Luc

*

400

–21

x390.93

pAAS–9 –124

*

Luc

x418.59

+5

500

a

800
700

pAAS–5 –124

600

900

Luc

700

+5

900

Luciferase activity
(fold increase over pGL3-basic)

Luciferase activity
(fold increase over pGL3-basic)

A

Fig. 4. Functional analysis of deletion constructs of the human DPP-III gene. (A) A series of DNA fragments were PCR amplified using fulllength promoter fragment as the template. Seven fragments with different 5¢-ends (nucleotides )781, )485, )230, )124, )93, )53 and
)40) and a common 3¢-end (nucleotide +5) were cloned upstream of the luciferase reporter gene in promoter-less plasmid pGL3-Basic to
generate constructs pAAS-2, pAAS-3, pAAS-4, pAAS-5, pAAS–6, pAAS-7 and pAAS-8, respectively. U87MG cells were transiently co-transfected with test plasmid and pRL-TK internal control plasmid. Values significantly different from pAAS-1 are marked by *. (B) A DNA fragment lacking 25 bases from the 3¢ end of pAAS-5 was amplified using DPP-III F-124 and DPP-III R-21 as the sense and antisense primers.
pAAS-1 was used as a template for the PCR. The 99 bp amplified fragment was digested with XhoI and HindIII and cloned into the pGL3Basic to generate pAAS-9 ()124 ⁄ )21). U87MG cells were transiently transfected with pAAS-9. pAAS-1 and pAAS-5 were also transfected in
separate experiments. Luciferase activity in the cell lysates was measured 48 h after transfection. Each transfection was performed in triplicate and the results are expressed as the mean ± SE of three independent experiments. a Significantly higher compared with pAAS-9
(P < 0.001); b significantly higher compared with pAAS-9 (P < 0.001). Statistical analysis was performed using a paired two-tailed Student’s
t-test.

1864

FEBS Journal 277 (2010) 1861–1875 ª 2010 The Authors Journal compilation ª 2010 FEBS

Ets-1 ⁄ Elk-1 key regulators of DPP-III transcription

A. A. Shukla et al.

consensus Ets-1 ⁄ Elk-1 core binding motifs (GGAA
GCAGGAA) separated by three bases were present in
this region (at positions )6 and )13). To elucidate the
role of these motifs, we deleted 25 bases from the 3¢end of the construct pAAS-5, thus generating pAAS-9
()124 ⁄ )21). This construct, which lacked 5 bases of
exon 1 and 20 bases of the promoter region, including
Ets-1 ⁄ Elk-1-binding motifs, exhibited no promoter
activity (Fig. 4B). These results established that nucleotides between )20 and +5 are essential for DPP-III
promoter activity.

Binding of transcription factors to the minimal
promoter region (-40 ⁄ +5)

Site-directed mutagenesis
To further corroborate our results, we mutated these
two Ets-1 ⁄ Elk-1 binding motifs sequentially in pAAS-1
using site-directed mutagenesis and assessed the promoter activities of the resulting constructs (Fig. 5).
pAAS-1Mut1 (harbouring a mutated Ets-1 ⁄ Elk-1 motif
at position )6) and pAAS-1Mut2 (having Ets-1 ⁄ Elk-1
mutated motifs at both position )6 and position )13),
were transfected in U87MG cells. Mutations in the
motif at )6 (pAAS-1Mut1) resulted in an 81% loss of
basal promoter activity compared with the full-length

x816.25

a

To show the in vivo binding of Ets-1 and Elk-1 transcription factors with the human DPP-III minimal
promoter region, we performed chromatin immunoprecipitation (ChIP) assays using Ets-1 and Elk-1 antibodies. The immunoprecipitated chromatin was subjected
to PCR using primers flanking the binding motifs present at positions )6 and )13 in the DPP-III promoter.
Amplification of a specific 81 bp DNA fragment was
observed when the DNA was immunoprecipitated
using Ets-1 or Elk-1 antibodies. However, no amplification of any DNA fragment was evident when DNA
was precipitated using mouse IgG (negative control)
(Fig. 6). The identity of the amplified products as part

800
od

y

tib
an

tib

-1

an

Elk
nti

10

0

Et

s-1

+A

b

200

DL

x152.48

300

nti

400

+A

500

od

G

600

y

700
+A
an nti m
tib
od ouse
y
Ig

Luciferase activity
fold increase over pGl3-basic

900

construct (pAAS-1). Whereas mutations in both
Ets-1 ⁄ Elk-1-binding motifs (pAAS-1Mut2) resulted in
a 96% loss of basal promoter activity compared with
the full-length construct (pAAS-1, Fig. 5). Abolition of
the promoter activity confirmed that Ets-1 ⁄ Elk-1 binding motifs are essential for transcription of the human
DPP-III gene. Because mutation of the motif present
at the )6 position alone resulted in an 81% loss of
promoter activity, we conclude that Ets-1 ⁄ Elk-1-binding motifs are critical for DPP-III gene expression.

200 bp
x35.94

100

81 bp

0

pAAS-1

pAAS-1
Mut1

pAAS-1
Mut2

Fig. 5. Functional relevance of Ets-1 ⁄ Elk-1-binding motifs in DPP-III
promoter activity. U87MG cells were transiently transfected with
either wild-type promoter, construct pAAS-1 or promoter constructs
containing one ()6; pAAS-1Mut1) or both ()6 and )13; pAAS1Mut2) mutated Ets-1 ⁄ Elk-1-binding motifs. Luciferase activity was
measured 48 h after transfection and is plotted in the left-hand
panel. Each transfection was performed in triplicate and the results
are expressed as the mean ± SE of three independent experiments. (a) Significantly higher compared with pAAS-1Mut1
(P < 0.001); (b) significantly higher compared with pAAS-1Mut2
(P < 0.001). Statistical analysis was performed using a paired twotailed Student’s t-test.

Fig. 6. In vivo analysis of binding of Ets-1 and Elk-1 to the DPP-III
promoter by ChIP assay. U87MG cells were fixed with 1% formaldehyde to cross-link the existing in vivo proteins–DNA complex.
Nuclei of the cross-linked cells were isolated and subjected to sonication to shear the DNA. Anti-Ets-1 and anti-Ek-1 IgG were used to
immunoprecipitate DNA bound to these proteins. PCR was
performed using DPP-III F-45 and ChIP R as the sense and

antisense primers to specifically amplify 81 bp DPP-III promoter
region including the Ets-1 ⁄ Elk-1-binding motifs present at
positions )6 and )13. PCR using the same primers was also
performed with DNA immunoprecipitated using mouse IgG as
template and served as a negative control. DL100 corresponds to a
100 bp DNA ladder and a single fragment of 200 bp is indicated by
an arrow.

