Báo cáo khoa học: Regulatory feedback loop between NF-jB and MCP-1-induced protein 1 RNase pdf

Regulatory feedback loop between NF-jB and
MCP-1-induced protein 1 RNase
Lukasz Skalniak, Danuta Mizgalska, Adrian Zarebski, Paulina Wyrzykowska, Aleksander Koj
and Jolanta Jura
Department of Cell Biochemistry, Faculty of Biochemistry, Biophysics and Biotechnology, Jagiellonian University, Krakow, Poland
Introduction
The binding of cytokines to receptors localized at the
surface of a target cell activates a cascade of biochemi-
cal events, often resulting in an alteration of the cell’s
transcriptome profile. Recently, microarray analysis of
human peripheral blood monocytes treated with mono-
cyte chemotactic protein 1 (MCP-1) [1] and human
monocyte-derived macrophages treated with interleu-
kin (IL)-1b [2], led to the identification of a novel
gene, termed ZC3H12A. The gene, which encodes a
protein named MCP-1-induced protein 1 (MCPIP),
undergoes rapid and potent transcription induction
upon stimulation of cells with MCP-1 or IL-1b. Fur-
ther studies showed that MCPIP plays an important
role in both physiological and pathological processes
related to inflammation. The protein was postulated to
act as an executor of MCP-1 action in chronic inflam-
mation-related ischaemic heart disease [1,3] and MCP-
1-induced angiogenesis [4]. MCPIP was also proved to
be a negative regulator of macrophage activation.
Preliminary studies revealed that this regulation, at
Keywords
inflammation; MCPIP; NF-kappa B;
transcription start site; transcriptional
regulation
Correspondence

J. Jura, Department of Cell Biochemistry,
Faculty of Biochemistry, Biophysics and
Biotechnology, 7 Gronostajowa St, 30-387
Krakow, Poland
Fax: +48 12 664 6902
Tel: +48 12 664 6359
E-mail:
Website: />(Received 23 June 2009, revised 6 August
2009, accepted 10 August 2009)
doi:10.1111/j.1742-4658.2009.07273.x
A novel gene ZC3H12A, encoding MCP-1-induced protein 1 (MCPIP),
was recently identified in human peripheral blood monocytes treated with
monocyte chemotactic protein 1 (MCP-1) and in human monocyte-derived
macrophages stimulated with interleukin (IL)-1b. These experiments
revealed that the gene undergoes rapid and potent transcription induction
upon stimulation with proinflammatory molecules, such as MCP-1, IL-1b,
tumour necrosis factor a and lipopolysaccharide. Here we show that the
induction of ZC3H12A by IL-1b is predominantly NF-jB-dependent
because inhibition of this signalling pathway results in the impairment of
ZC3H12A transcription activation. Our results indicate the presence of an
IL-1b-responding region within the second intron of the ZC3H12A gene,
which contains four functional NF-jB-binding sites. Therefore, we propose
that this transcription enhancer transduces a ZC3H12A transcription-
inducing signal after IL-1b stimulation. Recent reports suggest that MCPIP
acts as a negative regulator of inflammatory processes because it is engaged
in the degradation of transcripts coding for certain proinflammatory
cytokines. Our observations provide evidence for a novel negative feed-
back loop in the activation of NF-jB and point to potential significance
of MCPIP in the treatment of various pathological states, such as diabetes
or cancer that involve disturbances in the functioning of the NF-jB

system.
Abbreviations
IL, interleukin; IjB, inhibitor of jB; LPS, lipopolysaccharide; MCP-1, monocyte chemotactic protein 1; MCPIP, MCP-1-induced protein 1;
RLM-RACE, RNA ligase-mediated rapid amplification of cDNA ends; TNFa, tumour necrosis factor a; TSS, transcription start site.
5892 FEBS Journal 276 (2009) 5892–5905 ª 2009 The Authors Journal compilation ª 2009 FEBS
least partially, occurs via interference with the NF-jB
signalling pathway [5].
Although the contribution of MCPIP to inflamma-
tion is indisputable, the mode of action of this protein
seems to be ambiguous. As the protein contains a sin-
gle CCCH-type zinc finger, a putative nuclear localiza-
tion signal and two proline-rich potential activation
domains, it was initially classified as a transcription
factor [1,4]. Nevertheless, the data of Matsushita et al.
[6] and our data (in preparation) suggest that MCPIP
exhibits RNase properties, mediated by the PilT N-ter-
minus domain. The experiments indicate that MCPIP
may be an important factor regulating the half-life of
transcripts coding for such proteins as IL-1b and IL-6.
In this study, we show that the transcriptional
induction of the ZC3H12A gene after IL-1 b stimula-
tion is predominantly NF-jB-dependent. We prove
that this induction is mediated by a transcriptional
enhancer localized within the second intron of the
ZC3H12A gene. The enhancer contains four functional
jB sites (NF-jB-binding sites), revealed by computa-
tional analysis and verified by chromatin immuno-
precipitation, mutagenesis studies and gel-retardation
assay (EMSA). Using EMSA, we also show that over-
expression of MCPIP impedes the formation of

NF-jB ⁄ DNA complexes following IL-1b stimulation,
suggesting an inhibitory effect on NF-jB activation.
The effect was confirmed by studying the influence of
MCPIP on the induction of NF-jB-dependent genes,
namely IjBa and TNFa after IL-1b stimulation. The
results presented here, together with previously
reported findings on the significance of MCPIP in the
inhibition of NF-jB activation [5], provide evidence of
a novel negative feedback loop in the activation of this
transcription factor, and indicate the potential signifi-
cance of MCPIP in the treatment of NF-jB-related
diseases.
Results
Participation of the NF-jB pathway in activation
of ZC3H12A gene
The degradation of inhibitors of jB(IjBs) is a crucial
step in the activation of the NF-jB transcription factor
signalling pathway and is followed by translocation of
the transcription factor to the nucleus. To investigate
the role of this pathway in the induction of transcrip-
tion of the ZC3H12A gene after exposure of cells to
IL-1b, we used a HepG2 cell line deprived of NF-jB
activation ability [cells stably transduced with the
retroviral vector pCFG5-IEG2 containing a domi-
nant negative mutant form of the NF-jB inhibitor
(IjBa(S ⁄ A)] [7]. The cells were stimulated with IL-1b
for 4 h and real-time PCR analysis of MCPIP-coding
transcript level was carried out. The control HepG2-
mock cell line showed an almost 14-fold increase in
the transcript level, whereas in the HepG2 cell line

expressing the mutant form of the IjB inhibitor only a
fivefold increase was observed (Fig. 1). These results
clearly indicate that IL-1b-induced ZC3H12A gene
expression is predominantly NF-jB dependent.
Determination of ZC3H12A gene transcription
start site
Although it has been proven that the ZC3H12A gene
is composed of six exons, the first of which contains
exclusively a noncoding sequence, localization of the
gene’s transcription start site (TSS) is still not clear.
Four sequences in the Entrez Gene database (http://
www.ncbi.nlm.nih.gov/sites/entrez?db=gene) match
the ID of the MCPIP transcript, each having a distinct
5¢-UTR length (Fig. 2A). To identify the authentic
TSS of the ZC3H12A gene we performed the 5¢ RNA
ligase-mediated rapid amplification of cDNA ends
(RLM-RACE) procedure. Analysis of RACE products
by sequencing revealed the presence of two groups of
sequences with slightly different 5¢-ends (Fig. 2C).
Both sequences were registered to the NCBI database
under a single accession number FJ695517. Because
the first of the detected TSSs was represented by the
majority of the sequenced clones (60%), we postulated
0
2
4
6
8
10
12

