Báo cáo khoa học: Altered expression of tumor protein D52 regulates apoptosis and migration of prostate cancer cells potx

Altered expression of tumor protein D52 regulates
apoptosis and migration of prostate cancer cells
Ramesh Ummanni
1
, Steffen Teller
1
, Heike Junker
1
, Uwe Zimmermann
2
, Simone Venz
1
, Christian
Scharf
3
,Ju
¨
rgen Giebel
4
and Reinhard Walther
1
1 Department of Medical Biochemistry and Molecular Biology, University of Greifswald, Germany
2 Department of Urology, University of Greifswald, Germany
3 Department of Otorhinolaryngology, Head and Neck Surgery, University of Greifswald, Germany
4 Department of Anatomy and Cell Biology, University of Greifswald, Germany
Prostate carcinoma (PCA) is the most common cancer
among men. In 2002, an estimated 48 650 German
men were diagnosed with this disease and 11 839 died
from PCA (). Autopsy studies have
revealed that approximately 30% of men over the age
of 50 years have microscopic evidence of prostate

cancer [1]. In the sequence of molecular events playing
an important role in prostate cancer progression,
genetic alterations such as the gain or loss of chromo-
some 8 at 8q21 comprise important aberrations leading
Keywords
apoptosis; cell migration; cell proliferation;
prostate carcinoma; TPD52
Correspondence
R. Walther, Department of Medical
Biochemistry and Molecular Biology,
University of Greifswald,
F Sauerbruchstraße, D-17487 Greifswald,
Germany
Fax: +49 3834 865402
Tel: +49 3834 865400
E-mail:
(Received 13 August 2008, revised 16
September 2008, accepted 22 September
2008)
doi:10.1111/j.1742-4658.2008.06697.x
Tumor protein D52 (TPD52) is a protein found to be overexpressed in
prostate and breast cancer due to gene amplification. However, its physio-
logical function remains under investigation. In the present study, we inves-
tigated the response of the LNCaP human prostate carcinoma cell line to
deregulation of TPD52 expression. Proteomic analysis of prostate biopsies
showed TPD52 overexpression at the protein level, whereas its transcrip-
tional upregulation was demonstrated by real-time PCR. Transfection of
LNCaP cells with a specific small hairpin RNA giving efficient knockdown
of TPD52 resulted in significant cell death of the carcinoma LNCaP cells.
As demonstrated by activation of caspases (caspase-3 and -9), and by the

loss of mitochondrial membrane potential, cell death occurs due to apopto-
sis. The disruption of the mitochondrial membrane potential indicates that
TPD52 acts upstream of the mitochondrial apoptotic reaction. To study
the effect of TPD52 expression on cell proliferation, LNCaP cells were
either transfected with enhanced green fluorescence protein-TPD52 or a
specific small hairpin RNA. Enhanced green fluorescence protein-TPD52
overexpressing cells showed an increased proliferation rate, whereas
TPD52-depleted cells showed the reverse effect. Additionally, we demon-
strate that exogenous expression of TPD52 promotes cell migration via
avb3 integrin in prostate cancer cells through activation of the protein
kinase B ⁄ Akt signaling pathway. From these results, we conclude that
TPD52 plays an important role in various molecular events, particularly in
the morphological diversification and dissemination of prostate carcinoma
cells, and may be a promising target with respect to developing new thera-
peutic strategies to treat prostate cancer.
Abbreviations
2DE, 2D gel electrophoresis; DHT, dihydroxytestosterone; DIOC
6
, dihexyloxacarbocyanine iodide; EGFP, enhanced green fluorescence
protein; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide; PCA, prostate carcinoma; PI, propidium iodide; PKB ⁄ Akt, protein
kinase B; shRNA, small hairpin RNA; TPD52, tumor protein D52.
FEBS Journal 275 (2008) 5703–5713 ª 2008 The Authors Journal compilation ª 2008 FEBS 5703
to prostate cancer [2,3]. cDNA library analysis has
revealed the differential expression of a gene that was
further assigned as TPD52 and its locus has been
mapped on chromosome 8q21 [4,5]. Its encoding gene
is also referred to as PrLZ and is a member of the
tumor protein D52 (TPD52) gene ⁄ protein family and
is designated a proto-oncogene [6]. TPD52 is over-
expressed in breast cancer [7,8] prostate cancer [9,10]

as well as ovarian cancer [11] due to gene amplifica-
tion. The identification of TPD52 as a tumor associ-
ated antigen in breast cancer patients highlights its role
as a gene amplification target [12]. One study on
TPD52 gene characterization reported that epithelial
cells express TPD52 predominantly and that it may
play a role in the development of the epithelial cell
phenotype [13]. Its expression is controlled by andro-
gens in LNCaP cells [9]. The major circulating andro-
gen, testosterone, interacts with the androgen receptor
to control cellular processes such as proliferation,
apoptosis and other metabolic events in prostate
cancer [14]. Taken together, a combination of gene
amplification and androgen stimulation may cause
overexpression of TPD52 in prostate cancer. TPD52
undergoes post-translational modification (e.g. phos-
phorylation) and interacts with annexinVI and MAL2
in a calcium dependent manner [15–18]. Murine
TPD52 induces tumorigenesis and metastasis of
NIH3T3 fibroblasts [19]. Recent studies have demon-
strated that the PrLZ gene is reactivated and its
expression increases with cancer progression from pri-
mary to tumor metastasis [20] and that it activates the
protein kinase B (PKB ⁄ Akt) pathway, which plays an
important role in prostate cancer development and
progression [21]. Because the precise mechanism of the
function of TPD52 in prostate cancer progression is
still under investigation, the main objective of the pres-
ent study was the functional characterization of
TPD52 alterations in the androgen responsive prostate