FEBS Journal 277 (2010) 1861–1875 ª 2010 The Authors Journal compilation ª 2010 FEBS

1865


Ets-1 ⁄ Elk-1 key regulators of DPP-III transcription

A. A. Shukla et al.

Table 1. Sequence of double-stranded oligonucleotides used in the
gel-shift assay. The two Ets-1 ⁄ Elk-1-binding motifs present (positions )6 and )13 in the dipeptidyl-peptidase III promoter sequence)
in the wild-type oligonucleotide (Ets-Wt; )18 ⁄ +5 with respect to
transcription initiation site) are shown in bold. Mutated nucleotides
are shown in lowercase.
Probe

1

3

4

–

+

+

+

Ets-Wt

+

+

–

–

Ets-M1

–

–

+

–

Ets-M2

GAGCCGGAAGCAGGAAGTGAGTT
GAGCCGGAAGCAGtAtGTGAGTT
GAGCCGtAtGCAGtAtGTGAGTT

2

Nuclear extract

–

–

–

+

Sequence (5¢-3¢)

Ets-Wt
Ets-M1
Ets-M2

A

Shift 2
Shift 1

of the DPP-III promoter was confirmed by DNA
sequencing.
An electrophoretic mobility shift assay (EMSA) was

performed to assess the specific binding of Ets-1 ⁄ Elk-1
to the DPP-III minimal promoter region. EMSA was
performed using nuclear extracts obtained from
U87MG cells. Nucleotide fragments (23 bp) harbouring wild-type ()18 ⁄ +5; Ets-Wt) or mutated (Ets-M1
and Ets-M2) Ets-1 ⁄ Elk-1 motifs were used as radiolabelled probes for this purpose (Table 1). Incubation of
radiolabelled Ets-Wt with the nuclear extract resulted
in the formation of two DNA–protein complexes
which migrated more slowly than the free radiolabelled
probe (Fig. 7A,B; lanes 2). In the first complex
(Fig. 7A; shift 1), nuclear proteins showed strong binding to the probe compared with the second complex
(Fig. 7A; shift 2), which migrated more slowly than
the first. Formation of these complexes was abrogated
in the presence of a 100 molar excess of unlabelled
Ets-Wt (Fig. 7B, lane 3). Incubation of either radiolabelled Ets-M1 or Ets-M2 with the nuclear lysate did
not result in the formation of any such complex
(Fig. 7A; lanes 3 and 4). Consistent with these results,
in the presence of a 100 molar excess of unlabelled
Ets-M2, no change in the binding of nuclear proteins
to radiolabelled Ets-Wt was observed (Fig. 7B; lane 4).
Incubation of the mixture of radiolabelled probe and
nuclear lysate with antibodies specific for Ets-1 ⁄ Elk-1
resulted in ‘supershifts’ of the complex (shift 1)
(Fig. 7B; lanes 6 and 8). However, the formation of
such complexes was not observed when antibodies
were added to the nuclear lysate prior to addition of
the labelled probe (Fig. 7B; lanes 5 and 7),
Upregulation of DPP-III expression and promoter
activity by v-Ha-ras
Promoter deletion analysis, site-directed mutagenesis,
EMSA and ChIP assays demonstrated that Ets-1

and Elk-1 play a critical role in the transcription of

1866

B
1

2

3

4

5

6

7

8

Nuclear extract

–

+

+

+

+

+

+

+

Radiolabeled Ets-Wt

+

+

+

+

+

+

+

+

Unlabeled Ets-Wt

–

–

+

–

–

–

–

–

Unlabeled Ets-M2

–

–

–

+

–

–

–

–

Ets-1 antibody

–

–

–

–

+*

+

–

–

Elk-1 antibody

–

–

–

–

–

–

+*

+

Shift 2
Super shift
Shift 1

Fig. 7. Binding profile of nuclear proteins from U87MG cells to the
5¢-flanking region of the human DPP-III gene. (A) Radiolabelled 23mer double-stranded wild-type (Ets-Wt) and mutated (Ets-M1 and
Ets-M2) oligonucleotides were incubated with nuclear extracts
(15 lg of protein) prepared from U87MG cells in the binding assay.
The DNA–protein complexes (black arrow) were resolved on a nondenaturing gel and subjected to autoradiography. (B) The binding
reactions were carried out in the absence or presence of a 100
molar excess of unlabelled wild-type or mutant double-stranded oligonucleotides. In some of the reactions, 4 lg of antibody against
c-Ets-1 and pElk-1 were incubated with nuclear lysate before (lanes
5 and 7) or after (lanes 6 and 8) adding labelled probe. The shifts
produced are shown by black arrows and supershifted complexes
are shown by white arrows.

FEBS Journal 277 (2010) 1861–1875 ª 2010 The Authors Journal compilation ª 2010 FEBS


Ets-1 ⁄ Elk-1 key regulators of DPP-III transcription

A. A. Shukla et al.

DPP-III gene. Most Ets family proteins are nuclear
targets for phosphorylation by the RAS ⁄ mitogenactivated protein kinase (MAPK) signalling pathway.
These nuclear phospho-proteins in turn influence cell
proliferation, differentiation and oncogenic transformation. Our laboratory has developed a human liver
cell line (Chang liver) stably expressing v-Ha-ras
(M. Jain et al., unpublished results). These Chang liver
ras (CLR) cells exhibited approximately twofold higher
levels of pElk-1 (P £ 0.002) compared with cells stably
transfected with the empty vector (Chang liver DRas;
CLDR) (Fig. 8A). Transfection of pAAS-1 in CLR
and CLDR cells demonstrated a twofold higher luciferase activity in CLR cells compared with CLDR cells,
(P < 0.001; Fig. 8B). To demonstrate that the higher
DPP-III promoter activity was because of increased
levels of pElk-1 in v-Ha-ras-expressing cells (CLR), we
treated CLR and CLDR cells with mitogen-activated
protein kinase kinase ⁄ extracellular regulated kinase
(MEK ⁄ ERK) inhibitor U0126 (Sigma-Aldrich, Urbana,
IL, USA). Immunoblot analysis using antibodies specific for pERK confirmed a significant reduction in the
levels of its phosphorylated form (P £ 0.02; Fig. 8D,E).
Similarly, levels of pElk-1 were found to be decreased
in U0126-treated CLR cells compared with untreated
cells (P £ 0.003). However, CLDR cells did not exhibit
any significant difference in pElk-1 levels on treatment
with the inhibitor (Fig. 8F,G). Our efforts to compare
the levels of pEts-1 failed because the antibody did not
work in western blots.
The effect of inhibition of the MAPK pathway by
the U0126 inhibitor and the concomitant influence of

pElk-1 levels on transcription of the DPP-III gene was
assessed. In this regard, mRNA levels specific for the
DPP-III gene were estimated in both cell lines before
and after treatment with inhibitor. We observed that
expression of DPP-III mRNA in CLR cells was twofold higher than in CLDR cells (P £ 0.002). Treatment
of CLR cells with U0126 decreased the DPP-III
mRNA level by threefold (P £ 0.03), although there
was no significant effect on DPP-III mRNA levels in
treated CLDR cells (Fig. 8H). Thus we conclude that
upregulation of DPP-III expression by v-Ha-ras is
mediated by increased Elk-1 phosphorylation.
Induction of DPP-III promoter activity by Ets-1
It is evident from the results presented in Fig. 2 that the
DPP-III promoter exhibits minimal activity in human
cell lines like Panc1 and Chang liver. Therefore, to
further establish the role of Ets-1 in the transcription
of DPP-III, we co-transfected Chang liver cells with
DPP-III promoter–reporter construct containing wild-