14
16
18
-
-
HepG2-mock
HepG2-IκBα (S /A)
IL-1β
–+
**
MCPIP mRNA
Fold change vs control
Fig. 1. Contribution of NF-jB pathway to induction of ZC3H12A
transcription after IL-1b stimulation. In the experiment, the level of
MCPIP transcript was measured by real-time PCR in control HepG2
cells (HepG2-mock) and cells deprived of NF-jB activation ability
[HepG2-IjBa(S ⁄ A)]. Cells were serum-starved for 24 h and stimu-
lated for 4 h with 60 UÆmL
)1
IL-1b. Graphs present fold increase of
MCPIP transcript level normalized to unstimulated cells. The results
are means ± SD of three experiments. Student’s t-test was used
for statistics: **P < 0.01.
L. Skalniak et al. Interplay between NF-kappaB and MCPIP RNase
FEBS Journal 276 (2009) 5892–5905 ª 2009 The Authors Journal compilation ª 2009 FEBS 5893
it to be the strongest TSS of the ZC3H12A gene in
HepG2 cells and designated the corresponding nucleo-
tide as +1 in the gene sequence (Fig. 2D). The second
group of sequences obtained in the experiment cover
the remaining 40% of the clones and start three nucle-

otides downstream at the +4 position.
Two potential elements of the classical-type poly-
merase II promoter: TATA box and Initiator element
(Inr) were found in the nearest neighbourhood of the
described TSSs (Fig. 2D). In addition, the two TSSs of
ZC3H12A are the most represented in the Expressed
Sequence Tags database as 5¢-ends of sequences under-
going transcription and corresponding to MCPIP-
coding transcript (Fig. 2B). This additional proof
increases the reliability of indicated TSSs.
Computational analysis of potential jB sites
within the ZC3H12A gene and in its
neighbourhood
Transcription regulatory elements are commonly
located within a short sequence upstream of the mini-
mal promoter. Nevertheless, many groups have
reported the presence of regulatory elements more dis-
tant either upstream or downstream of the regulated
gene, as well as within the gene [8–10]. In order to
localize potential regulatory elements in the human
ZC3H12A locus containing NF-jB-binding sites, com-
putational transcription factor binding-site prediction
analysis was performed. The sequence ranging from
)2.5 kb and reaching the end of the ZC3H12A gene
(+9796 bp) was analysed using the consite online
tool [11]. Human Rel-family protein (c-Rel, p50 and
p65) potential binding sites were detected with the TF
score cut-off of 85%. The result of the computational
analysis is presented in Fig. 3.
The prediction procedure revealed the accumulation

of potential NF-jB-binding sites within the second
intron of the ZC3H12A gene. Thus, after initial experi-
mental verification of the activity of the ZC3H12A
promoter region, we focused on this intronic sequence
while designing further luciferase deletion mutants (see
below).
ZC3H12A minimal promoter
Computational analysis identified no significant poten-
tial NF-jB-binding site within the region directly
upstream of the ZC3H12A gene and suggested the
existence of only two potential c-Rel recognition sites
within the first intron of the gene (Fig. 3). To verify
the importance of those two sites and to investigate
the ZC3H12A promoter potential toward gene activa-
tion in response to IL-1b stimulation, initial deletion
mutants were constructed (Fig. 3, constructs F2-R2,
F3-R2 and F4-R2). Luciferase activity assay revealed
that the observed ability of the ZC3H12A promoter-
containing vectors to mediate transcription induction
is significantly below the observed increase of the
MCPIP transcript level after IL-1b stimulation
(2.5- versus >14-fold increase in the fourth hour of
stimulation; Fig. 3). It is rather comparable with the
induction of luciferase gene transcription driven by an
empty vector (Fig. 3). These observations, together
A
B
C
D
Fig. 2. Analysis of ZC3H12A transcription start site localization. (A) Set of the ZC3H12A gene transcription start sites represented by entries

in Entrez Gene database. (B) Visualization of 5¢-ends of sequences extracted from Expressed Sequence Tags database revealed by BLAST
search with the ZC3H12A gene query. The size of the arrows corresponds to the number of entries in dbEST matching the particular 5¢-end.
(C) The result of 5¢ RLM-RACE experiment. Numbers denote the percent of sequenced clones corresponding to each sequence. (D) Visuali-
zation of ZC3H12A minimal promoter with determined transcription start sites and putative promoter elements of the gene. Inr ) initiator,
+1 indicates the major TSS.
Interplay between NF-kappaB and MCPIP RNase L. Skalniak et al.
5894 FEBS Journal 276 (2009) 5892–5905 ª 2009 The Authors Journal compilation ª 2009 FEBS
with the absence of potential jB sites within the near-
est 5¢ neighbourhood of the first exon, suggest that
IL-1b-dependent transcription activation of the gene
requires other regulatory elements.
Further experiments revealed that the shortest exam-
ined sequence which maintains full activity of the
ZC3H12A promoter is located between nucleotide
)124 and +18 (Fig. 3, construct F14-R9). Therefore,
this construct was used to generate further constructs
for experiments testing the postulated transcription
enhancer (see below).
Localization of transcription enhancer in the
second intron of the ZC3H12A gene
As described previously, computational analysis
revealed the presence of potential NF-jB-binding sites
in the second intron of the ZC3H12A gene. For this
reason, we focused on this region while preparing fur-
ther reporter gene constructs. A luciferase activity
assay showed that only two constructs containing the
longest fragments of the second intron of the
ZC3H12A gene are able to significantly increase the
transcript level after IL-1 b stimulation. This indicates
the presence of IL-1b-responding elements within a

sequence located between nucleotides +2626 and
+2950 (Fig. 3), which was earlier predicted to contain
multiple potential jB sites. Taking into account this
prediction, a shorter sequence from this region was
extracted (+2791 to +3088) and termed EnhA. For
further experiments, this sequence was then fused with
a minimal promoter of the ZC3H12A gene to create
an A ⁄ F14-R9 construct, the activity of which was com-
parable with F2-R7 and F2-R8 constructs (Fig. 3). The
c-REL
c-REL
c-REL
c-REL
c-REL
c-REL
c-REL
c-REL
c-REL
c-REL
c-REL
c-REL
c-REL
c-REL
c-REL
c-REL
p50
p50
p50
p50
p50

p50
p50
p50
p65
p65
p65
p65
p65
p65
p65
Fig. 3. Localization of IL-1b-responding element in the second intron of the ZC3H12A gene, as revealed by luciferase activity assay. The
upper part of the figure represents computational prediction of putative NF-jB-binding sites within the ZC3H12A gene. The analysis was
performed starting from 2.5 kb upstream from the transcription start site. The sequence was analysed with
CONSITE software towards
Homo sapiens Rel family members: c-Rel, p50 and p65 with the TF score cut-off of 85%. For luciferase activity assay HepG2 cells were
transfected with 25 fmol of pGL4.17[luc2 ⁄ Neo] plasmid containing investigated fragments of ZC3H12A cloned adjacent to luc2 reporter
gene, and 5 fmol of pEF1 ⁄ Myc–His ⁄ Gal vector coding for b-galactosidase as an internal transfection control. Following 48 h incubation, cells
were stimulated for 8 h with 60 UÆmL
)1
of IL-1b and chemiluminescence-based luciferase activity assay was performed. Each data point rep-
resents the mean ± SD of three independent experiments, each performed in duplicates, and is presented as fold stimulation (normalized
firstly to b-galactosidase and then to basal construct activity). Student’s t-test was used for statistics: **P < 0.01. luc2, reporter gene; E1,
E2, E3, E4, E5, E6, ZC3H12A exons; —, intron ⁄ intergenic sequence; h, noncoding exonic region;
, coding region; EnhA, sequence bearing
multiple potential NF-jB-binding sites localized in second intron of the ZC3H12A gene.
L. Skalniak et al. Interplay between NF-kappaB and MCPIP RNase
FEBS Journal 276 (2009) 5892–5905 ª 2009 The Authors Journal compilation ª 2009 FEBS 5895
presence of NF-jB-binding sites within the EnhA
region was confirmed by chromatin immunoprecipita-
tion assay, in which an antibody against the human