cancer cell line LNCaP. The effect of TPD52 expres-
sion on different cellular events was examined to deter-
mine the role of TPD52 expression in prostate cancer.
Results
A protein profiling study on prostate biopsies identi-
fied differentially expressed proteins in cancer contain-
ing several proteins that are known to be dysregulated
in prostate cancer [22]. Among them, we identified
TPD52 as being overexpressed in PCA compared to
benign prostate epithelium (Fig. 1A). To determine
whether TPD52 is also overexpressed at the transcrip-
tional level, TPD52 mRNA was estimated by quantita-
tive real-time PCR from RNA isolated from the same
biopsies used for proteomic analysis. RPLP0 was used
as a house keeping gene to normalize expression levels
(Fig. 1B). Real-time PCR data have shown a signifi-
cant increase (Fig. 1C, box plots) of the amount of
TPD52 mRNA in PCA compared to benign prostatic
hyperplasia, suggesting that upregulated protein
expression in PCA is caused by an enhanced transcrip-
tion rate.
To assess the physiological effects of TPD52 expres-
sion on prostate cancer progression, enhanced green
fluorescence protein (EGFP)-TPD52 fusion protein
producing constructs were generated and expression of
the fusion protein in LNCaP cells was estimated by
fluorescence microscopy (Fig. 2A) and western blotting
TPD52
TPD52
BPH PCA

0.0
2.5
5.0
7.5
10.0
BPH
(n = 8)
PCA
(n = 12)
P < 0.0229
TPD52/RPLP0
0
2.5
5
7.5
10
TPD52/RPLP0
A
B
C
Fig. 1. TPD52 is overexpressed in prostate cancer. (A) Enlarged
region of SYPRO
Ò
Ruby stained 2DE gel images indicating tumor
protein D52 (TPD52) upregulation in PCA (right panel) and benign
prostatic hyperplasia (BPH) (left panel). (B) Quantitative reverse
transcription PCR of TPD52 transcripts shown from benign prostate
tissue (white bars, n = 8) and localized prostate cancer (black bars,
n = 12). (C) The ratio of PHB expression was normalized against
RPLP0 expression and this is graphically presented by box plots

with 95% confidence intervals (nonparametric two-tailed Mann–
Whitney test performed at 95% confidence interval, P < 0.0229).
Tumor protein D52 in prostate cancer R. Ummanni et al.
5704 FEBS Journal 275 (2008) 5703–5713 ª 2008 The Authors Journal compilation ª 2008 FEBS
(Fig. 2B) using anti-EFGP serum. On the other hand,
co-transfection (1 : 10 ratio) of pSUPER.neo-gfp
vector expressing small hairpin RNA (shRNA)
designed to downregulate TPD52 and recombinant
psiCHECKÔ-2-TPD52 vector followed by luciferase
assays confirmed the specificity of shRNA against the
TPD52 transcript (data not shown). Transfection of
pSUPER.neo-gfp vector expressing shRNA in EGFP-
TPD52 positive cells confirmed the downregulation of
TPD52 by up to 40% at the transcriptional level after
24 h (Fig. 2C,D). A significant downregulation was
observed at the protein level, as confirmed by western
blotting (Fig. 2E) with anti-EGFP serum and densito-
metric quantification. Corresponding bands revealed a
reduced expression of EGFP-TPD52 down to 40% of
the control level (Fig. 2F). No significant difference
was observed between nontransfected and mock trans-
fected cells.
Dysregulation of TPD52 affects the proliferation
rate of LNCaP cells
First, we studied whether overexpression or downregu-
lation of TPD52 influences the proliferation rate of
LNCaP cells. To determine the effect of TPD52
expression on cell proliferation, 3-(4,5-dimethylthiazol-
2-yl)-2,5-diphenyl-tetrazolium bromide (MTT) assays
were performed after overexpression or downregula-