type (pAAS-1) or mutant (pAAS-1Mut2) Ets-1 ⁄ Elk-1binding motifs with the Ets-1 expression vector (pEts-1)
in a molar ratio of 1 : 1. Simultaneously, pAAS-1 and
pAAS-1Mut2 were also co-transfected along with empty
Ets-1 expression vector (pcDNA3.1) and luciferase
activity was assayed in all transfected cells. Co-transfection of pAAS-1 with pEts-1 resulted in a significant
(P = 0.03) increase in promoter activity compared with
co-transfection with empty vector (Fig. 9). However, no
such difference in promoter activity was observed when
pAAS-1Mut2 was co-transfected with pEts-1 or empty
vector (Fig. 9). These results clearly establish that
over-expression of Ets-1 induces the DPP-III promoter

activity.

Discussion
Human DPP-III, a metalloaminopeptidase, purified
and characterized from a number of tissues, has been
implicated in several physiological and pathological
processes. To understand the regulation of its expression, the promoter of this peptidase has been cloned
and characterized for the first time in this study.
We amplified a 1038 bp genomic fragment located
upstream of the previously published DPP-III transcript (accession number NM_005700). This fragment
exhibited maximal promoter activity in human glioblastoma cells compared with other human and murine
cells, as assessed by luciferase reporter assays (Fig. 2).
These results are in agreement with the high DPP-III
activity reported in brain homogenates of rat, monkey
and guinea pig [5,7,16]. The presence of DPP-III in the
central nervous system facilitates the degradation of
angiotensins and encephalin, suggesting its role in
blood pressure regulation and in pain modulation [5].
Analysis of the amplified fragment (DPP-III promoter) revealed the absence of a consensus TATA
box, a high GC content (63.16%), and the presence of
multiple binding motifs for Sp1, suggesting that the
human DPP-III gene is a housekeeping gene (Fig. 1)
[17–19]. This is corroborated by reports demonstrating
its expression in a wide range of tissues from different
animal species [5,9,11,20]. Our results demonstrate
increased DPP-III promoter activity in v-Ha-ras transformed cells. Consistent with these results, TATA-less
promoters of human lysosomal cysteine cathepsins are
also upregulated by malignant transformation [21].
Most of the TATA-less promoters are known to
initiate transcription from multiple sites. However,

TATA-less promoters with multiple GC boxes have
been shown to initiate transcription from a single site,
as in the case of nerve growth factor receptor [22], the
cellular retinol-binding protein [23], endothelial nitric

FEBS Journal 277 (2010) 1861–1875 ª 2010 The Authors Journal compilation ª 2010 FEBS

1867


Ets-1 ⁄ Elk-1 key regulators of DPP-III transcription

A

CLR

A. A. Shukla et al.

B

CLΔR

16

a

pELK-1
arbitrary units (× 104)

14

pELK-1

CLR

CLΔR

12
10
8
6
4
2
0

CLR

α-Tubulin

Luciferase activity
fold increase over pGl3-basic

C

250

D
x190.35

200

CLΔR

Tr
CLR

a

Tr
CLΔR

Untr
CLΔR

Untr
CLR

150

pElk

x102.28

100

α-Tubulin
50
0

E

CLΔR

180

pELK
arbitrary units (× 102)

CLR

160

F
Untr
CLR

Tr
CLR

Untr
CLΔR

Tr
CLΔR

140
120

pElk

100
80

α-Tubulin

60
40
20
0

Untr Tr

CLR

CLΔR

H

35

Relative abundance of DPPIII mRNA

G

Untr Tr

pELK
arbitrary units (× 104)

30

25
20
15
10
5
0
Untr Tr

CLR

1868

Untr Tr

CLΔR

1.2

a,b,c

1
0.8
0.6
0.4
0.2
0

Untr Tr

CLR

Untr Tr

CLΔR

FEBS Journal 277 (2010) 1861–1875 ª 2010 The Authors Journal compilation ª 2010 FEBS


Ets-1 ⁄ Elk-1 key regulators of DPP-III transcription

A. A. Shukla et al.

Luciferase activity
fold increase over pGl3-basic

250

x185.51

a
200
150
100

x94.07

50
x7.52

x6.30

0

Fig. 9. Overexpression of pEts-1 results in increased DPP-IIII
promoter activity in human liver cells. DPP-III promoter–reporter
construct harbouring wild-type (pAAS1) or mutant (pAAS1Mut2)
Ets-binding motifs were co-transfected with Ets-1 expression
vector (pEts-1) or empty vector (pcDNA3.1) at a molar ratio of 1 : 1
in Chang liver cells. Forty-eight hours post transfection, cells
were lysed and luciferase activity was assayed. Values are
the mean ± SE of four independent experiments performed in
triplicate. Results were statistically analysed using the Student’s
t-test and luciferase activity significantly different from the
promoter–reporter construct transfected with empty vector is
denoted by ‘a’.

oxide [24] and genes coding for DPP-I [18]. Similarly,
we observed a single transcriptional start site located
33 nucleotides upstream of the translation initiation
codon for DPP-III in U87MG cells (Fig. 1). Analysis
of the DPP-III promoter sequence revealed the presence of an initiator element (Inr)-like sequence surrounding the transcription initiation site and two
A ⁄ T-rich sequences at positions )29 and )24 (Fig. 1).
The A ⁄ T content of the )30 sequence in an Inrcontaining synthetic promoter has been shown to have
a profound positive influence on the strength of the
promoter, despite having minimal resemblance to the
TATA consensus sequence [25,26]. The stretch of
DNA between the Inr sequence and the A ⁄ T-rich
region in the DPP-III promoter contains a GC box
(Sp1-binding motif) and two Ets-1 ⁄ Elk-1-binding
motifs. Both of these transcription factors are known

to help in recruitment of the transcription initiation
assembly [27–29] and therefore this arrangement of nucleotides in the DPP-III promoter is probably responsible for the strong promoter activity of DPP-III in
U87MG cells.
Deletion analysis of the DPP-III promoter revealed
that the region between )781 and )485 bp contains
several transcription factor binding motifs such as
USF, C ⁄ EBP and Sp1 (Fig. 1), and removal of this
region results in a 40% decrease in promoter activity

