Báo cáo khoa học: A new pathway encompassing calpain 3 and its newly identified substrate cardiac ankyrin repeat protein is involved in the regulation of the nuclear factor-jB pathway in skeletal muscle pdf

A new pathway encompassing calpain 3 and its newly
identified substrate cardiac ankyrin repeat protein is
involved in the regulation of the nuclear factor-jB pathway
in skeletal muscle
Lydie Laure*, Nathalie Danie
`
le*, Laurence Suel, Sylvie Marchand, Sophie Aubert,
Nathalie Bourg, Carinne Roudaut, Ste
´
phanie Duguez, Marc Bartoli and Isabelle Richard
Ge
´
ne
´
thon, CNRS UMR8587 LAMBE, Evry, France
Introduction
Calpain 3 is a muscle specific, calcium dependent,
multi-substrate cysteine protease whose mutations are
the cause of limb girdle muscular dystrophy 2A
(LGMD2A, OMIM 253600), a severe muscle disorder
leading to selective atrophy and weakness of proximal
muscles [1,2]. Calpain 3 becomes activated once an
Keywords
calpain 3; cardiac ankyrin repeat protein;
limb girdle muscular dystrophy 2A; NF-jB;
skeletal muscle; titin
Correspondence
I. Richard, Ge
´
ne
´

thon, CNRS UMR8587
Lambe, 1 bis rue de l’Internationale, 91000
Evry, France
Fax: +33 (0) 1 60 77 86 98
Tel: +33 (0) 1 69 47 29 38
E-mail:
*These authors contributed equally to this
work
(Received 1 June 2010, revised 11 August
2010, accepted 18 August 2010)
doi:10.1111/j.1742-4658.2010.07820.x
A multiprotein complex encompassing a transcription regulator, cardiac
ankyrin repeat protein (CARP), and the calpain 3 protease was identified
in the N2A elastic region of the giant sarcomeric protein titin. The present
study aimed to investigate the function(s) of this complex in the skeletal
muscle. We demonstrate that CARP subcellular localization is controlled
by the activity of calpain 3: the higher the calpain 3, the more important
the sarcomeric retention of CARP. This regulation would occur through
cleavage of the N-terminal end of CARP by the protease. We show that,
upon CARP over-expression, the transcription factor nuclear factor NF-jB
p65 DNA-binding activity decreases. Taken as a whole, CARP and its reg-
ulator calpain 3 appear to occupy a central position in the important cell
fate-governing NF-jB pathway. Interestingly, the expression of the atro-
phying protein MURF1, one of NF-jB main targets, remains unchanged
in presence of CARP, suggesting that the pathway encompassing cal-
pain3 ⁄ CARP ⁄ NF-jB does not play a role in muscle atrophy. With NF-jB
also having anti-apoptotic effects, the inability of calpain 3 to lower
CARP-driven inhibition of NF-jB could reduce muscle cell survival, hence
partly accounting for the dystrophic pattern observed in limb girdle muscu-
lar dystrophy 2A, a pathology resulting from the protease deficiency.

Structured digital abstract
l
MINT-7990388: Titin (uniprotkb:Q8WZ42) physically interacts (MI:0915) with CARP (uni-
protkb:
Q9CR42)bytwo hybrid (MI:0018)
l
MINT-7990374: calpain 3 (uniprotkb:P20807) physically interacts (MI:0915) with Titin (uni-
protkb:
Q8WZ42)bytwo hybrid (MI:0018)
l
MINT-7990342: calpain 3 (uniprotkb:P20807) physically interacts (MI:0915) with CARP (uni-
protkb:
Q9CR42)bytwo hybrid (MI:0018)
Abbreviations
Ankrd2, ankyrin repeat domain-containing protein 2; CARP, cardiac ankyrin repeat protein; DARP, diabetes-related ankyrin repeat protein;
FRAP, fluorescence recovery after photobleaching; GFP, green fluorescent protein; MARP, muscle ankyrin repeat proteins; NF, nuclear factor;
NLS, nuclear localization signals; qRT-PCR, quantitative RT-PCR; ROI, region of interest; TA, tibialis anterior; YFP, yellow fluorescent protein.
4322 FEBS Journal 277 (2010) 4322–4337 ª 2010 The Authors Journal compilation ª 2010 FEBS
internal propeptide is removed from its active site by
an auto-proteolytic process [3]. Although the large
majority of the substrates identified are structural pro-
teins [3–5], proteins involved in cell metabolism [5–7]
and in the regulation of gene and protein expression
[2,7–9] were also suggested to be potential calpain 3
substrates. Taken together, the ensuing cleavages were
proposed to play a role in three major physiological
processes: the orchestration of sarcomere remodeling
[10–12], the control of apoptosis [9,13] and the regula-
tion of gene expression [2,7–9].
Calpain 3 is found in several different subcellular

localizations within the muscle fiber, notably in associa-
tion with three regions of titin, a giant structural protein
spanning half the sarcomere [3,14,15]. Two of these
regions, the N2A region and the M line, are involved in
the transmission of mechanical signals to signaling path-
ways. In the M line, mechanical stimulation activates
the interaction of a protein complex with the kinase
domain of titin, reducing the nuclear translocation of
the transcription factor SRF and impeding gene tran-
scription [16]. In the elastic N2A region, mechanical
activity stimulates the expression of the muscle ankyrin
repeat proteins (MARPs), a family of gene expression
regulators [17,18]. Passive stretch also induces a subcel-
lular redistribution of the MARPs, suggesting a titin-
N2A-mediated link between stress signals and gene
expression [18]. The MARP family is composed of three
proteins, ankyrin repeat domain-containing protein 2
(Ankrd2), cardiac ankyrin repeat protein (CARP) and
diabetes-related ankyrin repeat protein (DARP),
grouped together with respect to their common minimal
structure and their potential role in the control of tran-
scription [17,19–21]. Although the three MARPs are
expressed in both heart and skeletal muscle [18,22,23],
Ankrd2 is mainly expressed in skeletal muscle [18,24,25],
CARP in the heart [18,21,26–28] and DARP in equiva-
lent amounts in both tissues [20].
Interestingly, Ankrd2 was previously suggested to be
cleaved by calpain 3 [29] but CARP, which was shown
to be the first MARP whose expression increases in
response to exercise in skeletal muscle [30], was not

assessed as a substrate. The structure of CARP com-
prises several ankyrin-like repeats, PEST motifs (i.e.
regions of protein instability rich in proline, glutamic
acid, serine and threonine) and putative nuclear locali-
zation signals (NLS) [18,19,26,28]. In the heart, CARP
expression increases in remodeling conditions associ-
ated with pathological hypertrophy [31–34]. In the skel-
etal muscle, CARP expression is low under basal
conditions but was reported to be induced in several
conditions such as exercise [30,35–38], atrophy [26] and
muscle pathologies [39–43]. From a molecular point of
view, CARP is known to act as a transcriptional regula-
tor. Indeed, CARP can bind to DNA [19] and inhibits
the transcription of MLC-2V by association with the
transcription factor YB1 in the heart [21].
Considering that (a) a molecular complex encom-
passes calpain 3 and CARP in the N2A elastic region
[18]; (b) exercise stimulates both calpain 3 activity [44]
and CARP expression [30] in skeletal muscle; (c) cal-
pain 3 was previously suggested to cleave unidentified
regulators of transcription [9]; and (d) a member of
the MARP family was previously demonstrated to be
cleaved by calpain 3 [29], the present study aimed to
identify the possible functional relationship(s) between
CARP and calpain 3 and the physiological pathway(s)
under control. We first showed that calpain 3 cleaves
CARP in vitro. Once cleaved, the long C-terminal part
of CARP is more efficiently bound to titin, possibly
impeding CARP nuclear translocation and any subse-
quent gene expression regulation. In addition, we dem-

onstrated that CARP regulates the transcriptional
activities of several transcription factors, including
nuclear factor NF-jB p65. Together, CARP and con-
sequently calpain 3 appear to have a central role in the
regulation of the important cell fate-governing NF-jB
pathway.
Results
CARP is a substrate of calpain 3
Considering the sarcomeric localization of both CARP
and calpain 3 and the fact that calpain 3 cleaves
another member of the MARPs family, the possibility
that CARP could be processed by active calpain 3 was
investigated. A direct, in vitro digestion of CARP by
calpain 3 using recombinant proteins could not be
attempted because calpain 3 is inactivated during purifi-
cation [45]. In skeletal muscle cells, calpain 3 is consid-
ered to be inactive until specific signals trigger its
dissociation from a muscle specific inhibitor [46]. We
therefore tested our hypothesis using ectopic gene
expression in non muscular cells, the only system lead-
ing to uncontrolled activation of calpain 3. NIH-3T3
fibroblasts were transfected with expression plasmids
encoding CARP (pcDNA-CARP-V5) in the presence
of wild-type or catalytically-inactive C129S-mutated
calpain 3 (encoded by pYFP-C3-CFP and pYFP-C3-
C129S-CFP, respectively). The activation of the protease
was confirmed by the appearance of an autolysis band
at approximately 55 kDa on a calpain-specific western
blot (Fig. 1A). CARP detection was performed using an
antibody raised against the C-terminal V5 epitope. In