tion of TPD52 in LNCaP cells. MTT assays showed a
significantly increased proliferation of the PCA cell line
LNCaP after transient overexpression of EGFP-
TPD52 (Fig. 3A). The proliferation of these cells was
20% higher than the proliferation of EGFP-transfected
control cells 48 h after transfection. Dihydroxytestos-
terone (DHT) was used as a control in MTT assays.
On the other hand, downregulation of TPD52 leads to
decreased cell proliferation, an effect that could be
suppressed to a certain extent when growth medium
was supplemented with 1 mm DHT (Fig. 3B).
Silencing of TPD52 by shRNA leads to apoptosis
in LNCaP cells
Considering that proliferation and migration has been
affected by overexpressed TPD52, we next studied
whether downregulation of TPD52 by RNA interfer-
ence leads to apoptosis through the activation of cas-
pase cascade in LNCaP cells. Cell death was analysed
by flow cytometry. Propidium iodide (PI) was applied
to LNCaP cells depleted for TPD52 expression to mea-
sure cell death. Based on the results of flow cytometry,
we observed approximately 36% cell death in TPD52
Mock C 12 h 24 h 36 h 48 h 72 h 96 h
0.0
0.5
1.0
1.5
Time (h)
Rel. TPD52 mRNA expression
Lane 1 Lane 2

Lane 3
0
50
100
150
Rel. expression of
EGFP-TPD52
M
EGFP TPD52
EGFP
24 h 48 h 72 h 96 h 120 h
Mock C
TPD52
RPLP0
EGFP-TPD52
GAPDH
pEGFP-TPD52 +
+
+
+
+
–
–
–
–
pSuper
pSuper-shRNA
12
3
ABC

D
EF
Fig. 2. Dysregulation of TPD52 expression in androgen dependant prostate cancer cells (LNCaP). (A) LNCaP cells transfected with either
EGFP (left panel) or EGFP-TPD52 (right panel) fusion protein producing recombinant vector and, 24 h posttransfection, cells were observed
under a microscope for expression of fusion protein. (B) Confirmation of expression of EGFP-TPD52 by western blotting with anti-EGFP
serum. (C) Downregulation of TPD52 by shRNA. For the kinetics of TPD52 knockdown, mRNA expression was assessed by semiquantitative
RT-PCR and (D) quantitative real-time PCR after LNCaP cells were transfected with either specific shRNA producing or mock vector and
incubated for the indicated times; the results are the mean ± SD of two experiments. (E) Western blotting for EGFP-TPD52 knockdown.
EGFP-TPD52 positive LNCaP cells were transfected with shRNA or control vector and incubated for 24 h. Total protein (30 lg) was
separated by 12% SDS ⁄ PAGE and detected with anti-EGFP serum. Lane 1, EGFP-TPD52 positive cells; lane 2, EGFP-TPD52 positive cells
transfected with control; lane 3, EGFP-TPD52 positive cells transfected with specific shRNA. Only a representative blot is shown here.
(F) Quantification of western blot signals showing 40% of downregulation; the results are the mean ± SD of three experiments.
R. Ummanni et al. Tumor protein D52 in prostate cancer
FEBS Journal 275 (2008) 5703–5713 ª 2008 The Authors Journal compilation ª 2008 FEBS 5705
depleted LNCaP cells after 48 h of post-transfection of
shRNA compared to mock transfected cells showing
approximately 7% cell death (Fig. 4A–D). To obtain
further insight into the mechanisms by which TPD52
downregulation induces cell death, we determined the
involvement of caspase activation and mitochondria
membrane depolarization. In many cell types, activa-
tion of procaspase-3 is a distinguishing feature of
apoptotic cell death. Thus, we first examined whether
caspase-3 is activated after downregulation of TPD52
(Fig. 4E). We observed a 3.5-fold activation of cas-
pase-3 in TPD52 knockdown LNCaP cells compared
to mock transfected cells (P £ 0.0008). To obtain fur-
ther information on the apoptosis signaling triggered
by TPD52 downregulation, we next examined caspase-
9 activation in TPD52 depleted LNCaP cells (Fig. 4F).

After shRNA mediated knockdown of TPD52 in
LNCaP cells, caspase-9 is activated by 1.6-fold com-
pared to control cells (P £ 0.0213). Additionally, we
examined the effect of TPD52 depletion on mitochon-
drial membrane depolarization by determining mito-
chondrial transmembrane potential (Dw
m
) 48 h after
TPD52 downregulation in LNCaP cells (Fig. 4G). In
30% of the TPD52 knockdown cells, a significant
decrease of Dw
m
(P £ 0.0013) could be observed,
whereas nontransfected or mock transfected cells were
less than 10% of the total cells, suggesting that the
depolarization of the mitochondrial membrane leads to
cytochrome c release, which in turn activates caspase-9
to initiate apoptosis. The activation of caspases-3 and
-9 taken together with the loss of mitochondrial
membrane potential suggests that downregulation of
TPD52 leads to activation of the intrinsic pathway to
initiate apoptosis in LNCaP cells.
Influence of TPD52 overexpression on LNCaP cell
migration
Furthermore, we analyzed whether overexpression of
EGFP-TPD52 fusion protein affects LNCaP cell
migration. Haptotactic cell migration assays with
vitronectin and collagen type I demonstrated that
overexpression of EGFP-TPD52 stimulates specifically
avb3-mediated LNCaP cell migration on vitronectin