p65 NF-jB subunit was used (Fig. 4B).
EnhA enhancer contains four NF-jB-binding sites
To increase the sensitivity of NF-jB-binding site pre-
diction within the EnhA sequence, computational anal-
ysis was repeated using the consite online tool and a
TF score cut-off of 78%. The analysis revealed the
presence of four potential binding sites for NF-jB
subunits. Each of these sites was given a separate label:
N1, N2, N3 and N4, in accordance with the decreasing
TF score. Then, point mutagenesis was carried out on
the A ⁄ F14-R9 construct in order to create four mutant
forms of this construct, deprived of consecutive sites.
The primers used in the point mutagenesis procedure
are listed in Table 1.
The luciferase activity assay indicated the importance
of each of the predicted binding sites after IL-1b stimu-
lation (Fig. 4A) suggesting their potential role in acti-
vation of ZC3H12A gene transcription. In addition, the
mutagenesis of all four jB sites together reduced the
transcription-activating potential of the A ⁄ F14-R9 con-
struct to the base level observed for the F14-R9 con-
struct. To verify the ability of sites N1–N4 to bind
activated NF-jB complexes, EMSA was performed.
Radiolabelled probes corresponding to the original
sequences of nominated NF-jB-binding sites and to the
sequences carrying identical mutations as mutant forms
of the A ⁄ F14-R9 construct were used (Fig. 4C). The
probes used in this experiment are listed in Table 2.
For each probe bearing an original sequence of the
examined NF-jB-binding site, the gel-shift band was

observed after stimulation with IL-1b (Fig. 4C, lanes
2). The band corresponding to the NF-jB ⁄ probe
complex was present neither in lane 1 (original probes,
control cells), nor in lanes 3 and 4 (mutated probes,
control cells and cells stimulated with IL-1b,
respectively), indicating that the shift is stimulation-
dependent and all mutations abolish the NF-jB-bind-
ing capability of the examined binding sites. Addition
of a 100-fold excess of a cold original probe as a bind-
ing competitor also abolished the formation of
observed complexes (lanes 5).
To further examine the composition of the com-
plexes observed in lane 2 (Fig. 4C), a supershift
assay was performed with antibodies against human
p65 and p50 NF-jB subunits. A characteristic super-
shift band was observed for all examined probes
when anti-p65 was added (Fig. 4C, lanes 6), suggest-
ing the presence of this subunit in the NF-jB ⁄ probe
complexes. Interestingly, the addition of anti-p50
IgG (lanes 7) resulted in a weakening of the signal
corresponding to the shifted band in comparison
with the signal observed for control antibody (lanes
8). The described effect of antibody addition may
result from competition between antibody and DNA
probe in binding to the p50 NF-jB subunit. In our
hands, this is a common phenomenon observed for
supershift assays with probes known to bind NF-jB
complexes (see Fig. 5, lane 2 and 3). The obtained
result suggests that at least some NF-jB com-
plexes bound to sites N1, N3 and N4 contain p50

subunits.
Fig. 4. Verification of four putative NF-jB-binding sites, localized in the second intron of the ZC3H12A gene in the EnhA sequence. (A) The
effect of point mutagenesis of jB sites on transcription activation properties of the A ⁄ F14-R9 construct, as measured by luciferase activity
assay. HepG2 cells were transfected with 25 fmol of pGL4.17[luc2 ⁄ Neo] plasmid or the plasmid containing fragments of ZC3H12A regula-
tory elements cloned adjacent to luc2 luciferase-coding reporter gene, as indicated on the figure, and 5 fmol of pEF1 ⁄ Myc–His ⁄ Gal vector
coding b-galactosidase as an internal transfection control. Following 48 h of incubation, cells were stimulated with 60 UÆmL
)1
of IL-1b for
8 h and chemiluminescence-based luciferase activity assay was performed. Each data point represents the mean ± SEM of three experi-
ments, each performed in duplicate, and is presented as fold stimulation (normalized first to b-galactosidase and then to basal construct
activity). Student’s t-test was used for statistics: *P < 0.05. luc2, reporter gene; N1, N2, N3, N4, putative jB sites; E1, E2, E3, E4, E5, E6,
ZC3H12A exons; —, intron ⁄ intergenic sequence; h, noncoding exonic region;
, coding region, red cross indicates the mutation of the jB
site. (B) Chromatin immunoprecipitation experiment indicating the presence of NF-jB-binding sites within the EnhA sequence. PCR was
performed on 10· (1 : 10) or 100· (1 : 100) diluted, sonicated DNA isolated from control and stimulated cells (Input) and on the same DNA
samples subjected to immunoprecipitation with antibody against p-65 NF-jB subunit (ChIP, a-p65). Unspecific antibodies served as an iso-
type control (IgG) of the chromatin immunoprecipitation experiment. Primers used in PCR were designed to amplify the EnhA sequence in
the ZC3H12A gene (MCPIP) or the IjBa gene promoter region containing known NF-jB-binding sites as a control (IjBa). Primers are listed
in Table 1. (C) Verification of the relevance of four NF-jB-binding sites from the EnhA sequence by EMSA. Nuclear extracts isolated from
IL-1b-stimulated ⁄ unstimulated HepG2 cells were incubated with radiolabelled oligonucleotides corresponding to N1, N2, N3 and N4 jB sites
(wt) or mutant forms of these oligonucleotides deprived of NF-jB recognition sequences (mut). A radiolabelled oligonucleotide bearing the
NF-jB-binding sequence from the HIV enhancer was used as a positive control (lanes 9 and 10). Lanes 1, 3 and 9, extracts from unstimu-
lated Hep-G2 cells; lanes 2, 4-8 and 10, extracts from Hep-G2 stimulated for 40 min with 60 UÆmL
)1
IL-1b; lane 5, the effect of addition of a
100-fold excess of cold probe; lanes 6–8, the effect of addition of antibody against p-65 (lane 6), p-50 (lane 7) or control antibody (lane 8).
Interplay between NF-kappaB and MCPIP RNase L. Skalniak et al.
5896 FEBS Journal 276 (2009) 5892–5905 ª 2009 The Authors Journal compilation ª 2009 FEBS
A
B