the presence of the protease-dead C129S calpain 3,
L. Laure et al. Regulation of CARP by calpain 3
FEBS Journal 277 (2010) 4322–4337 ª 2010 The Authors Journal compilation ª 2010 FEBS 4323
CARP migrates at an apparent molecular weight of
approximately 40 kDa. A lower band is clearly visible
in the presence of wild-type calpain 3 (37 kDa for the
shorter form), demonstrating that CARP is cleaved in
the presence of calpain 3 in vitro (Fig. 1A).
CARP and calpain 3 interaction was tested using
yeast two-hybrid experiments. Because the ectopic
expression of wild-type calpain 3 leads to uncontrolled
proteolysis, a construct encoding catalytically inactive
calpain 3 fused to GAL 4 binding domain (pAS-C3)
was used as a bait and a construct encoding CARP
fused with the activation domain (pGAD-CARP) was
used as a prey. The yeasts resulting from the mating of
clones transformed with either calpain 3 or CARP
grow on Leu-Trp-His- selection medium, indicating
that calpain 3 and CARP interact (Fig. 1B). The fact
that calpain 3 interacts directly with CARP supports
the idea that the cleavage is direct.
Efforts to identify CARP cleavage site by protein
sequencing were unsuccessful. We therefore con-
structed several N-terminal truncated forms of CARP
(pDNter1, pDNter2, pDNter3 and pDNter4; see Materi-
als and methods) with respect to the different domains
of this protein (Fig. 1C). First, after expression in
NIH3T3, their migration patterns were compared by
immunoblotting with the profiles observed upon cal-
pain 3 mediated-CARP cleavage (Fig. 1D). The plas-

mid pDNter2 produces a band that matches exactly
CARP cleaved C-terminal fragment (with an apparent
molecular weight of 37 kDa on SDS ⁄ PAGE). Second,
the migration patterns of CARP, DNter1 or DNter2 in
presence or absence of calpain 3 were compared
(Fig. 1E). Although DNter1 is cleaved when co-
expressed with calpain 3, DNter2 remains unchanged
(Fig. 1E), suggesting that the position of the cleavage
site is between amino acids 30 and 71. Interestingly, in
this region, three overlapping sequences fit the poten-
tial consensus recently reported for calpain 3 cleavage
sites almost perfectly (Fig. 1C, bottom) [47]. Since
these sequences are localized between amino acids 65
and 88 and the cleavage site is localized before amino
acid 71, the region of cleavage would be between
amino acids 65 and 71. Considering the location of the
N-terminal extremity of DNter2 on the structure of
CARP and the presence of the potential cleavage sites,
we identified the localization of the cleavage site within
a predicted coiled-coil domain (Fig. 1B).
Calpain 3-mediated CARP cleavage strengthens
its interaction with titin N2A
A core and a bipartite NLS were previously identified
around the CARP cleavage site within the coiled-coil
region (positions 71–74 and 59–76) [28]. We therefore
investigated whether calpain 3 activity could influence
CARP subcellular localization. Plasmids encoding fluo-
rescent fusion-proteins corresponding to CARP before
and after cleavage by calpain 3 (pYFP-CARP-CFP-
HIS, pYFP-DNter2-CFP-HIS and pYFP-Nter-CFP-

HIS) were injected and transferred by electroporation
in tibialis anterior (TA) muscles of 129SvPasIco wild-
type mice. Seven days later, the muscles were exposed
and submitted to direct observation using a confocal
microscope and an excitation wavelength of 514 nm
for yellow fluorescent protein (YFP) emission. The set-
ting for the CFP emission (excitation wavelength of
457 nm) was also attempted, but the fluorescence was
much weaker than YFP and the images were blurry,
impeding their analysis. We therefore used YFP fluo-
rescence only for further analysis.
Fig. 1. CARP is a substrate of calpain 3. (A) Western blot analysis performed on NIH3T3 extracts over-expressing V5-tagged CARP in the
presence of either wild-type or C129S-mutated calpain 3. The appearance of a 37-kDa CARP proteolytic fragment shows that CARP is
cleaved in presence of active calpain (V5 specific staining; upper panel). The activation of calpain 3 is verified by the detection of the 58 and
55 kDa autolysis fragments (calpain 3 specific staining; lower panel). (B) Yeast two-hybrid assessment of calpain 3-CARP interaction. The
calpain 3 construct was mutated on its active site to prevent uncontrolled proteolysis. Yeasts resulting from the mating of clones trans-
formed with calpain 3 or CARP were grown on Trp-Leu- (control medium; lower panels) or Trp-Leu-His- medium (selective medium; upper
panels). As a positive control, an interaction test of calpain 3 and N2A-titin is performed (upper left panel). The yeasts carrying calpain 3 and
CARP grow on the selective medium, indicating that CARP and calpain 3 interact (upper middle panel). (C) Schematic representation of
CARP structure (top) and sequence (bottom) indicating the presence of two PEST domains (light gray colored box), a coiled-coil region (gray
colored box), five ankyrin repeats (five dark gray boxes), two core NLS (in red) and a bipartite NLS (in yellow; the bipartite NLS encompass-
ing one of the core NLS). The region of interaction with titin-N2A is highlighted in bold ⁄ blue, as well as by bold ⁄ blue underlined characters
in the sequence. The consensus site for calpain 3 cleavage and the positions of the three imperfect cleavage sequences identified in CARP
are shown at the bottom. The truncated constructs (DNter1-4 and NterCARP) are shown below the CARP structure and the calpain 3 cleav-
age site is indicated by an arrow. (D) Western blot analysis performed on NIH3T3 extracts over-expressing either the full-length or the trun-
cated CARP constructs (DNter1–4). The molecular weight of DNter2 matches the lower band detected when CARP is co-expressed with
calpain 3 (37 kDa band; compare the first and the fourth lane). (E) Western blot analysis performed on NIH3T3 extracts over-expressing
CARP or the truncated DNter1 or DNter2 CARP constructs, in the presence or absence of calpain 3. DNter1 is cleaved when co-expressed
with calpain 3, whereas DNter2 is not.
Regulation of CARP by calpain 3 L. Laure et al.

4324 FEBS Journal 277 (2010) 4322–4337 ª 2010 The Authors Journal compilation ª 2010 FEBS
The staining for pYFP-CARP-CFP-HIS clearly
demonstrated a mixed nuclear and cytoskeletal pattern
(Fig. 2A; note the striated pattern of fluorescence at
higher magnification, lower left panel), as previously
found in heart cells, where it was initially identified as
a partner of skeletal muscle titin-N2A [18]. An analysis
of CARP expression in the subcellular compartments
obtained from the muscle of the mice injected with
pYFP-CARP-CFP-HIS confirms the presence of the
protein in the nucleus and on the cytoskeletal fraction
(Fig. 2B). Because we also confirmed using a two-
hybrid assay that CARP is able to interact with titin-
N2A (Fig. 2D, top left panel), the fluorescent cytoskel-
etal staining most likely corresponds to the sarcomeric
L. Laure et al. Regulation of CARP by calpain 3
FEBS Journal 277 (2010) 4322–4337 ª 2010 The Authors Journal compilation ª 2010 FEBS 4325
location of titin-N2A. In the nucleus, a spotted pattern
is clearly distinguished at very high magnification, sug-
gesting that CARP is localized into a very peculiar, yet
unidentified, nuclear subcompartment (Fig. 2A, lower
right panel). This pattern is reminiscent of the PML
bodies, a compartment in which Ankrd2 has previously
been observed [17]. The localization of pYFP-DNter2-
CFP-HIS is undistinguishable from the pYFP-CARP-
CFP-HIS localization (Fig. 2C, upper panel). By
contrast, the short fragment CARP-Nter has a very
different localization pattern. Indeed, its expression is
scattered throughout the fiber without any sarcomeric
pattern, and it does not translocate into the nucleus

(Fig. 2C, lower panel). This undefined localization,
taken together with the absence of physiologically rele-
vant protein domains in this region, suggests that this
fragment is probably devoid of biological activity.
To further investigate the possibility of translocation
in between various cell compartments, the strength of
the interaction between CARP and the muscle sarco-
mere was assessed in vitro using a two-hybrid assay and
in vivo using fluorescence recovery after photobleaching
(FRAP). Two-hybrid experiments were carried out
between yeast competent cells transformed either with
pAS-N2A-titin fused with GAL4-binding domain or
pGAD-CARP or DNter2 fused with GAL4-activation
domain. The growth of the clones is more important
when titin-N2A is expressed with DNter2, suggesting
that the weak interaction detected between CARP and
titin-N2A is reinforced after CARP cleavage (Fig. 2D).
FRAP analysis is commonly used to quantify the
mobility of a fluorescent molecule in a cell compart-
ment of interest [48]. FRAP experiments were carried
out after injection of pYFP-CARP-CFP-HIS, pYFP-
DNter2-CFP-HIS or pYFP-Nter-CFP-HIS in the TA
of 129SvPasIco mice. The fluorescence recovery speed
observed in the presence of the Nter protein is so rapid
that we could not even bleach a region of interest
(ROI) efficiently, impeding FRAP measurement (data
not shown). This result suggests that the short N-ter-
minal CARP fragment is freed from the sarcomere,
which is consistent with the results obtained by direct
localization of the fluorescence and with the fact that