Fig. 8. Elevation of DPP-III mRNA, promoter activity and pElk-1 levels by H-ras in human liver cells. (A) An equal amount of total protein
from Chang liver cells expressing v-Ha-ras (CLR) and control cells (CLDR) was resolved on SDS ⁄ PAGE and subjected to western blotting
using mAb raised against phosphorylated form of Elk-1 (pElk-1) protein or a-tubulin. (B) The individual pELK-1 bands of the blots given in (A)
have been quantitated densitometrically and normalized with the a-tubulin levels. Values are the mean ± SE of three independent experiments. Results were statistically analysed using the Student’s t-test. Values significantly different from CLDR cells are denoted by ‘a’. (C) To
measure DPP-III promoter activity, CLR and CLDR cells were transiently transfected with DPP-III full-length promoter construct (pAAS-1) and
luciferase activity was measured 48 h post transfection. Other details are given in Material and methods. Values are the mean ± SE of at
least three independent experiments. a Significantly higher compared with CLDR (P < 0.05). (D) Equal amounts of total protein from Chang
liver cells expressing v-Ha-ras (CLR) and control cells (CLDR) treated with either dimethylsulfoxide or U0126 were resolved on SDS ⁄ PAGE
and subjected to western blotting using an antibody raised against the phosphorylated form of Erk-1 or a-tubulin protein. (E) Densitometric
quantitation of the phosphorylated form of Erk-1. The bands of the blot given in (D) were subjected to densitometry and the values obtained
were normalized with the levels of a-tubulin. Values are the mean ± SE of three independent experiments. Results were statistically analysed using the Student’s t-test. Values significantly different from CLDR cells are denoted by ‘a’. (F) Equal amount of total protein from Chang
liver cells expressing v-Ha-ras (CLR) and control cells (CLDR) treated with either dimethylsulfoxide or U0126 were resolved on SDS ⁄ PAGE
and subjected to western blotting using an antibody raised against the phosphorylated form of Elk-1 or a-tubulin protein. (G) Densitometric
quantitation of phosphorylated form of Elk-1. Bands of the blot given in (F) were subjected to densitometry and the values obtained normalized with the levels of a-tubulin. Values are the mean ± SE of three independent experiments. Results were statistically analysed using the
Student’s t-test. Values significantly different from CLDR cells are denoted by ‘a’. (H) An equal amount of total RNA from CLR and CLDR
cells before and after treating cells with either U0126 (10 lgỈmL)1) or dimethylsulfoxide was reverse transcribed and subjected to real time
PCR using DPP-III (DPP F20 and AAS1) and b-actin (b-actin-F and b-actin-R) specific primers. The DPP-III mRNA levels were calculated using
b-actin as the internal control. Cycle threshold (Ct) values were calculated for each PCR and relative fold change was calculated using 2)DD
Ct
method [16]. Each set of observations was compared with the other set using a paired two-tailed t-test, assuming unequal variances
among the sample means. A P-value of £ 0.05 was considered statistically significant. a Significantly higher compared with Chang liver Ras

treated (P < 0.05), b significantly higher compared with Chang liver DRas untreated (P < 0.05), c significantly higher as compared to Chang
liver DRas untreated (P < 0.05).

FEBS Journal 277 (2010) 1861–1875 ª 2010 The Authors Journal compilation ª 2010 FEBS

1869


Ets-1 ⁄ Elk-1 key regulators of DPP-III transcription

A. A. Shukla et al.

(Fig. 4A). These results suggest that some or all of
these motifs are important for DPP-III transcription.
This analysis also suggested that the 25 nucleotides at
the 3¢-end of the DPP-III promoter are essential for its
activity (Fig. 4B). Nucleotide sequence analysis of this
region revealed the presence of two Ets-1 ⁄ Elk-1-binding motifs (GGAAGCAGGAA) at positions )6 and
)13. EMSA and ChIP assays established the binding
of the transcription factor(s) to these motifs. Ets-1 has
been shown to positively regulate urokinase plasminogen activator (uPA) expression in breast cancer, glioma, astrocytoma and meningioma cells [30,31].
Similarly, Ets transcription factor(s) regulate the
expression of several other human genes such as
stromelysin [32], prolactin and growth hormone [33]
and chemokine [34]. Mutations in the Ets-1 ⁄ Elk-1binding motifs abolished promoter activity (Fig. 5).
This was in agreement with the EMSA results using
the 23 bp DNA fragment, wherein no shift in mobility
was observed, (Fig. 7). These results led us to conclude
that the mutations which abolish the binding of Ets-1
and Elk-1 to DPP-III promoter result in a concomitant

loss of promoter activity.
Several studies have demonstrated that Ets-binding
motifs when present in a pair and in close proximity
with each other, induce gene expression to a higher
level [35–37]. Consistent with these reports, the
DPP-III promoter containing two Ets-binding motifs
(at positions )6 and )13) separated by three nucleotides exhibits robust activity (800-fold over pGL3Basic) in U87MG cells (Fig. 2). Mutagenesis of just
one of these motifs ()6 position) resulted in a
> 80% decrease in promoter activity, suggesting that
both motifs are essential for strong promoter activity
(Fig. 5). The cooperative binding of Ets proteins as a
homodimer or a heterodimer to form a ternary complex with the promoter region of several genes has
been demonstrated [32,36]. Stromelysin-1 promoter is
transactivated by a homo-dimer of Ets-1 through
head-to-head Ets-binding sites [36]. The DPP-III promoter contains two Ets-binding motifs arranged in a
head-to-tail orientation within the first 25 bp
upstream of the transcription start site. However,
Ets-1 binds as a homodimer when the two motifs are
present in a head-to-head orientation [36]. In supershift assays, the mobility of the DNA–protein complex was further shifted to a similar extent by both
Ets-1 and Elk-1 antibodies (Fig. 7B), suggesting the
binding of both these transcription factors to their
cognate motifs in this region. The formation of two
DNA–protein complexes also suggests that both these
transcription factors bind individually, as well as in
the form of a heterodimer to the DPP-III promoter.
1870

The N-terminal domain of Ets-1 is involved in the
formation of a complex with other proteins, whereas
its C-terminal domain is involved in DNA binding

[38]. By contrast, the DNA-binding domain of Elk-1 is
present at its N- terminal end and C-termini allows it
to form homo- or heterodimers. In our supershift
experiments, we used an antibody against Ets-1 raised
against its N-terminal region and an antibody against
Elk-1 raised against phosphorylated Ser383 present at
the C-terminus of this protein. Preincubation of
nuclear proteins with antibodies completely abolished
the formation of shift 2 (Fig. 7B; lanes 5 and 7). This
result suggests that shift 2 was created by binding a
heterodimer of Ets-1 and Elk-1 to the probe, and the
N-terminus of Ets-1 and the C-terminus of Elk-1 were
involved in the formation of the heterodimer. Preincubation of nuclear proteins with antibodies against
Ets-1 or Elk-1 prevented the formation of any such complex, confirming the binding of a heterodimer of Ets-1
and Elk-1 to the probe. Likewise, incubation of
antibodies with the DNA–protein complexes did not
produce any supershift of shift 2 because the N-terminus of Ets-1 and the C-terminus of Elk-1 were
involved in the formation of the heterodimer and were
not therefore available for binding to their respective
antibodies. However, these antibodies allowed us to
identify binding of both Ets-1 and Elk-1 separately, as
well as in the form of a complex to the DPP-III promoter. The slower moving complex (Fig. 7A, shift 2)
showed strong binding of nuclear proteins to the probe
only when antibodies were added after incubation of
probe with the nuclear proteins (Fig. 7B, lanes 6
and 8) suggesting stabilization of the DNA–protein
complex.
From these results it is apparent that Ets-1 and
Elk-1 are involved in the formation of a ternary complex with the DPP-III promoter and in regulating its
expression. In addition, Ras has been shown to mediate the phosphorylation of Ets proteins thereby

increasing their transactivation ability [39,40]. In this
regard, we observed significantly higher mRNA expression and promoter activity of DPP-III associated with
elevated levels of phosphorylated Elk-1 in CLR cells.
This further reiterates the role of Ets proteins in
DPP-III expression. Finally, co-transfection of Ets-1
expression vector (pEts-1) with promoter–reporter construct harbouring wild-type (pAAS-1), but not mutated
(pAAS-1Mut2), Ets-1 ⁄ Elk-1-binding motifs exhibited a
significant increase in promoter in Chang liver cells
(Fig. 9). These results confirm that Ets-1 is necessary
for DPP-III transcription and convincingly demonstrate the critical role of Ets-1 ⁄ Elk-1 in the expression
of this peptidase.