C
L. Skalniak et al. Interplay between NF-kappaB and MCPIP RNase
FEBS Journal 276 (2009) 5892–5905 ª 2009 The Authors Journal compilation ª 2009 FEBS 5897
MCPIP exerts an inhibitory effect on NF-jB
activation
It was shown recently that MCPIP overexpression
abolishes the p65-induced transcription from NF-jB-
activated promoters [5]. To further test the influence of
MCPIP on the NF-jB signalling pathway, EMSA was
performed. HepG2 cells were transfected either with
the construct coding for MCPIP, or with an empty
vector, and stimulated for 40 min with 60 UÆmL
)1
of
IL-1b. Alternatively, cells were treated with siRNA
specific for MCPIP and stimulated in the same
manner. Following stimulation, nuclear extracts were
isolated and the formation of NF-jB ⁄ DNA complexes
was examined using a radiolabelled probe named
NF-jBor (Table 2) bearing a well-known NF-jB-
binding DNA sequence from the human immuno-
deficiency virus enhancer [12] (Fig. 5A). Overexpres-
sion of MCPIP was confirmed by western blotting
(Fig. 5B) and siRNA-mediated inhibition of MCPIP
gene expression was verified by real-time PCR
(Fig. 5C).
Stimulation of cells with IL-1b resulted in activation
of NF-jB in control cells (Fig. 5, lanes 1–3, 5 and 9).
To ensure that the observed shift is a consequence of
binding of the NF-jB transcription factor, the involve-

ment of the p65 NF-jB subunit in formed complexes
was confirmed by the addition of a p65-specific anti-
body, resulting in the appearance of a supershift band
(lane 1). Moreover, addition of an anti-p50 IgG
weakened the NF-jB gel-shift signal, suggesting the
presence of complexes containing this subunit (lane 2).
Control anti-STAT1 IgG had no influence on the
observed gel band shift (lane 3).
Overexpression of MCPIP significantly reduced the
signal of activated NF-jB bound to the radioactive
probe (lane 7 versus 5). Conversely, MCPIP silencing
augmented the activation of NF-jB (lane 13 versus
11 and 9). Both results suggest the presence of an
inhibitory effect of the MCPIP protein on NF-jB
activation.
MCPIP inhibits the induction of NF-jB dependent
genes
It was shown that in cells overexpressing MCPIP and
stimulated with lipopolysaccharide (LPS) activation of
NF-jB-dependent genes is reduced [5]. To test this in
our model, HepG2 cells were transfected with a vector
encoding MCPIP or treated with siRNA specific for
MCPIP. Cells were then stimulated with IL-1b and the
expression of transcripts coding for tumour necrosis
factor a (TNFa) and IjBa, well known NF-jB targets,
was examined using real-time PCR. Overexpression of
MCPIP resulted in a lowering of the amount of both
TNFa- and IjBa-coding transcripts (Fig. 6A), whereas
silencing of the gene increased the transcript level of
those proteins after IL-1b treatment (Fig. 6B). Overex-

pression of MCPIP was confirmed by western blotting
and the silencing of MCPIP was verified by real-time
PCR (Fig. 6A and B, respectively, left-hand panel).
Discussion
Expression of the ZC3H12A gene was previously
shown to be induced by inflammation-related factors,
such as MCP-1, TNF a, LPS and IL-1b [1,5]. More-
over, the importance of the ZC3H12A gene product,
namely MCPIP, has been postulated in the immune
system. The protein was identified as being able to
reduce macrophage activation upon LPS recognition in
the murine macrophage cell line Raw264.7 [5]. The
authors concluded that MCPIP may be involved in the
regulation of macrophage activation and implicated in
the pathogenesis of inflammatory diseases.
In this study, we identified two major transcription
start sites of the ZC3H12A gene. Computational anal-
ysis of the direct neighbourhood of those TSSs indi-
cated the presence of two motifs with high similarity
to well-characterized cis-acting elements of the RNA
polymerase II core promoter: the TATA box and the
Inr element [13]. Thus, it seems that the ZC3H12A
promoter belongs to the TATA-containing group of
RNA polymerase II core promoters.
Large-scale mapping of human minimal promoter
topology revealed that promoters of genes displaying
tissue-specific expression often contain a TATA box
element within the minimal promoter region. Previous
studies have shown that TATA box-associated pro-
moters are involved in the tight regulation of genes,

allowing diversification of expression in different cell
types under various conditions [14]. These data seem
to be in accordance with our recent observation that
the level of MCPIP mRNA varies between different
tissues. However, the functionality of the predicted
TATA box needs to be verified experimentally. The
existence of two or more TSSs within the Inr element
is not an unusual situation, because transcription initi-
ation sites are currently known to be described rather
as short sequences than a single nucleotide [15].
Interestingly, none of the TSSs revealed in the RACE
experiment match any of the TSSs postulated previ-
ously. However, this does not imply that those sites are
irrelevant, because their existence may be a part of the
mechanism altering the expression of the ZC3H12A
gene in other tissues [14,16]. Additional transcription
Interplay between NF-kappaB and MCPIP RNase L. Skalniak et al.
5898 FEBS Journal 276 (2009) 5892–5905 ª 2009 The Authors Journal compilation ª 2009 FEBS
start sites could then be engaged in altered transcrip-
tion initiation in some other cell types.
It is well known that at least three species of mole-
cules activating ZC3H12A expression (TNFa, LPS and
IL-1b) are potent inducers of the NF-jB signalling
pathway [17]. Our studies on IL-1b-induced ZC3H12A
gene activation provide proof of the NF-jB-depen-
dency of the transcriptional induction of this gene.
Using both computational and experimental
approaches, we identified a transcription enhancer con-
taining four NF-jB-binding sites located within the
second intron of the ZC3H12A gene. We postulate

that this enhancer, termed EnhA, mediates the activa-
tion of ZC3H12A upon IL-1b stimulation. However,
taking into consideration that other proinflammatory
molecules may act through distinct signal transduction
pathways, the question of whether the gene response
to those stimulants also requires EnhA activation
warrants future investigation.
In this study, we also show that MCPIP exerts an
inhibitory effect on the activation of the transcrip-
tion factor NF-jB. This inhibitory effect results in
decreased induction of transcript levels for NF-jB-
dependent genes, namely IjBa and TNFa. The
observations are in agreement with recently published
data showing NF-jB-mediated transcription inhibi-
tion in the case of MCPIP overexpression [5]. These
results argue that the MCPIP protein acts as a novel
negative regulator for the NF-jB signalling pathway.
Because the ZC3H12A gene was shown to be
induced predominantly in a NF-jB-dependent man-
ner, this observation places the MCPIP in the nega-
tive regulatory loop of the cell’s response to the
inflammatory state.
NF-jB is a transcription factor known to play a
central and crucial role in regulating such complex
Table 2. Oligonucleotides used as molecular probes for EMSA.
Font styles provide the following information: bold, nucleotides
within NF-jB binding sites that were subjected to mutagenesis.
Probe name Primers alignment
NF-jBor 5¢ AGCTTCAGAGGGGACTTTCCGAGAGG 3¢
3¢ AGTCTCCCCTGAAAGGCTCTCCTCGA 5¢

GSN1or 5¢ AGGAGGGGAATTCCAGC 3¢
3¢ TCCCCTTAAGGTCGGAG 5¢
GSN1mu 5¢ AGGAGCTCAATTCGAGC 3¢
3¢ TCGAGTTAAGCTCGGAG 5¢
GSN2or 5¢ GGTGGGGAAATTCACC 3¢
3¢ CCCCTTTAAGTGGAGG 5¢
GSN2mu 5¢ GGTGGCCAAAGGTACC 3¢
3¢ CCGGTTTCCATGGAGG 5¢
GSN3or 5¢ GGCTCGGGGGTTTCTG 3¢
3¢ AGCCCCCAAAGACTGG 5¢
GSN3mu 5¢ GGCTCGGAGGCATATG 3¢
3¢ AGCCTCCGTATACTGG 5¢
GSN4or
5¢ GGAAGGGAATTTTTT 3¢
3¢ TCCCTTAAAAAAAGG 5¢
GSN4mu 5¢ GGAAGGAGATCTTTT 3¢
3¢ TCCTCTAGAAAAAGG 5¢
Table 1. Primers used in experimental approaches. All sequences
are given in the 5¢fi3¢ direction. Font styles provide the follow-
ing information: bold, ZC3H12A start codon mutation and nucleo-
tides within NF-jB binding sites that were subjected to
mutagenesis; italic, restriction enzyme recognition site. RLM-RACE,
RNA ligase-mediated rapid amplification of cDNA ends; ChIP, chro-
matin immunoprecipitation.
Primer Sequence
Real-time PCR primers
ZFFq GGCAGCGACCTGAGACCAGTG
ZFRq GGTGTGTGATGGGCACGTCGG
hqIkBaF AACCTGCAGCAGACTCCACTCC
hqIkBaR ACACGTGTGGCCATTGTAGTTGG