this fragment does not bear the binding site for titin-
N2A (Fig. 1C). After photobleaching, the recovery
speed of DNter2 is significantly slower than the recov-
ery speed of CARP, suggesting that the long C-termi-
nal CARP fragment is more efficiently bound to titin
after cleavage by calpain 3 (P < 0.01; Fig. 2E). It is
worth noting that, in skeletal muscle, an endogenous
inhibitor maintains calpain 3 in an inactive state until
a signal, such as eccentric exercise [44], activates its
proteolytic functions. As a result, after 7 days of
expression in 129SvPasIco mice, only a minor propor-
tion of the CARP substrate is cleaved, as indicated by
the clear sarcomeric pattern (Fig. 2A, upper left panel).
Considering that the weak proportion of YFP-Nter
protein resulting from the cleavage cannot be bleached,
the comparison of the FRAP results obtained with
CARP or DNter2 in wild-type animals does not take
into account anything else other than the motilities of
these proteins. These results suggest that, once cleaved
by calpain 3, the C-terminal region of CARP binds
more efficiently to the sarcomeric N2A region, possibly
reducing CARP nuclear translocation.
Because CARP was previously suggested to be able
to form a dimer [49], we aimed to determine whether
the cleavage of a molecule of CARP could affect the
sarcomeric binding of another uncleaved CARP mole-
cule. Accordingly, we compared CARP subcellular
localization in the presence or absence of calpain 3
using a new calpain 3 knockout mouse model (C3-
null) generated by disruption of the calpain 3 gene

using homologous recombination (Figs S1 and S2 and
Doc. S1). Although a weak quantity of calpain 3
mutated mRNA is still expressed (< 20% of the wild-
type level) (Fig. S1B), western blot analysis confirmed
the complete knockout of the protein in this murine
model (Fig. S1C). CARP subcellular localization and
mobility were assessed after injection of a plasmid
encoding pYFP-CARP-CFP-HIS in the TA muscles of
C3-null and 129SvPasIco strains. Since CARP will not
be processed by calpain 3 in C3 deficient animals and
will only be slightly processed in wild-type animals,
the full-length CARP protein is therefore the main
YFP-tagged protein present in both cases. With
respect to CARP localization, no significant difference
was noted: in both models, CARP is localized in the
nucleus, as well as on the fiber sarcomere, easily recog-
nizable by the striated pattern of the fluorescence
(Fig. 3A). In FRAP experiments (Fig. 3B), the fluores-
cence recovery speed is significantly slower in wild-
type muscles than in calpain 3 deficient muscles
(Fig. 3C), suggesting that the interaction between
CARP and titin is reinforced in the presence of cal-
pain 3. These results suggest that the calpain 3-medi-
ated cleavage of some molecules of CARP reinforces
the interaction of other unprocessed CARP molecules
with the sarcomere.
Taken together, the results obtained in the present
study appear to corroborate that, once cleaved by cal-
pain 3, the C-terminal part of CARP, as well as
unprocessed CARP molecules, bind more efficiently to

titin N2A, which is consistent with the fact that CARP
nuclear translocation could be controlled by calpain 3
activity.
Regulation of CARP by calpain 3 L. Laure et al.
4326 FEBS Journal 277 (2010) 4322–4337 ª 2010 The Authors Journal compilation ª 2010 FEBS
In vitro, CARP can act as a regulator of
transcription factors activity in the nucleus
Considering that CARP is a known regulator of tran-
scription in the heart, we investigated the possibility
that CARP might play a similar role on gene regula-
tion in skeletal muscle. The DNA binding activities
of nuclear proteins from C2 myotubes transfected
either with pcDNA3-CARP or with a mock vector
(pcDNA3-lacZ) were compared using a membrane-
based analysis (protein ⁄ DNA array) of a set of 345
pre-selected transcription factors. Sixty-eight transcrip-
tion factors appear to be regulated by CARP (cut-off
ratio CARP ⁄ lacZ < 0.6 or > 1.3). Apart from pax5,
Fig. 2. CARP cleavage strengthens its interaction with the titin N2A region. (A) Localization of YFP-CARP in the mouse TA after electrotrans-
fer. CARP is localized both on the sarcomere (lower left panel) and in the nucleus (lower right panel) of the fibers. Scale bars = 20 lm. (B).
Analysis of CARP expression in subcellular compartments of TA transduced by YFP-CARP (detection by GFP-specific western blot) confirms
that CARP is present on the cytoskeleton and the nucleus in skeletal muscle. (C) Localization of YFP-DNter2 and YFP-Nter in the mouse TA
after electrotransfer. Similar to CARP, D Nter2 is localized on the sarcomere and in the nucleus (upper panel), whereas the Nter-CARP fluo-
rescence (lower panel) is scattered throughout the fiber. (D) Yeast two-hybrid assay of the interaction of titin with CARP or DNter2. Yeasts
resulting from the mating of clones transformed with titin or CARP were grown on Trp-Leu- (lower panels, control medium) or Trp-Leu-His-
medium (upper panels, selective medium). On the selective medium, the yeasts carrying titin and DNter2 grow more than the yeasts carry-
ing titin and CARP, suggesting that, once cleaved, the association of the long C-terminal fragment of CARP and titin is reinforced. (upper
panels). (E) Quantification of FRAP experiments. FRAP was measured in several ROI after photobleaching at 514 nm in mouse TA trans-
duced with YFP-tagged CARP or DNter2. The fluorescence recovery speed is slower when CARP is truncated (i.e. slower in the presence of
the DNter2 construct compared to the CARP construct) (**P < 0.01, n = 12).

L. Laure et al. Regulation of CARP by calpain 3
FEBS Journal 277 (2010) 4322–4337 ª 2010 The Authors Journal compilation ª 2010 FEBS 4327
whose DNA-binding activity is slightly elevated in the
presence of CARP (on one out of the two consensus
sequences considered), all the other transcription fac-
tors are inhibited (Fig. 4A). The 32 factors most signif-
icantly inhibited (cut-off ratio CARP⁄ lacZ < 0.5) are
presented schematically in Fig. S3. Although its inhibi-
tion does not reach this level with this quantification
method, the activity of the transcription factor NF-jB,
as measured with three different consensus sequences,
is consistently repressed. This transcription factor
appeared to be particularly interesting considering that
it was previously described as having a role in muscle
atrophy [50] and is abnormally distributed subsequent
to calpain 3 deficiency [8].
Using a quantitative ELISA-based method, we con-
firmed that, when CARP is significantly over-expressed
by two-fold, NF-jB p65 transcriptional activity is sig-
nificantly decreased two-fold (P < 0.05; Fig. 4B).
Using the quantification of its messenger level on
RNA extracts of the same cells, we confirmed that this
transcription factor is not transcriptionally regulated
(Fig. 4C) and concluded that its nuclear translocation
or its activity is modulated by CARP. We also
performed real-time quantitative RT-PCR (qRT-PCR)
of MuRF1, an E3 ubiquitin ligase whose transcription
is up-regulated through NF-jB activation in atrophic
muscle fibers [51–53]. Interestingly, MuRF1 expression
remains constant in this experiment, strongly suggest-

ing that the corresponding signaling pathway regulated
by NF-jB does not involve this protein (Fig. 4D).
Discussion
In the present study, we provide new insights into the
regulation and function of the molecular complex
encompassing CARP and calpain 3 in the N2A region.
We identified CARP as a new calpain 3 substrate.
Interestingly, this cleavage regulates CARP subcellular
localization by increasing the strength of its interaction
with the sarcomere. In addition, we investigated the
modification of transcription factor activities induced
by CARP over-expression and demonstrated CARP-
induced regulation of NF-jB activity.
Even though CARP bears two potential PEST insta-
bility regions, its cleavage does not occur in any of
these sequences but takes place in a strongly structured
coiled-coil region [49]. A core and a bipartite NLS
were previously predicted to be encoded in this region,
the bipartite NLS encompassing the core NLS
(Fig. 1B) [28]. It should be noted that an additional
core NLS is present downstream of this region (posi-
tion 94–98; Fig. 1B) [19,28,54]. Cleavage by calpain 3
would theoretically disrupt the bipartite NLS and leave
the two core NLS intact on CARP C-terminal region.
The N-terminal region liberated by the cleavage has no
NLS left and is consistently never observed inside the
nucleus. However, it is possible that the loss of one
NLS in the C-terminal fragment affects the nuclear
transport of this form of CARP, although the sensitiv-
ity of the methods we used could not confirm this