(P £ 0.0029; Fig. 5A) but not integrin b1-mediated cell
migration on collagen type I (Fig. 5B). The observed
effects could not be confirmed in EGFP-TPD52
expressing MCF-7 cells (data not shown). To investi-
gate whether the activation of PKB ⁄ Akt pathway is
involved, EGFP-TPD52 or EGFP expressing LNCaP
cells were allowed to attach to vitronectin coated
plates. After intervals of 2 and 4 h, the amount of
phosphorylated PKB ⁄ Akt (Ser473) was analyzed. We
observed a significantly increased phosphorylation of
PKB ⁄ Akt in EGFP-TPD52 expressing cells compared
to EGFP expressing cells after 4 h of incubation on
vitronectin (Fig. 5C). To confirm the involvement of
the Akt pathway in TPD52 induced cell migration
towards vitronectin, a cell migration assay in the
presence of inhibitor for PI3-kinase, which acts
upstream of Akt phosphorylation, revealed no signifi-
cant increase in migration (Fig. 5D).
Discussion
Subsequent to the latest advances for early diagnosis
and new therapeutics for efficient treatment options,
0.00
0.25
0.50
0.75
*
*
MTT formazan formation
(570 nm)
+–+–

–+–+
+
+
––
pEGFP
pEGFP-TPD52
DHT
0.0
0.1
0.2
0.3
0.4
0.5
**
*
*
MTT formazan formation
(570 nm)
+
–+–
–+–+
+
+
––
Mock
shRNA(204)
DHT
A
B
Fig. 3. Influence of TPD52 overexpression on the proliferation of

the PCA cell line LNCaP. (A) Cell proliferation after overexpression
of TPD52 and (B) cell proliferation after downregulation of TPD52.
Viability of cells was measured in a colorimetric MTT assay by the
detection of formazan formation. The proliferation of control cells
transfected with EGFP was set at 100%. The results are the
mean ± SD of four independent experiments; DHT was used as a
control for the proliferation of LNCaP cells.
Tumor protein D52 in prostate cancer R. Ummanni et al.
5706 FEBS Journal 275 (2008) 5703–5713 ª 2008 The Authors Journal compilation ª 2008 FEBS
Mock +
–
–
+
–
+
–
+
–
–
–
–
–
–
+
Taxol
shRNA(204)
–
–
+
*** **

***
0
1
2
3
4
5
Relative caspase-3 activity
Mock
+
–
–
+
–
+
–
+
–
–
–
–
–
–
+Taxol
shRNA(204)
0
1
2
3
Relative caspase-9 activity

Mock +
–
–
+
–
+
–
+
–
–
–
–
Taxol
shRNA(204)
** ***
0
20
40
60
Δψm loss (% of cells)
AB
EFG
CD
6.93% cells M1
PI
10
0
10
1
10

2
10
3
10
4
1280
Events
PI
M1
10
0
10
1
10
2
10
3
10
4
26% cells
128
0
Events
PI
M1
10
0
10
1
10

2
10
3
10
4
36% cells
128
0
Events
PI
M1
10
0
10
1
10
2
10
3
10
4
128
0
Events
Fig. 4. Downregulation of TPD52 induces cell death in LNCaP cells. Cells were transfected with specific shRNA or control using Lipofecta-
mineÔ 2000 and cell death was measured by PI staining using fluorescence activated cell sorting analysis at the indicated time points.
(A) Mock transfected cells. (B) Cells transfected with specific shRNA after (C) 24 h and (D) 48 h. (D) Overlay of (A) and (C). TPD52 downre-
gulation activates caspase activity and increases the loss of mitochondrial membrane potential. (E, F) Showing the relative caspase-3 and -9
activities, respectively, as the ratio of mock transfected cells to shRNA transfected cells after 48 h. Taxol was used as a control for activa-
tion of caspases. (G) Effect of TPD52 downregulation on mitochondrial membrane potential dissipation assessed by cytofluorimetric analysis

of DIOC
6
; columns indicate the mean ± SD of three independent experiments performed in triplicate.
Akt
pAkt
EGFP + – + –
–+–+EGFP-TPD52
2 h
4 h
Vitronectin
**
0
250
500
750
1000
1250
EGFP
TPD52
% Age of control
0
250
500
750
1000
% Age of control
Vitronectin
**
TPD52
EGFP