hTNFf CAGGCGGTGCTTGTTCCTCAG
hTNFr GGGCTACAGGCTTGTCACTCG
EF2F GACATCACCAAGGGTGTGCAG
EF2R TCAGCACACTGGCATAGAGGC
Primers used in the RLM-RACE procedure
raceF1 CGACTGGAGCACGAGGACACTGA
raceR1 AGCCCAGCTTCCGGAAGAAGTCC
raceF2 GGACACTGACATGGACTGAAGGAGTA
raceR2 CCCAGATCTGCCACTGATAGCTCAGACTCCTG
Primers used for constructs preparation
F2 CCG CTCGAG CTCCAGCGTGTGGGCTCTGTG
F3 CCG CTCGAG CCGTCCGCACCTCGGTCAGTG
F4 CCG CTCGAG AGCAGGAAGGGGCGAGGCAGC
F11 CCC AGATCT CCCTGTGGAGAGAAGCCTGTCC
F14 CCG CTCGAG AGGCAGCCCCGCCCCCGGG
R2 CCC AGATCT GCCACTGATAGCTCAGACTCCTG
R4 CATTCCTGTGCTGGGGGAT
R6 GCTACATGAGGCTGGACACT
R7 CCC AAGCTT TTGCATATGATGGGGGGGCTAGC
R8 CCC GGATCC AAGCTT GCTGGGAGGGAGAGGACAGGG
R9 CCC AAGCTT TCCATGGGGCCGAGTCCTGGG
EnhAF1 CCG GGTACC TGAGAAGCAGAGCCACGCACCC
EnhAR1 CCG CTCGAG CCAGCTAGGCTGCTCCTGCCC
Point mutagenesis
MuN1F GGTAGTGGCAG GAGCTC AATTCG
AGCCTCAAACTTCC
MuN1R GGAAGTTTGAGGCTCGAATT GAGCTC CTGCCACTACC
MuN2F CATATGCAAATCATGGCCAAA GGTACC TCTGTTTCC
MuN2R GGAAACAGA GGTACC TTTGGCCATGATTTGCATATG
MuN3F CGCACCCACCTCGGAGG CATATG AGCTGGGGTAGTGGC

MuN3R GCCACTACCCCAGCT CATATG CCTCCGAGGTGGGTGCG
MuN4F CTGTTTCCTTCTAAGG AGATCT TTTTCCACTCGCCAGGC
MuN4R GCCTGGCGAGTGGAAAA AGATCT CCTTAGAAGGAAACAG
ChIP
ChipF CCGGGTACCTGAGAAGCAGAGCCACGCACCC
ChipR CCCAAGCTTAGAAGGAAACAGAGGTGAATTTCCC
ChipIkBf GACGACCCCAATTCAAATCG
ChipIkBr TCAGGCTCGGGGAATTTCC
L. Skalniak et al. Interplay between NF-kappaB and MCPIP RNase
FEBS Journal 276 (2009) 5892–5905 ª 2009 The Authors Journal compilation ª 2009 FEBS 5899
processes as the immune response, differentiation and
tumorigenesis [18,19]. The diversity of biological roles
fulfilled by NF-jB is achieved throughout a sophisti-
cated regulatory network, providing discriminatory
effects in signal transduction pathways initiated by
diverse stimulatory factors. Much effort has been made
recently to uncover those networks, because these
incontestably increase our understanding of many
physiological and pathological processes, enabling the
improvement of many NF-jB-associated disease treat-
ments [20]. This study, along with other recent studies
cited in this article, determines the MCPIP protein as
a novel cog in the NF-jB-regulating machine. Despite
the reliability of both the observed NF-jB influence on
ZC3H12A transcription and the negative effect of
MCPIP on NF-jB activation, the exact mode and
stage of MCPIP action still need to be determined.
Altogether, observations concerning the mutual
regulatory effect between MCPIP and NF-jB, its
implication in the inflammatory state and the ambi-

guous nature of the protein’s action, make MCPIP an
interesting object to study and a putative target for
future therapeutic approaches.
Materials and methods
Materials and reagents
Human recombinant IL-1b was purchased from Promokine
(Heidelberg, Germany). Restriction endonucleases, i.e.
KpnI, XhoI, HindIII, SacI, KpnI, NdeI and BglII, were
obtained from New England Biolabs (Ipswich, MA, USA).
Rabbit polyclonal IgG antibodies specific for human p65
(cat. sc-109), p50 (cat. sc-114) and unspecific IgG were from
Santa Cruz Biotechnology (Santa Cruz, CA, USA).
[
32
P]dCTP[aP] was purchased from Hartmann Analytic
GmbH (Braunschweig, Germany).
Cell lines
Human hepatocellular carcinoma-derived cells (HepG2 line
from ATCC) were cultured in Dulbecco’s Modified Eagle’s
A
B
C
Fig. 5. MCPIP inhibits NF-jB activation after
IL-1b stimulation. (A) EMSA presenting the
effect of MCPIP overexpression and
silencing on NF-jB activation. For the
experiment HepG2 cells were cultured on
six-well plates and transfected with a
MCPIP-containing construct (lanes 6 and 7)
or an empty vector (lanes 1–5). For MCPIP

silencing cells were treated with 50 n
M
MCPIP siRNA (lanes 12 and 13) or scram-
bled siRNA (lanes 10 and 11) and plated on
a 12-well plate. In addition, untreated cells
were analysed (lanes 8 and 9). After 48 h
cells were stimulated for 40 min with
60 UÆmL
)1
of human recombinant IL-1b
(lanes 1–3, 5, 7, 9, 11 and 13). Unstimulated
cells were used as a control (lanes 4, 6, 8,
10 and 12). Nuclear extracts were incubated
with radiolabelled oligonucleotides bearing
the NF-jB-binding DNA sequence from the
HIV enhancer. Lane 1, 2 and 3 represent
the effect of addition of antibody against
p-65, p-50 and control anti-STAT1 IgG,
respectively. Overexpression of MCPIP was
verified by western blotting (B) and MCPIP
silencing was verified by real-time PCR (C).
Student’s t-test was used for statistics:
**P < 0.01.
Interplay between NF-kappaB and MCPIP RNase L. Skalniak et al.
5900 FEBS Journal 276 (2009) 5892–5905 ª 2009 The Authors Journal compilation ª 2009 FEBS
Medium (Sigma, St Louis, MO, USA) supplemented with
5% (v ⁄ v) fetal bovine serum (Gibco, Carlsbad, CA, USA).
Cell cultures were maintained at 37 °C in a humidified atmo-
sphere of 5% CO
2