hypothesis.
The results obtained in the present study strongly
suggest that, once cleaved, CARP interaction with the
region N2A is reinforced. CARP interacts with titin-
N2A using a region situated in its second ankyrin
repeat (Fig. 1B) [18]. Bio-informatics analysis indicated
that this region remains structurally unaffected by the
cleavage, whereas the coiled-coil region appears to be
destructed (for methodology, see Materials and meth-
ods). In addition to carrying NLS, this region was
previously proposed to be involved in the homodi-
merization of CARP [49]. We therefore propose that
the loss of CARP dimerization promotes the binding to
titin by improving the accessibility of the titin-binding
domain. Interestingly, the importance of CARP inter-
action for its function was recently demonstrated in a
Fig. 3. Calpain 3 produces a reinforcement of CARP interaction
with titin. (A) CARP localization after electrotransfer of YFP tagged
CARP in TA muscles from wild-type (left) and C3-null (right) mice.
In both models, CARP is localized in the nucleus and on the sarco-
mere of the fibers. Scale bars = 20 lm. (B) Quantification of FRAP
experiments. FRAP was measured for several ROI after photoble-
aching at 514 nm in TA muscles from wild-type and C3-null mice
transduced with YFP-tagged CARP. The fluorescence recovery
speed is slower in muscles of animals bearing functional calpain 3
(**P < 0.01, n = 10).
Regulation of CARP by calpain 3 L. Laure et al.
4328 FEBS Journal 277 (2010) 4322–4337 ª 2010 The Authors Journal compilation ª 2010 FEBS
pathophysiological context since pathogenic mutations
result in the loss of CARP binding to talin and FHL2

and, consequently, in the perturbation of its function
[55].
Regulation of function through the control of sub-
cellular localization represents novel information for
a member of the calpain family, although it was
previously described for other proteases such as casp-
ases [56]. Several different subcellular traffic mechanisms
controlling transcription are known to be controlled by
protein cleavage. In particular, the liberation and
nuclear translocation of transcription factors can be
triggered by proteasome-mediated degradation of a
partner, as exemplified by the prototypical regulation of
Fig. 4. In vitro, CARP can act as a regulator of transcription factors activity in the nucleus. (A) Effect of CARP on the DNA-binding activities
of 345 transcription factors. DNA-binding activities were measured on nuclear extracts of C2 myotubes over-expressing either CARP or lacZ
(control). Black boxes highlight the 32 transcription factors that were most significantly inhibited (cut-off ratio CARP ⁄ lacZ < 0.5). Although
less severely, the DNA-binding activity of NF-jB is also inhibited (single white boxes indicate NF-jB DNA-binding activities measured on
three different consensus sequences). Pax5 is the only factor whose DNA-binding activity is slightly elevated (double white boxes). (B) Quan-
tification of NF-jB DNA-binding activities in C2 myotubes over-expressing CARP. The DNA-binding activity of the NF-jB isoform p65 is sig-
nificantly inhibited when CARP is over-expressed. (*P < 0.05, n = 3). (C) Real-time quantification of the mRNA level of NF-jB p65 in
myotubes over-expressing CARP. The gene expression of NF-jB p65 does not vary with CARP over-expression (n = 3). (D) Real-time quanti-
fication of the mRNA level of MuRF1 in myotubes over-expressing CARP. The gene expression of MURF1 does not vary with CARP over-
expression (n = 3).
L. Laure et al. Regulation of CARP by calpain 3
FEBS Journal 277 (2010) 4322–4337 ª 2010 The Authors Journal compilation ª 2010 FEBS 4329
the factor NF-jB by the protein IjBa [57]. Addition-
ally, the transmembrane receptor Notch is the target
of ligand-dependent proteolysis and one of the frag-
ments released migrate into the nucleus to regulate
gene expression [58]. The results reported in the pres-
ent study illustrate a novel mechanism of gene regula-

tion through nuclear translocation inhibition,
combining the destruction of an NLS with an increase
in the affinity of the targeted gene regulator for one of
its partners.
The sarcomeric sequestration consecutive to calpain
3 activation might, as a consequence, control CARP-
dependent gene expression. Indeed, MARPs are con-
sidered to be involved in gene transcription because (a)
Ankrd2 localizes in euchromatin, the region of chro-
matin where active gene transcription occurs [59], is
able to bind to three transcription factors, YB-1, PML
and p53, and enhances the up-regulation of the
p21(WAFI ⁄ CIPI) promoter by p53 [17] and (b) CARP
can bind to DNA [19] and is a negative regulator of
the transcription factor YB1 in the heart [21]. Interest-
ingly, calpain 3 was also reported to participate in the
control of gene expression [2,7–9], suggesting that the
complex calpain 3 ⁄ CARP might comprise an axis for
gene regulation. Amongst the possible CARP targets
identified in the present study, NF-jB p65 DNA bind-
ing activity was confirmed to be inhibited by CARP
over-expression. Interestingly, we previously demon-
strated that calpain 3 possibly participates in the
control of the NF-jB pathway because calpain 3
deficiency is associated with an altered distribution of
both NF-jB and of its regulator IjBa [8], as well as
with blockade of the induction of specific anti-apopto-
tic NF-jB target genes such as c-FLIP [9]. From a
mechanistic point of view, it could be postulated that a
direct interaction between CARP ankyrin repeats and

NF-jB p65 is the cause of a cytoplasmic sequestration
(and hence inhibition) of NF-jB, similar to IjB which
associates through its ankyrin repeats with NF-jB
[60]. However, CARP could also act upstream of a sig-
naling cascade controlling directly NF-jB activity as
the transcription factor is now known to be regulated
by both phosphorylation and acetylation [61]. Interest-
ingly, it was previously reported that the inhibition of
the NF-jB pathway during the induction of apoptosis
induces CARP upregulation, suggesting that a positive
feedback mechanism could exacerbate this phenome-
non [62]. On the other hand, a recent study shows that
the stimulation of NF-jB activity by skeletal muscle
longitudinal stretch up-regulates Ankrd2 expression
through direct stimulation of its promoter [63]. Taken
together, these studies suggest that the NF-jB pathway
might be a key differential regulator of the expression
of the MARPs. This differential regulation might be
necessary to tune muscle signaling pathways with pre-
cision in response to various physiological stimuli.
Under which conditions the pathway identified in
the present study is physiologically relevant and how
its dysfunction participates in the pathogenesis of
LGMD2A represent two important issues that remain
to be addressed. The NF-jB pathway is a key regula-
tor of numerous cellular events, such as proliferation
and differentiation, and catabolic or apoptotic path-
ways, in many organs. In particular, it was previously
established that NF-jB is a major inducer of muscle
atrophy in the skeletal muscle. Indeed, NF-jB inhibi-

tion in mice models invariably protects against muscle
atrophy, whereas NF-jB activation promotes proteoly-
sis in vivo [51,64–66]. However, in our hands, although
the over-expression of CARP in muscle cells results in
NF-jB p65 inhibition, it does not affect the expression
of MURF1, which is one of the main mediators of
NF-jB-dependent muscle atrophy [51]. It was also pre-
viously suggested that p65 is not the member of the
NF-jB family involved in the induction of atrophy
[64]. Taken together, CARP-dependent NF-jB inhibi-
tion therefore appears unlikely to play a role in muscle
atrophy. On the other hand, several studies have sug-
gested a possible involvement of NF-jB in muscle cell
survival through induction of anti-apoptotic factors
[8,9,67]. Calpain 3 deficiency was previously reported
to be associated with a deregulation of the NF-jB
pathway and an increase in muscle fiber apoptosis [8].
The participation of NF-jB signaling in the pathogen-
esis of LGMD2A is therefore an interesting possibility.
The findings obtained in the present study lead to a
proposed working hypothesis: in the absence of calpain
3, CARP nuclear activities would be exacerbated,
which would lead to a decrease in NF-jB activity
(Fig. S4). NF-jB inhibition would impede the protec-
tion of muscle from apoptosis, an event leading to
progressive muscle destruction. In line with this
hypothesis, CARP ectopic expression was previously
reported to be able to induce apoptotic cell death in
hepatoma cells [62]. In conclusion, calpain 3, through
its action on CARP, appears to have a central role in

regulating important cell fate-governing pathways.
Materials and methods
Plasmid constructions and antibodies
The sequences encoding full-length DNter1-4 and Nter
CARP were amplified by PCR on a random primed cDNA
library obtained by reverse transcription of murine
129SVter skeletal muscle RNA (primers indicated in
Regulation of CARP by calpain 3 L. Laure et al.
4330 FEBS Journal 277 (2010) 4322–4337 ª 2010 The Authors Journal compilation ª 2010 FEBS
Table 1). PCR products were cloned in pcDNA3.1D ⁄ V5-
His-Topo using the TOPO
Ò
cloning technology (Invitrogen,
Carlsbad, CA, USA). After digestion by XhoI and BamHI,
the inserts of the resulting plasmids were subcloned into
pYFP-CFP-HIS, a plasmid carrying the enhanced YFP at
the 5¢ end of the cloning site. The plasmids pYFP-C3-CFP
and pYFP-C3-C129S-CFP were previously described and
bear the murine calpain 3 coding sequence (wild-type or
C129S protease-dead mutant respectively) between
enhanced YFP in 5¢ and eCFP in 3¢ [3]. The plasmid
pcDNA3-lacZ was obtained from Invitrogen. Every ampli-
fied sequence was confirmed by automated sequencing.
For two-hybrid experiments, the cloning of the N2A
region of titin in the pGAD vector (Clontech, Mountain
View, CA, USA) and of human calpain 3 in the pAS vector
(Clontech) were described previously [68]. The calpain 3
construct carries the C129S mutation, which invalidates
the protease activity of calpain 3. The N2A region of titin
(exons 101–110) was PCR amplified (see primers in Table 1)