TPD52 +
LY, 294,002
Collagen-1
0
50
100
150
% Age of control
EGFP
TPD52
A
B
CD
Fig. 5. Overexpression of TPD52 stimulates cell migration. LNCaP cells transiently transfected with EGFP-TPD52 or EGFP as a control were
analysed by haptotactic cell migration toward vitronectin (A) and collagen type I (B). The data represent the results obtained from three inde-
pendent experiments performed in triplicate and are given as the mean ± SD. (C) Adhesion of EGFP-TPD52-LNCaP cells to vitronectin
increases PKB ⁄ AKT (Ser473) phosphorylation. EGFP or EGFP-TPD52 positive LNCaP cells starved in serum free medium for 24 h were har-
vested and seeded on vitronectin coated dishes at 37 °C for the indicated time intervals. The total protein of harvested cells (20 lg per lane)
was separated by 12% SDS ⁄ PAGE. Phosphorylation of PKB ⁄ AKT was detected by polyclonal phospho-AKT (Ser473) antibodies and loading
control PKB ⁄ AKT was detected by polyclonal AKT antibodies. (D) The influence of TPD52 on LNCaP cell migration analysed in the presence
of PI3 kinase inhibitor LY, 294,002. The results indicate that there is no significant increase in the migration of EGFP-TPD52 overexpressing
cells in the presence of inhibitor.
R. Ummanni et al. Tumor protein D52 in prostate cancer
FEBS Journal 275 (2008) 5703–5713 ª 2008 The Authors Journal compilation ª 2008 FEBS 5707
the mortality rate of prostate cancer has been
decreased significantly. In spite of all new treatment
strategies to increase survival, PCA is the most com-
mon type of cancer found in men in Western countries
and is the leading cancer death, next to lung and colo-
rectal cancer. In the present study, we demonstrate the

physiological consequences of TPD52 expression in the
androgen responsive prostate cancer cell line LNCaP.
It is an oncogene overexpressed in prostate, breast and
ovarian cancer, as demonstrated by DNA microarray
analysis and high density tissue microarrays. Its over-
expression due to gene amplification was confirmed by
array comparative genomic hybridization, single nucle-
otide polymorphism arrays and fluoresecemce in situ
hybridization analysis to measure gene copy number
on clinically localized prostate cancer specimens
[4,9,10,23]. Expression of recombinant TPD52 in acini
of rat pancreas stimulates amylase secretion [24]. As
reported previously, the results from our proteomic
analysis aiming to define the protein signature of pros-
tate cancer biopsies revealed the overexpression of
TPD52 in cancer patient material [22]. To date, the
main physiological role of TPD52 in prostate cancer
progression remains under investigation. In a recent
study, Wang et al. [20] found that TPD52 expression
increases with age and undergoes translocation during
development from early to adult tissues.
The expression of TPD52 proteins is linked with cell
proliferation in different cancer cell types. This is high-
lighted by reports that the expression of TPD52 in
neuroepithelial cells by retroviral transduction indi-
cated its role in cell proliferation [5,25]. The presence
of androgen response elements in the promoter region
of TPD52 gene indicates that the expression of TPD52
is controlled by androgens [14]. Testosterone as the
major circulating androgen can trigger an androgen

receptor response, which in turn activates various
genes for transcription in the nucleus [26]. TPD52
expression at both the transcriptional and translational
levels is positively regulated by estradiol in breast can-
cer cells [5] and androgens in prostate cancer cells
[9,10,14,27]. From the present study, we noted that
dysregulation of TPD52 expression slightly altered the
proliferation of LNCaP cells.
A common molecular strategy used by tumor cells
to evade apoptosis is the upregulation of anti-apopto-
tic proteins or the downregulation of pro-apoptotic
proteins. Human D53L1, another member of the
TPD52 family, interacts with apoptosis signal regulat-
ing kinase 1 and promotes apoptosis [28]. Gene silenc-
ing by antisense oligonucleotides or RNA interference
technology comprise useful tools to validate candidate
proteins [29,30]. We found that TPD52 knockdown in
LNCaP cells is accompanied by enhanced cell death.
This was further confirmed by apoptosis using differ-
ent methods, such as measurement of caspase activity
and loss of mitochondrial membrane potential. In
summary, it is suggested that TPD52 acts upstream of
the mitochondria related apoptosis. However, the exact
mechanism by which TPD52 influences apoptosis
needs to be investigated in detail.
It has been proposed that cancer arises due to
several molecular events leading to transformation of
normal to tumor cells, with further progression to
metastasis, including cell migration into the surround-
ing tissue, survival and proliferation in the host tissue

[31]. The expression of several genes, such as CARD10
[32] and Vav3 [33], and integrins is important in deter-
mining the formation of metastatic cells [34,35]. The
expression of murine TPD52 in NIH3T3 cells induces
the expression of several genes involved in the promo-
tion of metastasis and the genes responsible for pre-
vention of metastasis were downregulated [19]. From
our cell migration assays, we found that overexpres-
sion of TPD52 in LNCaP cells promotes cell migration
towards vitronectin. Integrins are transmembrane
receptors composed of a and b subunits. To date, 24
different integrins with different combinations of 8 a
and 18 b subunits are known [36]. Integrins bind to
different extracellular matrix proteins and control
functions such as adhesion, migration, differentiation,
proliferation, survival and motility [37]. Usually, inte-
grins avb3 and avb5 are involved in cell migration and
attachment to the extracellular matrix proteins: vitro-
nectin, fibronectin, fibrinogen, laminin, osteopontin,
amongst others [38]. Vitronectin can bind to avb5 and
avb3 integrin receptors. The expression of avb3in
LNCaP is controversial. Zheng et al. [39] noted that
LNCaP cells did not express avb3. Witkowski et al.
[40] and Chatterjee et al. [41] reported the expression
of both avb3 integrins in LNCaP cells. In addition to
these reports, Putz et al. [42] reported four prostate
cancer cell lines that were derived from bone marrow
expressing av and b3 integrin subunits. The MCF-7
cells chosen lack avb3-integrin expression, making it
possible to demonstrate that overexpression of TPD52