FEBS Journal 277 (2010) 1861–1875 ª 2010 The Authors Journal compilation ª 2010 FEBS


Ets-1 ⁄ Elk-1 key regulators of DPP-III transcription

A. A. Shukla et al.

Materials and methods
Cell culture
Human glioblastoma (U87MG), ovarian carcinoma (Caov-2),
pancreatic carcinoma (Panc1) and mouse fibroblast
(NIH 3T3) cells (obtained from National Centre for Cell
Science, Pune, India) were grown in Dulbecco’s modified
Eagle’s medium (Sigma-Aldrich, St. Louis, MO, USA)
containing high glucose (4.5 gỈL)1 at 25 mm) and supplemented with 20 lgỈmL)1 ciprofloxacin and 10% fetal
bovine serum (Gibco Life Technologies, Karlsruhe,
Germany) in a humidified atmosphere containing 5% CO2
at 37 °C. Chang liver cells, and stably v-Ha-ras-transfected

Chang liver cells, were cultured under identical conditions
in minimum essential medium containing 500 lgỈmL)1 G418
(Sigma-Aldrich).

Antibodies
Antibodies against human Ets-1 (sc-111) and human pElk-1
(sc-8406) were purchased from Santa Cruz Biotechnologies
(Santa Cruz, CA, USA).

Transfection
For all transfections, 106 cells were plated in each well of a
six-well plate 1 day prior to transfection. Next day, cells
were washed twice with serum-free medium before transfecting with 1 lg of control or test plasmid DNA using
TransfastÔ (Promega), according to the manufacturer’s
protocol. After 48 h, transfectants were washed three times
with ice cold NaCl ⁄ Pi, lysed and the luciferase activity in
the cell lysates measured using a dual-luciferase reporter
assay system (Promega, Madison, WI, USA). The pRL-TK
vector containing the Renilla luciferase gene under
HSV TK promoter (Promega) were co-transfected with
each construct and served as an internal control for normalization for the transfection efficiency and cell number.

Treatment of cells with the MEK inhibitor U0126
MEK inhibitor U0126, (Promega) was dissolved in dimethylsulfoxide leading to a 50 mm U0126 stock solution. Cells
were serum starved for 24 h before treatment. For the
experiments, U0126 was used at a concentration of
10 lgỈmL)1 in medium. In parallel, control cells were
treated with dimethylsulfoxide alone in the respective
concentration.

Amplification and cloning of the 5¢ upstream
region of the human DPP-III gene
Mapping of the transcription initiation site
To amplify the upstream region of the DPP-III gene, HpaIand NheI-digested total human genomic DNA was used as
a template and three rounds of PCR were performed using
primers designed based on human genome sequence (accession number NT_033903.7). For primary PCR, a sense
primer DPP-III F1 (5¢-TCCTAAGGACACCGACCAAC3¢, Fig. 1) from the upstream region and an antisense primer DPP-III R1 (5¢-CAGAAAGGGAA-CGATTTTGC-3¢;
Fig. 1) from the first intron were used. The product of the
primary PCR was diluted 100-fold and 1 lL of it was subjected to secondary PCR amplification using DPP-III F2
(5¢-AGCCTCGAGACCGTGCGGGATTTCA-3¢;
Fig. 1)
and DPP-III R2 (5¢-AGTATGGATTCGCCTTGGTC-3¢;
Fig. 1) as nested sense and antisense primers, respectively.
Similarly, a 1.0 lL aliquot of 100-fold diluted secondary
PCR products was subjected to a third round of PCR using
DPP-III F2 and DPP-III R3 (5¢- CCCAAGCTTAACT
CACTTCCTGCTTC-3¢; Fig. 1) as the sense and antisense
primers, respectively. The amplified fragment was subjected
to double-strand DNA sequencing followed by cloning into
the promoter-less reporter vector pGL3-Basic (Promega,
Madison, WI, USA) upstream of the luciferase reporter
gene. XhoI and HindIII restriction sites (shown in bold)
were incorporated in DPP-III F2 and DPP-III R3, respectively, to facilitate the cloning of the amplified fragment.
The resulting construct was named as pAAS-1 and further
used for generation of deletion and mutated constructs.

The transcription initiation site of the human DPP-III gene
was mapped using a 5¢-RACE kit (Roche Applied Science,
Mannheim, Germany) according to the manufacturer’s protocol. For this purpose, 3–4 lg of total RNA isolated from
U87MG cells was reverse transcribed by avian myeloblastosis virus-reverse transcriptase using an antisense DPP-IIIspecific primer AAS-2 (5¢-CTGAGCAGAGCATAGATG

TAG-3¢; Fig. 1). A poly(A) tail was added to the 3¢-end of
the purified cDNA with the help of terminal transferase.
The deoxyribosyladenosine-tailed cDNA thus obtained was
used as a template for PCR using an oligo(dT) anchor
primer provided with the kit and an antisense DPP-III
specific primer AAS-2. Another round of PCR was performed using 10-fold diluted products of primary PCR as
the template and the PCR anchor primer supplied with the
kit and a gene-specific primer AAS-1 (5¢-GACAGGTGG
TAGGCATAGAG-3¢; Fig. 1). The RACE products were
cloned into pGEM-TEasy (Promega) and sequenced.