and passaged every 4–5 days. For experi-
ments, cells were seeded on poly- l -lysine (Sigma) coated
12- or 24-well plates (BD Falcon, San Jose, CA, USA).
HepG2 cells stably transduced with a retroviral vector
encoding green fluorescent protein alone (HepG2-mock), or
encoding both green fluorescent protein and the dominant
negative form of the IjBa inhibitor [HepG2-IjBa(S ⁄ A)],
were kindly provided by S. Ludwig (Heinrich-Heine Uni-
versity, Du
¨
sseldorf, Germany) [7]. The transduced cells
were cultivated in Dulbecco’s modified Eagle’s medium
with 5% (v ⁄ v) fetal bovine serum and 1 mgÆmL
)1
Zeocin
(Invitrogen, Carlsbad, CA, USA).
MCPIP silencing
siRNA for MCPIP (5¢-CCCUGUUGAUACACAUU-
GUTT), as well as scrambled siRNA were obtained from
Ambion. Transfection was performed with siPORT NeoFx
agent (Ambion, Austin, TX, USA) according to the manu-
facturer’s protocol. Shortly, for single transfection 3 lLof
siPORT NeoFx and siRNA to a final concentration of
50 nm were diluted separately in 50 lL of OPTI-MEM,
A
B
Fig. 6. Effect of MCPIP overexpression (A) and silencing (B) on induction of IjBa and TNFa transcript level after stimulation with IL-1b.
HepG2 cells were cultured on 12-well plates and transfected with MCPIP-containing construct or an empty vector as indicated (A). For
MCPIP silencing cells were treated with 50 n
M MCPIP siRNA or scrambled siRNA as indicated (B) and plated on 12-well plate. After 48 h

cells were stimulated for 3 h with 60 UÆmL
)1
of human recombinant IL-1b and transcript level for IjBa (A and B, central panel) and TNFa (A
and B, right-hand panel) was examined by real-time PCR. Overexpression of MCPIP was verified by western blotting (A, left-hand panel) and
MCPIP silencing was verified by real-time PCR (B, left-hand panel). Student’s t-test was used for statistics: *P < 0.05, **P < 0.01,
***P < 0.001.
L. Skalniak et al. Interplay between NF-kappaB and MCPIP RNase
FEBS Journal 276 (2009) 5892–5905 ª 2009 The Authors Journal compilation ª 2009 FEBS 5901
after 10 min of incubation they were combined and left for
another 10 min to allow complex formation. Next, the mix-
ture was dispensed on 12-well plates and overlaid with
8 · 10
4
HepG2 cells. The effect of gene silencing was
assessed 48 h post transfection.
Real-time PCR
For RNA isolation, cells were seeded on poly-l-lysine
coated 12-well plates, serum-starved overnight in Opti-Mem
serum-free medium (Gibco) and stimulated for 4 h with
60 UÆmL
)1
of IL-1b. Cells were washed twice with NaCl ⁄ P
i
and total RNA was isolated using the modified Chomczyn-
ski–Sacchi method, as described previously [2]. RNA
concentration was measured with a ND-1000 spectropho-
tometer (NanoDrop, Wilmington, DE, USA) and RNA
integrity was verified on a 1% denaturating agarose gel.
For the real-time PCR experiment, 1 lg of total RNA
was reverse-transcribed using oligo(dT) 15 primer (Promega,

Madison, WI, USA) and M-MLV reverse transcriptase
(Promega). Following synthesis, cDNA was diluted 5· and
real-time PCR was carried out using Rotor-Gene 3000
(Corbett, Cambridge, UK) system and Sybr Green-based
master mix (Finnzymes, Espoo, Finland). After an initial
denaturation step for 10 min at 95 °C, conditions for cycling
were: 40 cycles of 20 s at 95 °C, 20 s at 62 °C and 30 s at
72 °C. The fluorescence signal was measured right after the
extension step at 72 °C. At the end of the PCR cycling, a
melting curve was generated to verify specificity of the PCR
product. For the normalization of each sample, the amount
of eukaryotic translation elongation factor 2 cDNA was
measured (primers EF2F and EF2R). All samples were run
in triplicates. The primers used in real-time PCR are listed
in Table 1.
Mapping the transcription start site
To investigate the human ZC3H12A transcription start site
localization, RLM-RACE was carried out with the GeneR-
acer Kit (Invitrogen). Total RNA from HepG2 cells was
isolated using the modified Chomczynski–Sacchi method
and processed according to the GeneRacer manual. The
raceR1 primer was used for the reverse transcription step
(Table 1). The first PCR was carried out with the use of
raceF1 and raceR1 primers. For the nested PCR, the prod-
uct of the first PCR was used and the specific product was
amplified with raceF2 and raceR2 primers (Table 1).
EMSA
HepG2, HepG2-mock and HepG2-IjBa(S ⁄ A) cell lines were
cultured on 60 mm cell culture dishes. After overnight serum
starvation, cells were stimulated for 40 min with 60 UÆmL

)1
IL-1b. Unstimulated cells served as an experimental control.
Nuclear extracts were prepared by a mini-extraction proce-
dure. After a brief wash with cold NaCl ⁄ P
i
, cells were
collected with a rubber policeman and centrifuged for 5 min
at 400 RCF. Pelleted cells were resuspended in 200 lLof
buffer containing 10 mm Hepes pH 7.9, 10 mm KCl, 0.1 mm
EDTA, 0.1 mm EGTA, 1 mm Na
3
VO
4
,1mm dithiothreitol,
0.2 mm phenylmethanesulonyl fluoride (Sigma) and
Complete Protease Inhibitor Cocktail (Roche, Basel,
Switzerland). After incubation on ice for 10 min, 15 lLof
10% Nonidet NP-40 was added. Nuclei were collected by
centrifugation at 500 g for 3 min at 4 °C and resuspended in
50 lL of extraction buffer (20 mm Hepes pH 7.9, 400 mm
NaCl, 1 mm EDTA, 1 mm EGTA, 1 mm Na
3
VO
4
,1mm
dithiothreitol and Complete Protease Inhibitor cocktail).
Samples were incubated for 15 min on ice and mixed by vor-
texing every 3 min. Following incubation, the nuclei were
centrifuged for 5 min at 14 000 g. Protein concentration was
determined by BCA assay (Sigma). For storage, glycerol was

added to a final concentration of 10% and nuclear extracts
were frozen in liquid nitrogen and placed at )80 °C. For the
NF-jB-directed EMSA, double-stranded probes were pre-
pared by equimolar mixing of primer pairs as indicated in
Table 2, denaturation at 98 °C for 5 min and refolding at
room temperature. One picomole of double-stranded probes
were labelled with 3.33 pmol of [
32
P]dCTP[aP] and Klenow
polymerase (Fermentas, Burlington, Canada) for 1 h at
37°C in the presence of 1 nmol dATP, dGTP and dTTP
mix. Radioactive probes were purified with QIAquick PCR
Purification Kit (Qiagen, Du
¨
sseldorf, Germany) and sus-
pended in 50 lL of Tris buffer.
Five micrograms of nuclear extracts from control cells
and cells stimulated with IL-1b were incubated for 10 min
at room temperature with 1 ng of poly(dI-dC) (Sigma) in
binding buffer (10 mm Hepes, pH 7.9, 100 mm NaCl,
0.5 mm EDTA, 10% v ⁄ v glycerol and 0.2 mm dithiothrei-
tol). Next, 1 lL of purified labelled probe was added and
samples were incubated for 45 min at room temperature.
For the supershift assay, after the initial 15 min of incuba-
tion with radiolabelled probe, the anti-p65, anti-p50 or con-
trol IgG was added as indicated in Fig. 4C and samples
were incubated at room temperature for additional 30 min.
Following incubation, the samples were loaded on 5%
(w ⁄ v) non-denaturating polyacrylamide gel. Electrophoresis
was run at 160 V for 2.5 h in 0.5 · TBE. Gels were trans-