is involved in avb3-mediated cell attachment to vitro-
nectin [43,44]. Previously, it was been shown that avb3
mediated cell migration and adhesion of LNCaP cells
to vitronectin activates the Akt ⁄ PI3 kinase pathway
via phosphorylation of Akt at Ser473 [39]. The results
obtained in the present study show that TPD52 expres-
sion activates the Akt ⁄ PI3 kinase pathway. This sup-
ports the idea of the activation of the avb3 signalling
pathway in TPD52 induced cell migration. In the avb3
signalling pathway, ligation of avb3 with multiple
Tumor protein D52 in prostate cancer R. Ummanni et al.
5708 FEBS Journal 275 (2008) 5703–5713 ª 2008 The Authors Journal compilation ª 2008 FEBS
ligands activates FAK, which interacts and activates
PI3 kinase. The PI3 kinase activates PKB ⁄ Akt by
phosphorylation and activated PKB phosphorylates
several substrates to control various biological pro-
cesses, such as cell migration, adhesion, survival and
proliferation [21]. A very recent study reported that
expression of PrLZ activates the PKB ⁄ Akt signalling
pathway in prostate cancer cells [45]. The C-terminal
domain of the PrLZ gene product shares homology
with TPD52. Therefore we speculate that TPD family
proteins may activate Akt via activation of integrins.
Taken together, migration studies confirm the involve-
ment of avb3 integrin in TPD52 mediated migration
of LNCaP cells towards vitronectin. Similar to breast
cancer cells, prostate cancer cells metastasize to the
bone, which consists of extracellular matrix proteins
specific to avb3 [21,46]. TPD52 involvement in avb3
mediated cell migration may play a role bone metas-

tasis of prostate cancer patients.
In conclusion, it appears that TPD52 is involved in
different molecular processes, such as the regulation of
apoptosis and proliferation. Its association with cell
migration suggests a role in tumor dissemination.
Because the PKB ⁄ Akt pathway is the central pathway
involved in prostate cancer progression, activation of
PKB ⁄ Akt by its phosphorylation is a possible mech-
nism of cell survival and migration that is controlled
by TPD52. Taken together, TPD52 may be a potential
and valid target to improve therapeutic strategies for
better treatment.
Experimental procedures
Clinical samples collection
Tissue samples and patient data were obtained after
informed consent. The study was approved by the local eth-
ics committee of the University of Greifswald and carried
out in accordance with the declaration of Helsinki. Ultra-
sound guided biopsies were taken from each patient and
biopsies were investigated histopathologically by two expe-
rienced pathologists.
Preparation of protein/RNA extracts
Approximately 6–10 mg of prostate biopsies was homoge-
nized in 0.5 mL of Trizol
Ò
reagent (Invitrogen, Karlsruhe,
Germany) in a bead mill (Sartorius, Go
¨
ttingen, Germany).
Total protein and total RNA was isolated according to the

protocols recommended by the supplier (Invitrogen) for
Trizol
Ò
reagent. Protein pellets were vacuum dried, resus-
pended directly in lysis buffer [8 m urea (Sigma-Aldrich,
Munich, Germany); 2 m thiourea (Sigma-Aldrich, Munich,
Germany); 4% Chaps (Roth Chemicals, Karlsruhe, Ger-
many); 40 mm Tris base (Roth Chemicals) containing
65 mm dithiothreitol (Roth Chemicals)] and stored at
)80 °C until use. The protein concentration of the extracts
was determined by a modified Bradford assay [47]. Total
RNA was stored at )20 °C.
2D gel electrophoresis (2DE), imaging, analysis
and MS
2DE was performed as described previously by Ummanni
et al. [22]. Briefly, to prepare samples for analytical 2DE,
150 lg of protein sample of each patient were made up to
450 lL with rehydration buffer [8 m urea, 2 m thiourea,
2% Chaps, 50 mm dithiothreitol with 0.5% v ⁄ v IPG buffer,
pH 4–7 (GE Healthcare, Uppsala, Sweden)] and used to
passively rehydrate each IPG strip overnight. For prepara-
tive 2DE, 650 lg of protein sample pooled from equal
amount of protein isolated from PCA biopsies were used.
The analytical gels were stained with SYPRO
Ò
Ruby pro-
tein gel stain (Bio-Rad, Mu
¨
nchen, Germany). Preparative
gels were stained with colloidal coomassie brilliant blue