Generation of promoter deletion constructs
Various 5¢ promoter deletion constructs were generated by
PCR using wild-type full-length DPP-III promoter–reporter
construct ()1033 ⁄ + 5; pAAS-1) as the template and a common antisense primer DPP-III R3. However, different sense
primers were used for each deletion construct. The PCR

FEBS Journal 277 (2010) 1861–1875 ª 2010 The Authors Journal compilation ª 2010 FEBS

1871


Ets-1 ⁄ Elk-1 key regulators of DPP-III transcription

A. A. Shukla et al.

fragments were cloned upstream of the lucifersae reporter
gene in HindIII- and XhoI-digested pGL3-Basic vector.
These sites were introduced in antisense and all-sense primers, respectively to facilitate the process of cloning and have
been shown in bold. The sense primers used for the different

constructs were DPP-III F-786: 5¢-CCCCTCGAGCCGTC
CAGACCTGTAAAAG-3¢ ()781 ⁄ +5; pAAS-2), DPP-III
F-490:
5¢-CACCTCGAGCTTTGCAACTTCCAAG-3¢
()485 ⁄ +5; pAAS-3), DPP-III F-129: 5¢-CGACTCGAGAAG
CTCGTCTTGG-3¢ ()124 ⁄ +5; pAAS-5), DPP-III F-98:
5¢-GGCTCGAGCTGACGCCCATCC-3¢ ()93 ⁄ +5; pAAS–6),
DPP-III F-58: 5¢-GTTCTCGAGGGGGGGCGGGGTT-3¢
()53 ⁄ +5; pAAS-7), DPP-III F-45: 5¢-GCGCTCGAGGCA
GAGCCCCAAT-3¢ ()40 ⁄ +5; pAAS-8). However, to generate the construct pAAS-9 ()124 ⁄ )21) lacking 25 bases from
the 3¢-end and 909 bases from 5¢-end of the promoter, the
sense and antisense primers used were DPP-III F-129 and
DPP-III R-21: 5¢-CCGAAGCTTCCATTCATTGGGG-3¢.
Promoter–reporter construct pAAS-4 ()230 ⁄ +5) was generated by excision of the ()1033 ⁄ +5) fragment from pAAS-1
by digesting with KpnI followed by religating the larger
fragment. All constructs were subjected to double-stranded
DNA sequencing to rule out the inadvertent induction of
mutation(s) by PCR.

Site-directed mutagenesis
Oligonucleotide-mediated mutagenesis was employed to
introduce mutations into the Ets-1- and Elk-1-binding
motifs present at positions )6 and )13 in the DPP-III promoter. PCR was performed using pAAS-1 as a template,
DPP-IIIF2 as the sense primer and DPP-III R3M1
(5¢-CCCAAGCTTAACTCACaTaCTGCTTC-3¢) as the antisense primer to mutate the Ets-1 ⁄ Elk-1-binding motif present at position )6. However, for mutagenesis of the
Ets-1 ⁄ Elk-1 motifs present at both the )6 and )13 positions,
PCR was performed using same the sense primer and DPPIII R3M2 (5¢-CCCAAGCTTAACTCACaTaCTGCTTaCG3¢) as the antisense primer. The nucleotides changed to
mutate the Ets-1 ⁄ Elk-1-binding motifs are shown in lower
case. The amplified fragments were cloned and sequenced.

Preparation of nuclear extract
U87MG cells were grown in flasks until they were  80%
confluent. Cells were harvested and washed twice in
NaCl ⁄ Pi. A pellet of 2 · 107 cells was resuspended in
200 lL of sucrose buffer (320 mm sucrose, 10 mm Tris
pH 8, 3 mm MgCl2, 2 mm Mg-acetate, 0.1 mm EDTA,
0.5% NP-40, 1 mm dithiothreitol, 0.5 mm phenylmethanesulfonyl fluoride and 10 mm NaF) and incubated
on ice for 10 min, followed by centrifugation for 5 min at
500 g. The pellet was washed with sucrose buffer (without
NP-40) and resuspended in 60 lL of low-salt buffer (20 mm
Hepes ⁄ KOH pH 7.9, 1.5 mm MgCl2, 40 mm KCl, 0.2 mm

1872

EDTA, 25% glycerol, 0.5 mm dithiothreitol, 0.5 mm
phenylmethanesulfonyl fluoride, 10 mm NaF and protease
inhibitor cocktail; Sigma-Aldrich, St. Louis, IL, USA).
High-salt buffer (20 mm Hepes ⁄ KOH pH 7.9, 1.5 mm
MgCl2, 800 mm KCl, 0.2 mm EDTA, 25% glycerol, 1%
NP-40, 0.5 mm dithiothreitol, 0.5 mm phenylmethanesulfonyl fluoride, 10 mm NaF and protease inhibitor cocktail)
was added slowly in very small aliquots, while mixing with
a pipette tip, followed by incubation on ice with intermittent shaking. After 45 min, the lysate was centrifuged at
14 000 g for 15 min. All the steps were carried out at 4 °C.
The supernatant was removed and stored at )70 °C
in small aliquots, following protein estimation using the
Bradford method [41].

ChIP assays
ChIP assays were performed using ImprintÔ Chromatin
Immunoprecipitation Kit (Sigma-Aldrich) according to the

manufacturer’s protocol. Two micrograms of antibody,
diluted in 100 lL antibody buffer was incubated for 90 min
in the strip wells provided in the kit. Simultaneously,
1 · 106 U87MG cells were treated with 1% formaldehyde
for 10 min at 25 °C to cross-link the existing DNA–protein
complex(s). After treating with glycine (125 mm) to quench
cross-linking, cells were processed for the isolation of
nuclei. The nuclear pellet was resuspended in the shearing
buffer provided in the kit and subjected to sonication using
a Misonix sonicator at a power setting of 1.5 and a 100%
duty cycle; the extracts were sonicated for three 10 s pulses,
with 2 min on ice between pulses. Sheared chromatin was
separated from the cell debris by centrifugation at 14 000 g
for 10 min at 4 °C. The supernatant was incubated in wells
precoated with the antibodies for 90 min. The immunoprecipitated DNA was recovered and used as a template for
PCR
with
DPP-III F-45
and
ChIPR
(5¢-CCG
CGCCTCACCTGCAGCA-3¢; Fig. 1) as the sense and antisense primers. The products were resolved on agarose gel,
purified and sequenced.

EMSA
Twenty-three base pair radiolabelled double-stranded fragments (from position )18 to +5 with respect to transcription initiation site mapped) containing wild-type or
mutated Ets-1 ⁄ Elk-1-binding motifs were end-labelled with
[32P]ATP[cP] and T4 polynucleotide kinase. The unincorporated [32P]ATP[cP] was removed by Sephadex G25 column
chromatography. Gel-shift assays were performed using
Promega’s Gel Shift Assay System according to the manufacturer’s protocol. Binding reactions were carried out at

room temperature for 30 min using 15 lg of U87MG
nuclear lysate and 0.035 pmol of radiolabelled probe in
buffer containing 2% glycerol, 0.5 mm MgCl2, 0.25 mm
EDTA, 0.25 mm dithiothreitol, 25 mm NaCl, 5 mm

FEBS Journal 277 (2010) 1861–1875 ª 2010 The Authors Journal compilation ª 2010 FEBS


Ets-1 ⁄ Elk-1 key regulators of DPP-III transcription

A. A. Shukla et al.

Tris ⁄ HCl pH 7.5 and 0.025 mgỈmL)1 poly(dI-dC)Ỉ(dI-dC).
A 100 m excess of unlabelled wild-type or mutated probe
was added to the binding reactions for specific and nonspecific competitive assays. For supershift assays 4 lg of the
specific antibody against Ets-1 and ⁄ or pElk-1 was added to
the binding reactions, followed by incubation for 4 h at
room temperature. Protein–DNA complexes were resolved
on 5% nondenaturing PAGE in 0.5 · TBE buffer and visualized by autoradiography.

other set using a paired two-tailed t-test, assuming unequal
variances among the sample means. A P-value of £ 0.05
was considered to be statistically significant.