from a random primed cDNA library obtained by reverse
transcription of an adult human skeletal muscles poly(A)
RNA library (Ambion AM7983; Ambion, Austin, TX,
USA). The PCR product was digested by XmaI and NcoI
and cloned in fusion with the GAL4 DNA-binding domain
in pAS. CARP and DNter2 cDNA were fused to GAL4
activation domain in pGAD. Briefly, CARP and DNter2
were PCR amplified with primers containing the restriction
sites NcoI in the 5¢ primer and XmaI in the 3¢ primer
(Table 1). The digested fragments were ligated in EcoRI ⁄
BamHI linearized pGAD. Every amplified sequence was
validated by automated sequencing.
Rabbit polyclonal antibody directed against the epitope
QESEEQQQFRNIFKQ in exon 17 of the calpain 3 (B3)
was kindly provided by Dr Ahmed Ouali (INRA UR 370,
Saint Genes Champanelle, France) and has been described
previously [8]. NF-jB-specific rabbit polyclonal antibody
was obtained from Chemicon. Mouse monoclonal antibody
specific for the V5 epitope was purchased from Invitrogen.
Horseradish peroxidase linked donkey anti-rabbit IgG and
sheep anti-mouse IgG antibodies were obtained from GE
Healthcare (Piscataway, NJ, USA).
Cell culture and transfection
The NIH3T3 cell line was obtained from the American
Type Culture Collection (Rockville, MD, USA) and the C2
mouse myoblasts from the ATCC [69]. Fibroblasts and
myoblasts were cultured in DMEM containing gentamicin
(10 lgÆmL
)1
) and supplemented with 10% or 20% fetal

bovine serum (HyClone
Ò
Thermo Scientific, Hudson, NH,
USA), respectively. Myogenic differentiation of C2 cells
was initiated by replacement of the growth medium with
DMEM containing 5% horse serum (Gibco
Ò
Invitrogen,
Carlsbad, CA, USA) and the subsequent maintenance of
the cells in this medium for 4–10 days.
For plasmid transfections, cells were plated (300 000 C2
cells or 1 000 000 NIH3T3 cells per 100 mm dish) and
allowed to grow for 24 h. Transfections were performed
with 6 lg of plasmid and 30 lL of FuGENE 6 transfection
reagent (Roche Applied Science, Indianapolis, IN, USA).
In case of co-transfections, plasmids were mixed at equimo-
lar concentrations. To increase C2 transfection efficiency,
the same transfection method was used a second time
before the start of myogenic differentiation.
Preparation of protein samples and
immunoblotting
Cells were washed with NaCl ⁄ P
i
and proteins were
extracted using a buffer containing 20 mm Tris (pH 7.5),
150 mm NaCl, 2 mm EGTA, 1% Triton X-100, 2 lm E64
and protease inhibitors (Complete mini protease inhibitor
cocktail; Roche Applied Sciences). After centrifugation at
10 000 g for 10 min at 4 °C, the supernatants were recov-
ered for western blot analysis.

The muscle proteins of the different sub-cellular compart-
ments were extracted using the ProteoExtract
Ò
Subcellular
Proteome Extraction Kit (S-PEK; Calbiochem
Ò
Merck
KGaA, Darmstadt, Germany). Briefly, TA muscles were
homogenized in 1 mL of lysis buffer with a Fast-Prep instru-
ment (MP-Biomedicals, Solon, OH, USA), and proteins of
the cytosol, membranes, nucleus and cytoskeleton were
extracted in accordance with the manufacturer’s instructions.
The samples were denatured before SDS ⁄ PAGE using
LDS NuPage buffer (Invitrogen) supplemented with 100 mm
dithiothreitol. Sample protein concentrations were deter-
mined by the BCA methodology (Thermo Scientific, Rock-
ford, IL, USA). Protein samples were submitted to
SDS ⁄ PAGE in precast 4–12% acrylamide gradient gels (Nu-
Table 1. Primers used for cloning.
Plasmid Insert
Upper primer
Lower primer
pGAD-CARP Full-length
CARP
CGCCATGGCAATGATGGTACTGAAAGTAGAGG
CGGCCCGGGAACTGATTAAGAGTCTGTCG
pGAD-DNter2 CARP from
71 to 319
GAGCCATGGAACAACGGAAAAGCGAGAAAC
CGGCCCGGGAACTGATTAAGAGTCTGTCG

pYFP-CARP-
CFP-HIS
Full-length
CARP
1–319
CACCATGATGGTACTGAGAG
GAATGTAGCTATGCGAGAGTTC
pDNter1 CARP from
30 to 319
CACCATGGCCGAGTTCAGAAATGGAGAAG
GAATGTAGCTATGCGAGAGTTC
pDNter2 CARP from
71 to 319
CACCATGCTGAAGACACTTCCGGCCAACAG
GAATGTAGCTATGCGAGAGTTC
pDNter3 CARP from
102 to 319
CACCATGCTGAAAGCTGCGCTGGAGAAC
GAATGTAGCTATGCGAGAGTTC
pDNter4 CARP from
124 to 319
CACCATGACCAAAGTTCCAGTTGTGAAGG
GAATGTAGCTATGCGAGAGTTC
pCarpNter CARP from
1to70
CACCATGATGGTACTGAGAG
GAATGTAGCTATGCGAGAGTTC
L. Laure et al. Regulation of CARP by calpain 3
FEBS Journal 277 (2010) 4322–4337 ª 2010 The Authors Journal compilation ª 2010 FEBS 4331
Page system; Invitrogen) and transferred onto poly(vinyli-

dene difluoride) membranes (Millipore, Billerica, MA, USA)
by the appliance of an electric field (100 V for 1 h). The
transfer efficiency was evaluated by Ponceau red protein
staining (0.2%, w ⁄ v, in 5% acetic acid). The membranes were
probed with antibodies against calpain 3 (dilution 1 : 150),
green fluorescent protein (GFP) (dilution 1 : 5000), NF-jB
p65 (dilution 1 : 4000) or V5 epitope (dilution 1 : 5000). For
calpain 3 and V5 specific western blot, detection was
performed with secondary antibodies (dilution 1 : 10 000)
coupled to horseradish peroxidase and revelation was rea-
lised with the SuperSignal West Pico substrate (Pierce). For
GFP and NF-jB-specific western blot, detection was carried
out with a secondary antibody coupled to IRDye 680
(Li-Cor, Lincoln, NE, USA; dilution 1 : 10 000) and the
membranes were exposed to the Odyssey infrared imaging
system (Li-Cor) for detection of the signal.
RNA extraction and real-time qRT-PCR
Total RNA were isolated from mouse cells using Trizol
reagent (Gibco). cDNA were synthesized from 1 lg of total
RNA using the SuperScript first strand synthesis system for
RT-PCR kit (Invitrogen) and random oligonucleotides.
Expression of calpain 3, CARP, NF-jB and MuRF1 genes
was monitored by a qRT-PCR method using TaqMan
probes (Perkin Elmer, Waltham, MA, USA) and a 7900
HT fast RT-PCR machine (Applied Biosystems, Carlsbad,
CA, USA). The ubiquitous acidic ribosomal phosphopro-
tein (P0) was used to normalize the data across samples. P0
expression was monitored by SYBRGreen incorporation.
The primer pairs and TaqMan probes used for amplifica-
tion are indicated in Table 2. Each experiment was per-

formed in duplicate.
Transcription factor activity assays
Protein ⁄ DNA arrays were used to screen simultaneously a
large number of transcription factors for DNA binding
activity. Five 100 mm dishes of 2 · 10
5
C2 myogenic cells
were prepared for each condition. They were transfected
with pcDNA3-CARP or with a mock plasmid (pYFP-C3-
CFP or pcDNA3-lacZ). Transfected cells were purified using
a method taking advantage of the co-expression of a trun-
cated H-2K
k
surface marker (MACSelect K
k
system; Milte-
nyi Biotec, Auburn, CA, USA). After selection, cells were
differentiated into myotubes for 5 days. Nuclear extracts
were prepared with the S-PEK sub-cellular fraction kit
(Calbiochem) and quantified using the Bradford technique
(Bio-Rad, Hercules, CA, USA). The protein ⁄ DNA assays
were carried out on 25 lg of total nuclear proteins using the
TranSignal Protein ⁄ DNA Combo Array (Affymetrix, Santa
Clara, CA, USA) in accordance with the manufacturer’s
instructions. DNA-binding activity is proportional to the
intensity of the spot obtained after membrane revelation.
Films were scanned and spot density was determined using
the quantity one software (Bio-Rad).
Relevant results were quantified using the ELISA-based
method TransAm (Active Motif, Carlsbad, CA, USA). Five