ferred to 3 mm Chr chromatography paper (Whatman,
Maidstone, UK) and dried under vacuum. The bands were
visualized by 48 h exposure to a phosphoimage screen and
read using molecular imager fx and quantity one soft-
ware (BioRad, Hercules, CA, USA).
Computational analysis
All DNA sequences were extracted from the Entrez
Nucleotide database, National Center for Biotechnology
Interplay between NF-kappaB and MCPIP RNase L. Skalniak et al.
5902 FEBS Journal 276 (2009) 5892–5905 ª 2009 The Authors Journal compilation ª 2009 FEBS
Information (). To identify
potential NF-jB-binding sites within the ZC3H12A gene
and its promoter region, DNA sequence ranging from
)2500 to +9796 (3¢-end of the gene) was analysed with
ConSite regulatory elements prediction software (http://
www.phylofoot.org/consite) [11]. The sequence was analy-
sed towards Homo sapiens Rel family members: c-Rel, p65
and p50 with the TF score cut-off of 85%.
Constructs
To investigate regulatory elements controlling the human
ZC3H12A gene, a large panel of luciferase reporter con-
structs was prepared. ZC3H12A gene and promoter frag-
ments were PCR-amplified using AdvantageÔ 2 PCR
Enzyme System (BD Biosciences Clontech, Mountain View,
CA, USA) and cloned into the pGL4.17[luc2 ⁄ Neo] plasmid
(Promega) with T4 DNA ligase (New England Biolabs). All
constructs were verified by restriction digest and sequenc-
ing. All primers utilized in the preparation of the constructs
are listed in Table 1 and were designed basing on two
Entrez Nucleotide NCBI entries: AL449284 and AL034379.

The nucleotide corresponding to the TSS determined in the
RLM-RACE experiment (see below) was marked as ‘+1’
and the numeration presented here is related to this
nucleotide.
Constructs F2-R2, F3-R2 and F4-R2 (Fig. 3), containing
the first exon of the ZC3H12A gene, first intron and first
three codons of the ZC3H12A coding sequence, were pre-
pared with F2, F3, F4 and R2 primers and XhoI ⁄ BglII
restriction enzymes. Further constructs (F2-R4, F2-R6,
F2-R7 and F2-R8, Fig. 3) were prepared in a two-step
manner. First, the F2-R2 promoter region was cloned into
the pGL4.17[luc2 ⁄ Neo] vector using F2 and R2 primers and
XhoI ⁄ BglII restriction enzymes, and then the rest of the
DNA fragment was added by subsequent cloning with
BglII and HindIII (primers F11 and R4, R6, R7 or R8).
Additional constructs were prepared with the F14 and R9
primers and cloned with XhoI and HindIII enzymes (con-
struct F14-R9 containing the ZC3H12A minimal promoter:
nucleotides from )124 to +18, Fig. 3) or by initial cloning
with
XhoI and HindIII and subsequent cloning with KpnI
and XhoI with the use of primers EnhAF1 and EnhAR1 (i.e.
A ⁄ F14-R9). In all prepared constructs, the first ATG codon
of the ZC3H12A gene was subjected to mutagenesis
(ATG fi ATC) to allow the translation of the luciferase
reporter gene. The pEF1 ⁄ Myc–His ⁄ Gal plasmid encoding
b-galactosidase was used as an internal transfection control
for the luciferase activity assays.
Luciferase activity assay
HepG2 cells were plated onto poly-l-lysine-coated 24-wells

plates. Transfection was performed with Lipofectamine
2000 (Invitrogen) after overnight serum starvation in Opti-
Mem medium. For each transfection, 25 fmol of
pGL4.17[luc2 ⁄ Neo]-based constructs and 2.5 fmol of
pEF1 ⁄ Myc-His ⁄ Gal vector were used. After 12 h incuba-
tion, fresh Opti-Mem medium was applied and cells were
incubated for additional 36 h. Cells were stimulated for 8 h
with 60 UÆmL
)1
IL-1b and luciferase activity assay was per-
formed using chemiluminescence-based Dual-Light System
(Applied Biosystems, Foster City, CA, USA) according to
the manufacturer’s protocol. Unstimulated cells served as a
basal promoter activity control. Chemiluminescence was
measured with MiniLuminat LB 96P (EG&G Berthold,
Bad Wildbad, Germany). The luciferase activity of each
construct was normalized to b-galactosidase activity as an
integral transfection control. Data points were presented as
fold stimulation of promoter activity (normalized to basal
promoter).
Point mutagenesis
All point mutants presented here, except for the ATG
mutants described before, were prepared based on the
A ⁄ F14-R9 construct. For mutagenesis, the QuikChange XL
Site-Directed Mutagenesis Kit (Stratagene, Cedar Creek,
TX, USA) was used according to the manufacturer’s proto-
col. Mutations were designed in a way to introduce novel
restriction enzyme recognition sites (for sites N1, N2, N3
and N4 respectively SacI, KpnI, NdeI and BglII). Primers
used in this procedure (listed in Table 1) were HPLC-puri-

fied. All mutations were confirmed by restriction cleavage
and sequencing.
Chromatin immunoprecipitation
HepG2 cells were cultured on a 100 mm cell culture dish
and, where indicated, stimulated for 30 min with IL-1b
(60 UÆmL
)1
) after overnight serum starvation. Proteins were
cross-linked to DNA by incubation with 1% formaldehyde
for 10 min at 37 °C. The cells were washed with 0.125 m gly-
cine in NaCl ⁄ P
i
and collected with a rubber policeman in
1 mL of NaCl ⁄ P
i
containing Complete Protease Inhibitor
cocktail and 1 mm phenylmethanesulonyl fluoride. Cells
were pelleted and washed once with a buffer containing
10 mm Hepes, pH 6.5, 0.5 mm EGTA, 10 mm EDTA and
0.25% Triton X-100 and then with a buffer containing
10 mm Hepes, pH 6.5, 0.5 mm EGTA, 1 mm EDTA and
200 mm NaCl. Cells were lysed with lysis buffer (50 mm
Tris ⁄ HCl, pH 8.0, 1% SDS and 10 mm EDTA). Lysates
were sonicated to produce DNA fragments between 300 and
600 bp. After centrifugation, the samples were diluted 1 to
10 with IP buffer (16.7 mm Tris ⁄ HCl, pH 8.0, 0.01% SDS,
1.1% Triton X-100, 1.2 mm EDTA, 16.7 mm NaCl and
Complete Protease Inhibitor Cocktail) and immunoprecipi-
tated overnight at 4 °C using the anti-p65 IgG or the control
unspecific IgG. Following immunoprecipitation, samples

were incubated for 1 h with 20 lg of salmon testes DNA
L. Skalniak et al. Interplay between NF-kappaB and MCPIP RNase
FEBS Journal 276 (2009) 5892–5905 ª 2009 The Authors Journal compilation ª 2009 FEBS 5903
(Sigma) and 200 lg of BSA and then 20 lL of protein G
dynal beads (Dynal Biotech, Oslo, Norway) was added to
each sample. After a 3 h incubation, the beads were washed
with the following buffers: TSE I (20 mm Tris, pH 8.0, 2 mm
EDTA, 150 mm NaCl, 1% Triton X-100 and 0.1% SDS),
TSE II (20 mm Tris, pH 8.0, 2 mm EDTA, 500 mm NaCl,
1% Triton X-100 and 0.1% SDS), Buffer III (10 mm Tris,
pH 8.0, 0.25 m LiCl, 1 mm EDTA, 1% NP-40 and 1%
sodium deoxycholate) and TE (10 mm Tris, pH 8.0 and
1mm EDTA). DNA was eluted with elution buffer (0.1 m
NaHCO
3
and 1% SDS). NaCl (200 mm) was added to the
eluted samples and to the input samples and cross-linking
was reversed by overnight incubation at 65 °C. After diges-
tion with 20 lg of proteinase K for 1 h at 45 °C, DNA
was purified using a Qiagen PCR cleanup kit. Primers
ChipF and ChipR (Table 1) were used in the PCR to
amplify the human ZC3H12A second intron fragment,
ranging from +2791 to +2982, and containing postulated
NF-jB-binding sites. As a positive control a PCR was car-
ried out with primers specific to the IjBa promoter region
(Table 1, primers ChipIkBf and ChipIkBr).
Western blotting
Cytoplasmic extracts (20 lg) were separated on SDS ⁄ PAGE
10% polyacrylamide gel. Following electrotransfer to
poly(vinylidene difluoride) membrane (Millipore, Billerica,