Statistical analysis
The results of the present study were analysed by Student’s
t-test.

Acknowledgements
Western blotting

Equal numbers of Chang liver cells stably transfected with
v-Ha-ras expression vector (CLR) or empty vector (CLDR)
were washed twice with ice cold NaCl ⁄ Pi and lysed in
RIPA buffer (50 mm Tris ⁄ HCl pH 7.5, 1 mm EDTA
pH 8.0, 1% NP-40, 150 mm NaCl, 10 mm MgCl2, 10 mm
NaF, 1 lgỈmL)1 protease inhibitor cocktail). Cell lysates
containing equal amounts of total protein ( 80 lg) were
resolved on 12% denaturing SDS ⁄ PAGE and transferred
on to a 0.45 lm (pore size) nitrocellulose membrane (mdi,
Ambala Cantt, India). The blots were incubated with
anti-pElk-1 IgG (Santa Cruz Biotechnology, Santa Cruz,
CA, USA) and a-tubulin (Sigma, Sigma-Aldrich) followed
by incubation with alkaline phosphatase-conjugated antirabbit IgG (Santa Cruz Biotechnology). Proteins bands
were visualized using premixed 5-bromo-4-chloroindol-2-yl
phosphate ⁄ Nitro Blue tetrazolium solution (Sigma-Aldrich).

Real-time PCR
Total RNA ( 3 lg) was reverse-transcribed using M-MuLV
RT (MBI Fermentas, Vilnius, Lithuania) and random
hexamers according to the manufacturer’s protocol. An aliquot containing 200 ng of the total cDNA was subjected
to PCR using DPP-III F-20 (5¢-GCAGGAAGTGA
GTTTCGAAC-3¢) and AAS1 as sense and antisense primers on a Bio-Rad I-cycler (Bio-Rad, Hercules, CA, USA).
PCR was carried out in a final volume of 25 lL containing
1.5 mm MgCl2, 20 lm of each primer, 0.2 mm dNTP mix,
1 U Taq DNA polymerase (Invitrogen, Carlsbad, CA,
USA), 1 · PCR buffer (Invitrogen) and 1 · SYBER green
(Invitrogen). The PCR conditions comprised of 40 cycles
of denaturation 94 °C for 30 s, annealing at 59 °C for 45 s,
extension at 72 °C for 1 min and fluorescence recording at
80 °C for 30 s. Similarly b-actin cDNA was also amplified

using primers b-actin F (sense) (5¢-AGAAAATCTGGC
ACCACACC-3¢) and b-actin R (antisense) (5¢-TAGCACAGCCTGGATAGCAA-3¢), and served as the internal control. Melting-curve analysis was performed to
confirm primer–dimer formation for human DPP-III or
b-actin cDNAs under the above mentioned conditions.
Cycle threshold (Ct) values were calculated for each PCR
and relative fold change was calculated using 2)DDCt
method [42]. Each set of observation was compared to the

We are thankful to Professor H. K. Prasad for critically reading the manuscript. The Ets-1 expression vector was a kind gift from Professor U. Pati, School of
Biotechnology, JNU, New Delhi. This work was supported by a research grant [N1004] from Defence
Research Development Organization (DRDO), Government of India to SSC. AAS and MJ are recipients
of junior and senior research fellowships from Council
of Scientific and Industrial Research, Government of
India, and University Grants Commission, New Delhi,
respectively.

References
1 Hopsu-Havu VK, Jansen CT & Jarvinen M (1970)
Partial purification and characterization of an alkaline
dipeptide naphthylamidase (Arg–Arg–NAase) of the rat
skin. Arch Klin Exp Dermatol 236, 267–281.
2 de Bersaques J (1972) Peptidases and naphthylamidases
in human skin. Influence of buffers, EDTA and metals
on dipeptide arylamidase 3. Enzymologia 43, 253–259.
3 Swanson AA, Davis RM & McDonald JK (1984)
Dipeptidyl peptidase III of human cataractous lenses.
Partial purification. Curr Eye Res 3, 287–291.
4 Abramic M, Zubanovic M & Vitale L (1988) Dipeptidyl
peptidase III from human erythrocytes. Biol Chem
Hoppe Seyler 369, 29–38.

5 Lee CM & Snyder SH (1982) Dipeptidyl-aminopeptidase III of rat brain. Selective affinity for enkephalin
and angiotensin. J Biol Chem 257, 12043–12050.
6 Nishikiori T, Kawahara F, Naganawa H, Muraoka Y,
Aoyagi T & Umezawa H (1984) Production of acetyl-lleucyl-l-argininal, inhibitor of dipeptidyl aminopeptidase III by bacteria. J Antibiot (Tokyo) 37, 680–681.
7 Hazato T, Inagaki-Shimamura M, Katayama T & Yamamoto T (1982) Separation and characterization of a
dipeptidyl aminopeptidase that degrades enkephalins
from monkey brain. Biochem Biophys Res Commun 105,
470–475.
8 Shimamori Y, Watanabe Y & Fujimoto Y (1986) Purification and characterization of dipeptidyl aminopeptidase III from human placenta. Chem Pharm Bull
(Tokyo) 34, 3333–3340.

FEBS Journal 277 (2010) 1861–1875 ª 2010 The Authors Journal compilation ª 2010 FEBS

1873


Ets-1 ⁄ Elk-1 key regulators of DPP-III transcription

A. A. Shukla et al.

9 Hashimoto J, Yamamoto Y, Kurosawa H, Nishimura
K & Hazato T (2000) Identification of dipeptidyl peptidase III in human neutrophils. Biochem Biophys Res
Commun 273, 393–397.
10 Watanabe Y, Kumagai Y & Fujimoto Y (1990)
Presence of a dipeptidyl aminopeptidase III in Saccharomyces cerevisiae. Chem Pharm Bull (Tokyo) 38,
246–248.
11 Mazzocco C, Fukasawa KM, Auguste P & Puiroux J
(2003) Characterization of a functionally expressed dipeptidyl aminopeptidase III from Drosophila melanogaster. Eur J Biochem 270, 3074–3082.
12 Baral PK, Jajcanin-Jozic N, Deller S, Macheroux P,
Abramic M & Gruber K (2008) The first structure of