100 mm dishes of 1 · 10
6
C2 myogenic cells were prepared
for each condition. They were transfected with pcDNA3-
CARP or with a mock plasmid (pcDNA3-lacZ) and differ-
entiated into myotubes for 7–10 days. Nuclear extracts
from CARP-expressing and control C2 myotubes were pre-
pared using a Nuclear Extraction Kit (Active Motif) in
accordance with the manufacturer’s instructions. Either 1.5
or 40 lg of nuclear extract were used for NF-jB p65 and
RelB activity assay, respectively. The transcription factor
activity was measured at 450 nm using a spectrophotometer.
Table 2. Primers and probes sets used for qRT-PCR of mouse genes.
Acronym Name Accession number
Upper primer
Probe
Lower primer
C3 Calpain 3 NM_007601.3 mC3.F ACAACAATCAGCTGGTTTTCACC
mC3.P TGCCAAGCTCCATGGCTCCTATGAAG
mC3.R CAAAAAACTCTGTCACCCCTCC
CARP Ankyrin repeat domain 1 NM_013468 mCARP.F CTTGAATCCACAGCCATCCA
mCARP.P CATGTCGTGGAGGAAACGCAGATGTC
mCARP.R TGGCACTGATTTTGGCTCCT
NF-jB p65 Reticuloendotheliosis viral oncogene
homolog A (Rela)
NM_009045 mp65NFjB.F GGCGGCACGTTTTACTCTTT
mp65NFjB.P CGCTTTCGGAGGTGCTTTCGCAG
mp65NFjB.R TCAGAGTTCCCTACCGAAGCAG
MurF1 Tripartite motif-containing 63 (Trim63), NM_001039048 mMurf1.F AGGGCCATTGACTTTGGGAC
mMurf1.P AGGAGG AGTTTACAGAAGAGGAGGCTGATGAG

mMurf1.R CTCTGTGGTCACGCCCTCTT
P0 Acidic ribosomal phosphoprotein XR_004667 mP0.F CTCCAAGCAGATGCAGCAGA
mP0.P CCGTGGTGCTGATGGGCAAGAA
mP0.R ATAGCCTTGCGCATCATGGT
Regulation of CARP by calpain 3 L. Laure et al.
4332 FEBS Journal 277 (2010) 4322–4337 ª 2010 The Authors Journal compilation ª 2010 FEBS
The results are expressed as a percentage of expression in
control myotubes.
Yeast two-hybrid analysis
Protein–protein interactions were investigated using the BD
Matchmaker yeast Two-hybrid System (Clontech). The yeast
competent cells AH109 (mat a) and Y187 (mat a) were trans-
formed using the alkali-cation transformation kit (MP Bio-
medicals, Solon, OH, USA) with 25 lg of pGAD and pAS
plasmids, respectively, and plated on medium lacking leucine
(for mat a-pGAD) or tryptophan (for mat a-pAS). The
Y187 cells were mated with AH109 yeasts for 36 h at 30 °C
on non selective YPD medium. Colonies were harvested,
resuspended in 50 lL of water, spotted on medium lacking
leucine, tryptophan and histidine and incubated for 4 days
at 30 °C. Plates were scanned to obtain digitized images.
In vivo plasmid delivery
Wild-type mice from the 129SvPasIco strain were pur-
chased from Charles River Laboratories (Les Oncins,
France). The calpain 3-deficient (C3-null) model used in the
present study corresponds to a complete inactivation of the
calpain 3 expression (for a description of the model, see
Doc. S1). All mice were handled in accordance with the
European Communities Council Directive of 24 November
1986 (86 ⁄ 609 ⁄ EEC) and experiments were performed in

accordance with Genethon ethical committee.
Endotoxin-free plasmids were prepared with the Endo-
Free Megaprep kit (Qiagen, Valencia, CA, USA). In total,
50 lg of plasmid were injected into the TA muscles of wild-
type (129svPasIco) or C3-null mice (18–32 weeks old).
Immediately after injection, transcutaneous electric pulses
were applied through two stainless steel plate electrodes
placed on each side of the hind limb. Eight square-wave
electric pulses were generated by an ECM-830 electropulsa-
tor (BTX, Holliston, MA, USA) with an output voltage of
200 VÆcm
)1
, a pulse length of 20 ms, and a frequency of
pulse delivery of 2 Hz. For monitoring of fluorescence,
7 days after injection, mice were anaesthetized with intra-
peritoneal injections of ketamine ⁄ xylazine (at a concentra-
tion of 100 and 10 mgÆkg
)1
, respectively), the skin
surrounding the TA was dissected, a glass cover-slide was
positioned on the exposed muscle and the fluorescence was
observed using a confocal microscope (DM-IRBE; Leica
Microsystems, Bannockburn, IL, USA) and a laser excita-
tion wavelength of 514 nm for YFP detection.
FRAP experiments
FRAP experiments were performed by bleaching ROIs
across mouse TA fibers transduced 7 days previously with
YFP-tagged constructs. Ten iterations of photobleaching
were used at a laser set up of k = 514 nm and 100%
output. The prebleaching status, bleaching and fluorescence

recovery were recorded by the ‘time series application’ of
the Leica confocal software, using 3% laser output to mini-
mize further bleaching. For quantitative analysis, a mini-
mum of 12 individual muscle fibers (from three different
animals) were analyzed, and the average pixel intensities in
specified ROI were determined with the freeware image
analysis imagej ( Unbleached ref-
erence regions were analyzed in parallel for each muscle
fiber for data normalization. The fluorescence recovery
speed is calculated by dividing the variation of fluorescence
units between pre- and post-bleach status by the variation
of fluorescence over the same length of time in an
unbleached ROI, hence giving normalized results expressed
as arbitrary units per minute. Box-plot representations were
built for each condition. The box embraces the 25th and
75th percentile values. Whiskers extend from each end of
the box to the minimum and maximum values in the data.
Crosses represent the mean value.
Bio-informatics analysis
Bio-informatics analyses were carried out on the sequence
of the full-length CARP protein and on the sequence of the
C-terminal fragment resulting from calpain 3-dependent
proteolysis. The 2D structures were analyzed using net-
surfp software ( />The prediction of the presence of coiled-coil regions was
performed using coils ( />COILS_form.html) and paircoil (-
t.edu/cb/paircoil/cgi-bin/paircoil.cgi) software. The analyses
were confirmed using esypred3d software for the predic-
tion of 3D structures ( />esypred/).
Statistical analysis
Data are presented as the mean ± SEM. Individual means

were compared using the Mann–Whitney non parametric
test. P < 0.05 or P < 0.01 was considered statistically
significant.
Acknowledgements
We acknowledge the excellent technical expertise of
Ludovic Arandel, Thibaut Marais and Lae
¨
titia Van Wit-
tenberghe. We are very grateful to Dr Ahmed Ouali for
providing us with antibodies. This work was supported
by the ‘Association Franc¸ aise contre les Myopathies’.
References
1 Fardeau M, Eymard B, Mignard C, Tome FM, Richard
I & Beckmann JS (1996) Chromosome 15-linked
L. Laure et al. Regulation of CARP by calpain 3
FEBS Journal 277 (2010) 4322–4337 ª 2010 The Authors Journal compilation ª 2010 FEBS 4333
limb-girdle muscular dystrophy: clinical phenotypes in
Reunion Island and French metropolitan communities.
Neuromuscul Disord 6, 447–453.
2 Richard I, Broux O, Allamand V, Fougerousse F,
Chiannilkulchai N, Bourg N, Brenguier L, Devaud C,
Pasturaud P, Roudaut C et al. (1995) Mutations in the
proteolytic enzyme calpain 3 cause limb-girdle muscular
dystrophy type 2A. Cell 81, 27–40.
3 Taveau M, Bourg N, Sillon G, Roudaut C, Bartoli
M & Richard I (2003) Calpain 3 is activated through
autolysis within the active site and lyses sarcomeric
and sarcolemmal components. Mol Cell Biol 23,
9127–9135.
4 Guyon JR, Kudryashova E, Potts A, Dalkilic I, Brosius

MA, Thompson TG, Beckmann JS, Kunkel LM &
Spencer MJ (2003) Calpain 3 cleaves filamin C and
regulates its ability to interact with gamma- and
delta-sarcoglycans. Muscle Nerve 28, 472–483.
5 Cohen N, Kudryashova E, Kramerova I, Anderson LV,
Beckmann JS, Bushby K & Spencer MJ (2006) Identifi-
cation of putative in vivo substrates of calpain 3 by
comparative proteomics of overexpressing transgenic
and nontransgenic mice. Proteomics 6, 6075–6084.
6 Kramerova I, Kudryashova E, Wu B, Ottenheijm C,
Granzier H & Spencer MJ (2008) Novel role of
calpain-3 in the triad-associated protein complex
regulating calcium release in skeletal muscle. Hum Mol
Genet 17, 3271–3280.
7 Ono Y, Hayashi C, Doi N, Kitamura F, Shindo M,
Kudo K, Tsubata T, Yanagida M & Sorimachi H
(2007) Comprehensive survey of p94 ⁄ calpain 3 sub-
strates by comparative proteomics - Possible regulation
of protein synthesis by p94. Biotechnol J 2, 565–576.
8 Baghdiguian S, Martin M, Richard I, Pons F, Astier C,
Bourg N, Hay RT, Chemaly R, Halaby G, Loiselet J
et al. (1999) Calpain 3 deficiency is associated with
myonuclear apoptosis and profound perturbation of the
IkappaB alpha ⁄ NF-kappaB pathway in limb-girdle
muscular dystrophy type 2A. Nat Med 5, 503–511.
9 Benayoun B, Baghdiguian S, Lajmanovich A, Bartoli
M, Daniele N, Gicquel E, Bourg N, Raynaud F, Pasqu-
ier MA, Suel L et al. (2008) NF-{kappa}B-dependent
expression of the antiapoptotic factor c-FLIP is regu-
lated by calpain 3, the protein involved in limb-girdle