stain (Roth Chemicals). SYPRO
Ò
Ruby stained gel images
were scanned at 100 lm resolution using a FS-700 molecu-
lar dynamics laser densitometer (Bio-Rad) and pdquest
software, version 7.3.3 Basic (Bio-Rad). Image analysis was
carried out with the pdquest 2D analysis software package,
version 7.4 (Bio-Rad) and changes in expression level were
restricted to being greater than 1.5-fold. Protein identifica-
tion was performed as described previously [22,48].
Measurements of TPD52 gene transcripts by
quantitative real-time PCR
Quantitative real-time PCR for TPD52 expression was per-
formed using the SYBR Green kit (Eppendorf, Hamburg,
Germany) as described previously [22]. Briefly, RNA was
isolated from the same biopsies used for proteome analysis
using Trizol
Ò
reagent (Invitrogen) according to the manu-
facturers’ protocol and RNA quality was assessed by 1.0%
agarose formaldehyde gel electrophoresis. cDNA was pre-
pared by reverse transcription of 1 lg of total RNA using
oligo dT primer (15mer) and M-MLV reverse transcriptase
(Promega Corp., Madison, WI, USA). Primer pairs were
designed using the oligo direct programme (Invitrogen) and
synthesized by Invitrogen. The sequences for TPD52 and
RPLP0 (house keeping gene) are: TPD52 sense: 5¢-GAGG
AAGGAGAAGATGTTGC-3¢, TPD52 antisense: 5¢-GCC
GAATTCAAGACTTCTCC-3¢, RPLP0 sense: 5¢-TTGTGT
TCACCAAGGAGGAC-3¢, RPLP0 antisense: 5¢-GACTC

TTCCTTGGCTTCAAC-3¢.
Primer sets were used to generate a single amplicon of
the desired size evaluated by agarose gel electrophoresis.
Quantitative real-time PCR was performed in the Master-
R. Ummanni et al. Tumor protein D52 in prostate cancer
FEBS Journal 275 (2008) 5703–5713 ª 2008 The Authors Journal compilation ª 2008 FEBS 5709
cycler
Ò
ep realplex (Eppendorf) with optimized thermal
cycles using the SYBR Green kit (Eppendorf). At the end
of the PCR, samples were subjected to a melting analysis to
confirm the specificity of the amplicon. To obtain statistical
significance, the data obtained were analysed by a nonpara-
metric two-tailed Mann–Whitney U-test performed at 95%
confidence interval.
Cell culture
The PCA cell line LNCaP was purchased from DSMZ
(Braunschweig, Germany) and maintained in RPMI1640
(Invitrogen) supplemented with 10% fetal bovine serum,
100 unitsÆmL
)1
penicillin and streptomycin, glucose, sodium
pyruvate, sodium bicarbonate and Hepes. Cells were grown
in an incubator at 37 °C with a constant supply of 5% CO
2
and split after reaching 85–90% confluence. Cells were
regularly tested for mycoplasma contamination using the
MycoAlertÔ Mycoplasma Detection Kit (Cambrex Bio
Science Rockland, Inc., Rockland, ME, USA).
Overexpression of EGFP-TPD52 fusion protein

An EGFP-TPD52 fusion protein expressing recombinant
vector was generated by cloning the coding region of the
human TPD52 (Accession number NM 001001875) cDNA
derived from LNCaP cells into the vector pEGFP-N3 (Clon-
tech, Palo Alto, CA, USA). The cDNA was prepared by
reverse transcription of 1 lg of total RNA from LNCaP
cells using oligo dT primer (15mer) and M-MLV reverse
transcriptase (Promega Corp.). A specific primer pair was
designed using oligo direct programme (Invitrogen) and syn-
thesized by Invitrogen. TPD52 cDNA was generated by PCR
using Pwo DNA Polymerase (Peqlab, Erlangen, Germany).
The sense primer (5¢-GCTA
CTCGAGCCATGGACCG
CGGCGAGCAAGGT-3¢) contains a recognition site
(underlined) for the restriction enzyme XhoI. The antisense
primer (5¢-CACTT
GGTACCCAGGCTCTCCTGTGTCTT
TTC-3¢) contains a site for KpnI (underlined). Insertion of
the XhoI ⁄ KpnI digested PCR product into the XhoI ⁄ KpnI
restriction sites of the vector resulted in a C-terminal fusion
of TPD52 to EGFP. The sequence of the cloned PCR
fragment was confirmed by DNA sequencing (Seqlab,
Go
¨
ttingen, Germany).
Downregulation of TPD52
To downregulate TPD52 in LNCaP cells, we designed dif-
ferent shRNA pairs directed against three splice variants of
TPD52 using oligoengine programme and synthesized by
Invitrogen. shRNA oligos were annealed in annealing