MA, USA) and blocking in 2% BSA (BioShop, Burlington,
Canada) dissolved in Tris-buffered saline containing 0.1%
Nonidet, membranes were incubated with primary antibody
at 4 °C overnight. After addition of secondary antibodies,
chemiluminescence detection was performed using SuperSig-
nal (Thermo Scientific, Waltham, MA, USA). Membranes
were exposed to Kodak Medical X-ray Film (Kodak, New
York, NY, USA) and developed. The following antibodies
were used: rabbit anti-MCPIP (self-made, final concentration
1 lgÆmL
)1
); mouse anti-actin (1 : 5000; Sigma); peroxidase-
conjugated anti-rabbit (1 : 40 000; Sigma) and peroxidase-
conjugated anti-mouse (1 : 10 000, Sigma).
Acknowledgements
We thank Prof. Stephan Ludwig (Heinrich-Heine Uni-
versity, Du
¨
sseldorf, Germany) for delivering HepG2-
IjBa(S ⁄ A) and HepG2-mock cell lines. We would like
to thank Dr J. Miedzobrodzki (Department of Micro-
biology, Faculty of Biochemistry, Biophysics and
Biotechnology) for providing the luminescence micro-
plate reader used in the luciferase activity studies. The
work was supported by the European Community’s
FP6: MTKD-CT-2006-042586 and LSHM-CT-2006-
036903 and Polish Ministry of Scientific Research and
Information Technology: 63 ⁄ 6PR-UE ⁄ 2007 ⁄ 7 and 339 ⁄
6PR-UE ⁄ 2007 ⁄ 7.
References

1 Zhou L, Azfer A, Niu J, Graham S, Choudhury M,
Adamski FM, Younce C, Binkley PF & Kolattukudy
PE (2006) Monocyte chemoattractant protein-1 induces
a novel transcription factor that causes cardiac myocyte
apoptosis and ventricular dysfunction. Circ Res 98,
1177–1185.
2 Jura J, Wegrzyn P, Korostyn
´
ski M, Guzik K, Oczko-
Wojciechowska M, Jarzab M, Kowalska M, Piechota
M, Przewocki R & Koj A (2008) Identification of inter-
leukin-1 and interleukin-6-responsive genes in human
monocyte-derived macrophages using microarrays.
Biochim Biophys Acta 1779, 383–389.
3 Bidzhekov K, Zernecke A & Weber C (2006) MCP-1
induces a novel transcription factor with proapoptotic
activity. Circ Res 98, 1107–1109.
4 Niu J, Azfer A, Zhelyabovska O, Fatma S &
Kolattukudy PE (2008) Monocyte chemotactic
protein (MCP)-1 promotes angiogenesis via a novel
transcription factor, MCP-1-induced protein (MCPIP).
J Biol Chem 283, 14542–14551.
5 Liang J, Wang J, Azfer A, Song W, Tromp G, Kol-
attukudy PE & Fu M (2008) A novel CCCH-zinc finger
protein family regulates proinflammatory activation of
macrophages. J Biol Chem 283, 6337–6346.
6 Matsushita K, Takeuchi O, Standley DM, Kumagai Y,
Kawagoe T, Miyake T, Satoh T, Kato H, Tsujimura T,
Nakamura H et al. (2009) ZC3H12A is an RNase
essential for controlling immune responses by regulating

mRNA decay. Nature 458, 1185–1190.
7 Yang XP, Albrecht U, Zakowski V, Sobota RM, Ha
¨
us-
singer D, Heinrich PC, Ludwig S, Bode JG & Schaper
F (2004) Dual function of interleukin-1beta for the
regulation of interleukin-6-induced suppressor of cyto-
kine signaling 3 expression. J Biol Chem 279, 45279–
45289.
8 Cleynen I, Brants JR, Peeters K, Deckers R, Debiec-
Rychter M, Sciot R, Van de Ven WJ & Petit MM
(2007) HMGA2 regulates transcription of the Imp2 gene
via an intronic regulatory element in cooperation with
nuclear factor-kappaB. Mol Cancer Res 5, 363–372.
9 St Clair DK, Porntadavity S, Xu Y & Kiningham K
(2002) Transcription regulation of human manganese
superoxide dismutase gene. Methods Enzymol 349,
306–312.
10 Smith AN, Barth ML, McDowell TL, Moulin DS,
Nuthall HN, Hollingsworth MA & Harris A (1996)
A regulatory element in intron 1 of the cystic fibrosis
transmembrane conductance regulator gene. J Biol
Chem 271, 9947–9954.
11 Sandelin A, Wasserman WW & Lenhard B (2004)
ConSite: web-based prediction of regulatory elements
using cross-species comparison. Nucleic Acids Res 32,
W249–W252.
Interplay between NF-kappaB and MCPIP RNase L. Skalniak et al.
5904 FEBS Journal 276 (2009) 5892–5905 ª 2009 The Authors Journal compilation ª 2009 FEBS
12 Franza BR Jr, Josephs SF, Gilman MZ, Ryan W &

Clarkson B (1987) Characterization of cellular proteins
recognizing the HIV enhancer using a microscale DNA-
affinity precipitation assay. Nature 330, 391–395.
13 Juven-Gershon T, Hsu JY, Theisen JW & Kadonaga JT
(2008) The RNA polymerase II core promoter – the
gateway to transcription. Curr Opin Cell Biol 20, 253–
259.
14 Mu
¨
ller F, Deme
´
ny MA & Tora L (2007) New problems
in RNA polymerase II transcription initiation: matching
the diversity of core promoters with a variety of
promoter recognition factors. J Biol Chem 282,
14685–14689.
15 Suzuki Y, Taira H, Tsunoda T, Mizushima-Sugano J,
Sese J, Hata H, Ota T, Isogai T, Tanaka T, Morishita
S et al. (2001) Diverse transcriptional initiation revealed
by fine, large-scale mapping of mRNA start sites.
EMBO Rep 2, 388–393.
16 Kimura K, Wakamatsu A, Suzuki Y, Ota T, Nishikawa
T, Yamashita R, Yamamoto J, Sekine M, Tsuritani K,
Wakaguri H et al. (2006) Diversification of transcrip-
tional modulation: large-scale identification and charac-
terization of putative alternative promoters of human
genes. Genome Res 16, 55–65.
17 Mu
¨
ller JM, Ziegler-Heitbrock HW & Baeuerle PA

(1993) Nuclear factor kappa B, a mediator of lipopoly-
saccharide effects. Immunobiology 187, 233–256.
18 Hayden MS & Ghosh S (2008) Shared principles in
NF-kappaB signaling. Cell 132, 344–362.
19 Karin M (2006) Nuclear factor-kappaB in cancer devel-
opment and progression. Nature 441, 431–436.
20 Courtois G & Gilmore TD (2006) Mutations in the
NF-kappaB signaling pathway: implications for human
disease. Oncogene 25, 6831–6843.
L. Skalniak et al. Interplay between NF-kappaB and MCPIP RNase
FEBS Journal 276 (2009) 5892–5905 ª 2009 The Authors Journal compilation ª 2009 FEBS 5905