muscular dystrophy type 2A. FASEB J 22, 1521–1529.
10 Duguez S, Bartoli M & Richard I (2006) Calpain 3: a
key regulator of the sarcomere? Febs J 273, 3427–3436.
11 Kramerova I, Kudryashova E, Tidball JG & Spencer
MJ (2004) Null mutation of calpain 3 (p94) in mice
causes abnormal sarcomere formation in vivo and
in vitro. Hum Mol Genet 13, 1373–1388.
12 Kramerova I, Kudryashova E, Venkatraman G &
Spencer MJ (2005) Calpain 3 participates in sarcomere
remodeling by acting upstream of the ubiquitin-protea-
some pathway. Hum Mol Genet 14, 2125–2134.
13 Baghdiguian S, Richard I, Martin M, Coopman P,
Beckmann JS, Mangeat P & Lefranc G (2001) Patho-
physiology of limb girdle muscular dystrophy type 2A:
hypothesis and new insights into the IkappaBal-
pha ⁄ NF-kappaB survival pathway in skeletal muscle.
J Mol Med 79, 254–261.
14 Sorimachi H, Kinbara K, Kimura S, Takahashi M,
Ishiura S, Sasagawa N, Sorimachi N, Shimada H,
Tagawa K, Maruyama K et al. (1995) Muscle-specific
calpain, p94, responsible for limb girdle muscular
dystrophy type 2A, associates with connectin through
IS2, a p94-specific sequence. J Biol Chem 270, 31158–
31162.
15 Kinbara K, Sorimachi H, Ishiura S & Suzuki K (1997)
Muscle-specific calpain, p94, interacts with the extreme
C-terminal region of connectin, a unique region flanked
by two immunoglobulin C2 motifs.
Arch Biochem Bio-
phys 342, 99–107.

16 Lange S, Xiang F, Yakovenko A, Vihola A, Hackman
P, Rostkova E, Kristensen J, Brandmeier B, Franzen
G, Hedberg B et al. (2005) The kinase domain of titin
controls muscle gene expression and protein turnover.
Science 308, 1599–1603.
17 Kojic S, Medeot E, Guccione E, Krmac H, Zara I,
Martinelli V, Valle G & Faulkner G (2004) The Ankrd2
protein, a link between the sarcomere and the nucleus
in skeletal muscle. J Mol Biol 339, 313–325.
18 Miller MK, Bang ML, Witt CC, Labeit D, Trombitas
C, Watanabe K, Granzier H, McElhinny AS, Gregorio
CC & Labeit S (2003) The muscle ankyrin repeat pro-
teins: CARP, ankrd2 ⁄ Arpp and DARP as a family of
titin filament-based stress response molecules. J Mol
Biol 333, 951–964.
19 Chu W, Burns DK, Swerlick RA & Presky DH (1995)
Identification and characterization of a novel cytokine-
inducible nuclear protein from human endothelial cells.
J Biol Chem 270, 10236–10245.
20 Ikeda K, Emoto N, Matsuo M & Yokoyama M (2003)
Molecular identification and characterization of a novel
nuclear protein whose expression is up-regulated in
insulin-resistant animals. J Biol Chem 278, 3514–3520.
21 Zou Y, Evans S, Chen J, Kuo HC, Harvey RP & Chien
KR (1997) CARP, a cardiac ankyrin repeat protein, is
downstream in the Nkx2-5 homeobox gene pathway.
Development 124, 793–804.
22 Moriyama M, Tsukamoto Y, Fujiwara M, Kondo G,
Nakada C, Baba T, Ishiguro N, Miyazaki A, Nakam-
ura K, Hori N et al. (2001) Identification of a novel

human ankyrin-repeated protein homologous to CARP.
Biochem Biophys Res Commun 285, 715–723.
23 Pallavicini A, Kojic S, Bean C, Vainzof M, Salamon M,
Ievolella C, Bortoletto G, Pacchioni B, Zatz M,
Lanfranchi G et al. (2001) Characterization of human
skeletal muscle Ankrd2. Biochem Biophys Res Commun
285, 378–386.
Regulation of CARP by calpain 3 L. Laure et al.
4334 FEBS Journal 277 (2010) 4322–4337 ª 2010 The Authors Journal compilation ª 2010 FEBS
24 Kemp TJ, Sadusky TJ, Saltisi F, Carey N, Moss J,
Yang SY, Sassoon DA, Goldspink G & Coulton GR
(2000) Identification of Ankrd2, a novel skeletal muscle
gene coding for a stretch-responsive ankyrin-repeat
protein. Genomics 66, 229–241.
25 Tsukamoto Y, Senda T, Nakano T, Nakada C, Hida T,
Ishiguro N, Kondo G, Baba T, Sato K, Osaki M et al.
(2002) Arpp, a new homolog of carp, is preferentially
expressed in type 1 skeletal muscle fibers and is
markedly induced by denervation. Lab Invest 82,
645–655.
26 Baumeister A, Arber S & Caroni P (1997) Accumula-
tion of muscle ankyrin repeat protein transcript reveals
local activation of primary myotube endcompartments
during muscle morphogenesis. J Cell Biol 139, 1231–
1242.
27 Boengler K, Pipp F, Fernandez B, Ziegelhoeffer T,
Schaper W & Deindl E (2003) Arteriogenesis is
associated with an induction of the cardiac ankyrin
repeat protein (carp). Cardiovasc Res 59, 573–
581.

28 Jeyaseelan R, Poizat C, Baker RK, Abdishoo S,
Isterabadi LB, Lyons GE & Kedes L (1997) A novel
cardiac-restricted target for doxorubicin. CARP, a
nuclear modulator of gene expression in cardiac progen-
itor cells and cardiomyocytes. J Biol Chem 272, 22800–
22808.
29 Hayashi C, Ono Y, Doi N, Kitamura F, Tagami M,
Mineki R, Arai T, Taguchi H, Yanagida M, Hirner S
et al. (2008) Multiple molecular interactions implicate
connectin ⁄ titin N2A region as a modulating scaffold
for p94 ⁄ calpain 3 activity in skeletal muscle. J Biol
Chem 283, 14801–14814.
30 Lehti M, Kivela R, Komi P, Komulainen J,
Kainulainen H & Kyrolainen H (2009) Effects of
fatiguing jumping exercise on mRNA expression of
titin-complex proteins and calpains. J Appl Physiol
106, 1419–1424.
31 Aihara Y, Kurabayashi M, Saito Y, Ohyama Y,
Tanaka T, Takeda S, Tomaru K, Sekiguchi K, Arai M,
Nakamura T et al. (2000) Cardiac ankyrin repeat
protein is a novel marker of cardiac hypertrophy: role
of M-CAT element within the promoter. Hypertension
36, 48–53.
32 Arber S, Hunter JJ, Ross J Jr, Hongo M, Sansig G,
Borg J, Perriard JC, Chien KR & Caroni P (1997)
MLP-deficient mice exhibit a disruption of cardiac
cytoarchitectural organization, dilated cardiomyopathy,
and heart failure. Cell 88, 393–403.
33 Ihara Y, Suzuki YJ, Kitta K, Jones LR & Ikeda T
(2002) Modulation of gene expression in transgenic

mouse hearts overexpressing calsequestrin. Cell Calcium
32, 21–29.
34 Zolk O, Frohme M, Maurer A, Kluxen FW, Hentsch
B, Zubakov D, Hoheisel JD, Zucker IH, Pepe S &
Eschenhagen T (2002) Cardiac ankyrin repeat protein,
a negative regulator of cardiac gene expression, is
augmented in human heart failure. Biochem Biophys
Res Commun 293, 1377–1382.
35 Barash IA, Mathew L, Ryan AF, Chen J & Lieber
RL (2004) Rapid muscle-specific gene expression
changes after a single bout of eccentric contractions
in the mouse. Am J Physiol Cell Physiol 286, C355–
C364.
36 Carson JA, Nettleton D & Reecy JM (2002) Differential
gene expression in the rat soleus muscle during early
work overload-induced hypertrophy. FASEB J 16, 207–
209.
37 Chen YW, Nader GA, Baar KR, Fedele MJ, Hoffman
EP & Esser KA (2002) Response of rat muscle to acute
resistance exercise defined by transcriptional and trans-
lational profiling. J Physiol 545, 27–41.
38 Hentzen E, Lahey M, Peters D, Mathew L, Barash I,
Friden J & Lieber R (2006) Stress-Dependent And
Stress-Independent Expression Of The Myogenic Regu-
latory Factors And The Marp Genes After Eccentric
Contractions. J Physiol 570
, 157–167.
39 Bakay M, Zhao P, Chen J & Hoffman EP (2002) A
web-accessible complete transcriptome of normal
human and DMD muscle. Neuromuscul Disord 12(Suppl