dipeptidyl-peptidase III provides insight into the catalytic mechanism and mode of substrate binding. J Biol
Chem 283, 22316–22324.
13 Abramic M, Schleuder D, Dolovcak L, Schroder W,
Strupat K, Sagi D, Peter-Katalini J & Vitale L (2000)
Human and rat dipeptidyl peptidase III: biochemical
and mass spectrometric arguments for similarities and
differences. Biol Chem 381, 1233–1243.
14 Sato H, Kimura K, Yamamoto Y & Hazato T (2003)
Activity of DPP-III in human cerebrospinal fluid
derived from patients with pain. Masui 52, 257–263.
15 Simaga S, Babic D, Osmak M, Sprem M & Abramic M
(2003) Tumor cytosol dipeptidyl peptidase III activity
is increased with histological aggressiveness of
ovarian primary carcinomas. Gynecol Oncol 91,
194–200.
16 Smyth M & O’Cuinn G (1994) Dipeptidyl aminopeptidase activities of guinea-pig brain. Int J Biochem 26,
913–921.
17 Zhu J, He F, Hu S & Yu J (2008) On the nature
of human housekeeping genes. Trends Genet 24,
481–484.
18 Rao NV, Rao GV & Hoidal JR (1997) Human dipeptidyl-peptidase I. Gene characterization, localization,
and expression. J Biol Chem 272, 10260–10265.
19 Bohm SK, Gum JR Jr, Erickson RH, Hicks JW & Kim
YS (1995) Human dipeptidyl peptidase IV gene promoter: tissue-specific regulation from a TATA-less
GC-rich sequence characteristic of a housekeeping gene
promoter. Biochem J 311(Pt 3), 835–843.
20 Ellis S & Nuenke JM (1967) Dipeptidyl arylamidase III
of the pituitary. Purification and characterization. J Biol
Chem 242, 4623–4629.
21 Mohamed MM & Sloane BF (2006) Cysteine cathepsins: multifunctional enzymes in cancer. Nat Rev Cancer

10, 764–775.
22 Sehgal A, Patil N & Chao M (1988) A constitutive promoter directs expression of the nerve growth factor
receptor gene. Mol Cell Biol 8, 3160–3167.
23 Nilsson MH, Spurr NK, Lundvall J, Rask L &
Peterson PA (1988) Human cellular retinol-binding

1874

24

25

26

27

28

29

30

31

32

33

34

protein gene organization and chromosomal location.
Eur J Biochem 173, 35–44.
Karantzoulis-Fegaras F, Antoniou H, Lai SL, Kulkarni
G, D’Abreo C, Wong GK, Miller TL, Chan Y, Atkins
J, Wang Y et al. (1999) Characterization of the human
endothelial nitric-oxide synthase promoter. J Biol Chem
274, 3076–3093.
Zenzie-Gregory B, O’Shea-Greenfield A & Smale ST
(1992) Similar mechanisms for transcription initiation
mediated through a TATA box or an initiator element.
J Biol Chem 267, 2823–2830.
Hoopes BC, LeBlanc JF & Hawley DK (1992) Kinetic
analysis of yeast TFIID–TATA box complex formation
suggests a multi-step pathway. J Biol Chem 267, 11539–
11547.
Carcamo J, Buckbinder L & Reinberg D (1991) The initiator directs the assembly of a transcription factor IIDdependent transcription complex. Proc Natl Acad Sci
USA 88, 8052–8056.
Yoo W, Martin ME & Folk WR (1991) PEA1 and
PEA3 enhancer elements are primary components of
the polyomavirus late transcription initiator element.
J Virol 65, 5391–5400.
Hagemeier C, Bannister AJ, Cook A & Kouzarides T
(1993) The activation domain of transcription factor
PU.1 binds the retinoblastoma (RB) protein and the
transcription factor TFIID in vitro: RB shows sequence
similarity to TFIID and TFIIB. Proc Natl Acad Sci
USA 90, 1580–1584.
Kitange G, Shibata S, Tokunaga Y, Yagi N, Yasunaga
A, Kishikawa M & Naito S (1999) Ets-1 transcription
factor-mediated urokinase-type plasminogen activator

expression and invasion in glioma cells stimulated by
serum and basic fibroblast growth factors. Lab Invest
79, 407–416.
Kitange G, Tsunoda K, Anda T, Nakamura S, Yasunaga A, Naito S & Shibata S (2000) Immunohistochemical
expression of Ets-1 transcription factor and the urokinase-type plasminogen activator is correlated with the
malignant and invasive potential in meningiomas.
Cancer 89, 2292–2300.
Jayaraman G, Srinivas R, Duggan C, Ferreira E,
Swaminathan S, Somasundaram K, Williams J, Hauser
C, Kurkinen M, Dhar R et al. (1999) p300 ⁄ cAMPresponsive element-binding protein interactions with
ets-1 and ets-2 in the transcriptional activation of the
human stromelysin promoter. J Biol Chem 274,
17342–17352.
Bradford AP, Brodsky KS, Diamond SE, Kuhn LC,
Liu Y & Gutierrez-Hartmann A (2000) The Pit-1
homeodomain and beta-domain interact with Ets-1 and
modulate synergistic activation of the rat prolactin
promoter. J Biol Chem 275, 3100–3106.
Li QJ, Vaingankar S, Sladek FM & Martins-Green M
(2000) Novel nuclear target for thrombin: activation of

FEBS Journal 277 (2010) 1861–1875 ª 2010 The Authors Journal compilation ª 2010 FEBS


Ets-1 ⁄ Elk-1 key regulators of DPP-III transcription

A. A. Shukla et al.

35

36

37

38

the Elk1 transcription factor leads to chemokine gene
expression. Blood 96, 3696–3706.
Brown TA & McKnight SL (1992) Specificities of protein–protein and protein–DNA interaction of GABP
alpha and two newly defined ets-related proteins. Genes
Dev 6, 2502–2512.
Baillat D, Begue A, Stehelin D & Aumercier M (2002)
ETS-1 transcription factor binds cooperatively to the
palindromic head to head ETS-binding sites of the
stromelysin-1 promoter by counteracting autoinhibition.
J Biol Chem 277, 29386–29398.
Ghosh D, Ezashi T, Ostrowski MC & Roberts RM
(2003) A central role for Ets-2 in the transcriptional
regulation and cyclic adenosine 5¢-monophosphate
responsiveness of the human chorionic gonadotropinbeta subunit gene. Mol Endocrinol 17, 11–26.
Nye JA, Petersen JM, Gunther CV, Jonsen MD &
Graves BJ (1992) Interaction of murine ets-1 with

39

40

41

42

GGA-binding sites establishes the ETS domain as a
new DNA-binding motif. Genes Dev 6, 975–990.
Gille H, Kortenjann M, Thomae O, Moomaw C,
Slaughter C, Cobb MH & Shaw PE (1995) ERK
phosphorylation potentiates Elk-1-mediated ternary
complex formation and transactivation. EMBO J 14,
951–962.
Drewett V, Muller S, Goodall J & Shaw PE (2000)
Dimer formation by ternary complex factor ELK-1.
J Biol Chem 275, 1757–1762.
Bradford MM (1976) A rapid and sensitive method for
the quantitation of microgram quantities of protein
utilizing the principle of protein–dye binding. Anal
Biochem 72, 248–254.
Livak KJ & Schmittgen TD (2001) Analysis of relative
gene expression data using real-time quantitative PCR
and the 2(-Delta Delta C(T)) method. Methods 25,
402–408.

FEBS Journal 277 (2010) 1861–1875 ª 2010 The Authors Journal compilation ª 2010 FEBS

1875