1), S125–S141.
40 Laure L, Suel L, Roudaut C, Bourg N, Ouali A, Bartoli
M, Richard I & Daniele N (2009) Cardiac ankyrin
repeat protein is a marker of skeletal muscle pathologi-
cal remodelling. Febs J 276, 669–684.
41 Nakada C, Oka A, Nonaka I, Sato K, Mori S, Ito H &
Moriyama M (2003) Cardiac ankyrin repeat protein is
preferentially induced in atrophic myofibers of congeni-
tal myopathy and spinal muscular atrophy. Pathol Int
53, 653–658.
42 Nakada C, Tsukamoto Y, Oka A, Nonaka I, Takeda S,
Sato K, Mori S, Ito H & Moriyama M (2003) Cardiac-
restricted ankyrin-repeated protein is differentially
induced in duchenne and congenital muscular dystro-
phy. Lab Invest 83, 711–719.
43 Nakamura K, Nakada C, Takeuchi K, Osaki M,
Shomori K, Kato S, Ohama E, Sato K, Fukayama M,
Mori S et al. (2002) Altered expression of cardiac anky-
rin repeat protein and its homologue, ankyrin repeat
protein with PEST and proline-rich region, in atrophic
muscles in amyotrophic lateral sclerosis. Pathobiology
70, 197–203.
44 Murphy RM, Goodman CA, McKenna MJ, Bennie J,
Leikis M & Lamb GD (2007) Calpain-3 is autolyzed
and hence activated in human skeletal muscle 24 h fol-
lowing a single bout of eccentric exercise. J Appl Physiol
103, 926–931.
45 Kinbara K, Ishiura S, Tomioka S, Sorimachi H, Jeong
SY, Amano S, Kawasaki H, Kolmerer B, Kimura S,
Labeit S et al. (1998) Purification of native p94, a

L. Laure et al. Regulation of CARP by calpain 3
FEBS Journal 277 (2010) 4322–4337 ª 2010 The Authors Journal compilation ª 2010 FEBS 4335
muscle-specific calpain, and characterization of its
autolysis. Biochem J 335 (Pt 3), 589–596.
46 Daniele N, Richard I & Bartoli M (2007) Ins and outs
of therapy in limb girdle muscular dystrophies. Int J Bio-
chem Cell Biol 39, 1608–1624.
47 de Morree A, Lutje Hulsik D, Impagliazzo A, van
Haagen HHHBM, de Galan P, van Remoortere A, ‘t
Hoen PAC, van Ommen GB, Frants RR & van der
Maarel SM (2010) Calpain 3 is a rapid-action, unidirec-
tional proteolytic switch central to muscle remodeling.
PLoS ONE 5, e11940.
48 Reits EA & Neefjes JJ (2001) From fixed to FRAP:
measuring protein mobility and activity in living cells.
Nat Cell Biol 3, E145–E147.
49 Witt SH, Labeit D, Granzier H, Labeit S & Witt CC
(2005) Dimerization of the cardiac ankyrin protein
CARP: implications for MARP titin-based signaling.
J Muscle Res Cell Motil 26, 401–408.
50 Jackman RW & Kandarian SC (2004) The molecular
basis of skeletal muscle atrophy. Am J Physiol Cell
Physiol 287, C834–C843.
51 Cai D, Frantz JD, Tawa NE Jr, Melendez PA, Oh
BC, Lidov HG, Hasselgren PO, Frontera WR, Lee J,
Glass DJ et al. (2004) IKKbeta ⁄ NF-kappaB activation
causes severe muscle wasting in mice. Cell 119, 285–
298.
52 Glass DJ (2005) Skeletal muscle hypertrophy and atro-
phy signaling pathways. Int J Biochem Cell Biol 37 ,

1974–1984.
53 Franch HA & Price SR (2005) Molecular signaling
pathways regulating muscle proteolysis during atrophy.
Curr Opin Clin Nutr Metab Care 8, 271–275.
54 Ishiguro N, Baba T, Ishida T, Takeuchi K, Osaki M,
Araki N, Okada E, Takahashi S, Saito M, Watanabe
M et al. (2002) Carp, a cardiac ankyrin-repeated pro-
tein, and its new homologue, Arpp, are differentially
expressed in heart, skeletal muscle, and rhabdomyosar-
comas. Am J Pathol 160, 1767–1778.
55 Moulik M, Vatta M, Witt SH, Arola AM, Murphy RT,
McKenna WJ, Boriek AM, Oka K, Labeit S, Bowles
NE et al. (2009) ANKRD1, the gene encoding cardiac
ankyrin repeat protein, is a novel dilated cardiomyopa-
thy gene. J Am Coll Cardiol 54, 325–333.
56 Valencia CA, Ju W & Liu R (2007) Matrin 3 is a
Ca2+ ⁄ calmodulin-binding protein cleaved by caspases.
Biochem Biophys Res Commun 361, 281–286.
57 Lin X, Mu Y, Cunningham ET Jr, Marcu KB, Gelezi-
unas R & Greene WC (1998) Molecular determinants
of NF-kappaB-inducing kinase action. Mol Cell Biol 18,
5899–5907.
58 Schweisguth F (2004) Regulation of notch signaling
activity. Curr Biol 14, R129–R138.
59 Tsukamoto Y, Hijiya N, Yano S, Yokoyama S, Nak-
ada C, Uchida T, Matsuura K & Moriyama M (2008)
Arpp ⁄ Ankrd2, a member of the muscle ankyrin repeat
proteins (MARPs), translocates from the I-band to the
nucleus after muscle injury. Histochem Cell Biol 129,
55–64.

60 Inoue J, Kerr LD, Rashid D, Davis N, Bose HR Jr
& Verma IM (1992) Direct association of pp40 ⁄ I
kappa B beta with rel ⁄ NF-kappa B transcription
factors: role of ankyrin repeats in the inhibition of
DNA binding activity. Proc Natl Acad Sci USA 89,
4333–4337.
61 Perkins ND (2006) Post-translational modifications reg-
ulating the activity and function of the nuclear factor
kappa B pathway. Oncogene 25, 6717–6730.
62 Park JH, Liu L, Kim IH, Kim JH, You KR & Kim
DG (2005) Identification of the genes involved in
enhanced fenretinide-induced apoptosis by par-
thenolide in human hepatoma cells. Cancer Res 65,
2804–2814.
63 Mohamed JS, Lopez MA, Cox GA & Boriek AM
(2010) Anisotropic regulation of Ankrd2 gene expres-
sion in skeletal muscle by mechanical stretch. FASEB J
24, 3330–3340.
64 Hunter RB, Stevenson E, Koncarevic A, Mitchell-
Felton H, Essig DA & Kandarian SC (2002)
Activation of an alternative NF-kappaB pathway in
skeletal muscle during disuse atrophy. FASEB J 16,
529–538.
65 Judge AR, Koncarevic A, Hunter RB, Liou HC, Jack-
man RW & Kandarian SC (2007) Role for IkappaBal-
pha, but not c-Rel, in skeletal muscle atrophy. Am J
Physiol Cell Physiol 292, C372–C382.
66 Mourkioti F, Kratsios P, Luedde T, Song YH,
Delafontaine P, Adami R, Parente V, Bottinelli R,
Pasparakis M & Rosenthal N (2006) Targeted

ablation of IKK2 improves skeletal muscle strength,
maintains mass, and promotes regeneration. J Clin
Invest 116 , 2945–2954.
67 Tolosa L, Morla M, Iglesias A, Busquets X, Llado J &
Olmos G (2005) IFN-gamma prevents TNF-alpha-
induced apoptosis in C2C12 myotubes through down-
regulation of TNF-R2 and increased NF-kappaB activ-
ity. Cell Signal 17, 1333–1342.
68 Herasse M, Ono Y, Fougerousse F, Kimura E,
Stockholm D, Beley C, Montarras D, Pinset C,
Sorimachi H, Suzuki K et al. (1999) Expression and
functional characteristics of calpain 3 isoforms
generated through tissue-specific transcriptional and
posttranscriptional events. Mol Cell Biol 19, 4047–
4055.
69 Yaffe D & Saxel O (1977) Serial passaging and differen-
tiation of myogenic cells isolated from dystrophic
mouse muscle. Nature 270, 725–727.
70 Fougerousse F, Gonin P, Durand M, Richard I &
Raymackers JM (2003) Force impairment in calpain
3-deficient mice is not correlated with mechanical
disruption. Muscle Nerve 27, 616–623.
Regulation of CARP by calpain 3 L. Laure et al.
4336 FEBS Journal 277 (2010) 4322–4337 ª 2010 The Authors Journal compilation ª 2010 FEBS
Supporting information
The following supplementary material is available:
Fig. S1. The C3-KO murine model has no residual
calpain 3 expression.
Fig. S2. The C3-KO murine model reproduces features
of the human disease (i.e. muscle degeneration and

weakness).
Fig. S3. CARP expression inhibits the DNA-binding
activities of 32 transcription factors.
Fig. S4. Calpain 3-mediated cleavage of CARP reduces
its effects on transcription factors.
Doc S1. Construction and characterization of the cal-
pain 3 deficient animal model.
This supplementary material can be found in the
online version of this article.
Please note: As a service to our authors and readers,
this journal provides supporting information supplied
by the authors. Such materials are peer-reviewed and
may be re-organized for online delivery, but are not
copy-edited or typeset. Technical support issues arising
from supporting information (other than missing files)
should be addressed to the authors.
L. Laure et al. Regulation of CARP by calpain 3
FEBS Journal 277 (2010) 4322–4337 ª 2010 The Authors Journal compilation ª 2010 FEBS 4337