buffer by heating the mixture at 95 °C for 5 min followed
by slowly cooling down to room temperature. Annealed oli-
gos were phosphorylated by T4 polynucleotide kinase in the
presence of ATP and cloned into pSUPER.neo-gfp vector
(Oligoengine RNA interference) between the BglII and Hin-
dIII restriction sites. The shRNA expressing vectors were
screened for their antisense activity using recombinant psi-
CHECKÔ2-TPD52 vector. Co-transfection of two vectors
into LNCaP cells and luciferase assay after 24 h revealed
that the following sequence is more specific for antisense
activity than the others: forward, 5¢-GATCCCCGCGGAA
ACTTGGAATCAATTTCAAGAGAATTGATTCCAAGT
TTCCGCTTTTTA-3¢ and reverse, 5¢-AGCTTAAAAA
GCGGAAACTTGGAATCAATTC TCTTGAAATTGAT
TCCAAGTTTCCGCGGG-3¢.
MTT assay for cell proliferation
The effect of TPD52 overexpression on proliferation of the
PCA cell line LNCaP was measured by the MTT (Sigma-
Aldrich, St Louis, MO, USA) proliferation assay. In brief,
4 · 10
4
cells were grown in 24 well plates at 37 °C ⁄ 5% CO
2
for 20 h. Cells were then transfected with EGFP- or EGFP-
TPD52 vector by the LipofectamineÔ 2000 method.
Twenty-four hours after transfection, MTT solution was
added to the wells and cells were incubated for an addi-
tional 4 h at 37 °C ⁄ 5% CO
2
. After solubilization buffer

was added, formazan production was measured at 570 nm
in a spectrophotometer (Novaspec II, Pharmacia, Uppsala,
Sweden). Cell proliferation assays were performed with and
without DHT (Sigma-Aldrich, Munich, Germany). Cell
proliferation values are the mean of three independent
experiments, each carried out with triplicate samples. For
calculation of significance, a t-test was performed using
graph pad prism, version 3.0 (GraphPad Software Inc.,
San Diego, CA, USA).
Cell migration assay
To study the influence of TPD52 on cell migration, a hapo-
totactic cell migration test was performed after overexpres-
sion of EGFP-TPD52 in LNCaP or MCF-7 cells.
Haptotactic cell migration assays were performed in Tran-
swell chambers (#3422; Costar Inc., Cambridge, MA, USA)
according to Zhang et al. [45]. Porous membranes were
coated on the bottom surface with vitronectin (10 lgÆmL
)1
)
or collagen type I (10 lgÆmL
)1
) for 1 h at 37 ° C. LNCaP
or MCF-7 cells were transfected with EGFP or EGFP-
TPD52 expressing vectors using LipofectamineÔ 2000
(Invitrogen) and grown at 37 °C ⁄ 5% CO
2
for 24 h. Trans-
fected cells were then trypsinized and washed in the pres-
ence of soyabean trypsin inhibitor with migration buffer
(RPMI 1640, 2 mm CaCl

2
,1mm MgCl
2
, 0.2 mm MnCl
2
,
0.5% BSA). Cells were resuspended in migration buffer
with or with out PI3 kinase inhibitor LY, 294,002 (Alexis
Biochemicals, San Diego, CA, USA) and 1 · 10
5
cells were
added onto the top of the membrane and allowed to move
through it and bind vitronectin or collagen type I for 6 h at
37 °C in migration buffer in the lower chamber. After
Tumor protein D52 in prostate cancer R. Ummanni et al.
5710 FEBS Journal 275 (2008) 5703–5713 ª 2008 The Authors Journal compilation ª 2008 FEBS
removal of the remaining cells in the upper chamber, mem-
branes were fixed in NaCl ⁄ P
i
with 4% formaldehyde and
cells were counted using an inverse fluorescence microscope
(IX-70; Olympus, Tokyo, Japan).
PI uptake for cell death
Cell death was analysed with PI uptake. Cells were har-
vested, washed with NaCl ⁄ P
i
and fixed in ethanol at )20 °C.
After centrifugation, cells were resuspended in NaCl ⁄ P
i
con-

taining glucose, RNase and PI (50 lgÆmL
)1
), and incubated
for 20 min in the dark at room temperature. After washing
with NaCl ⁄ P
i
buffer, PI uptake was analysed by fluorescence
activated cell sorting (FACS CaliburÔ System; BD Bio-
science, Erembodegem, Belgium) on an FL-2 fluorescence
detector (20 000 events were recorded for each condition).
Flow cytometry data were analysed using winmdi software
(The Scripps Research Institute, La Jolla, CA, USA).
Determination of caspase-3 and -9 activity
Caspase-3 and -9 activities were measured 48 h after down-
regulation of TPD52 using fluorogenic substrates
Ac-DEVD-AFC and LEHD-AFC, respectively. Harvested
cells were lysed with caspase lysis buffer (10 mm Tris–HCl,
10 mm sodium phosphate buffer, pH 7.5, 130 mm NaCl,
1% Triton X-100 and 10 mm Na
2
P
2
O
7
) and then incubated
with the respective substrate (25 lgÆmL
)1
)in20mm Hepes
(pH 7.5), 10% glycerol and 2 mm dithiothreitol at 37 °C
for 2 h. The release of AFC was analyzed by fluorimeter

using an excitation ⁄ emission wavelength of 390 ⁄ 510 nm.
Relative caspase activities were calculated as the ratio of
values between mock transfected and transfected cells.
Paclitaxel was used as a positive control.
Measurement of mitochondrial transmembrane
potential Dw
m
Changes in the mitochondrial potential were detected with
the potential-sensitive probe dihexyloxacarbocyanine iodide
(DIOC
6
) uptake [49]. Dw
m
was determined 48 h after down-
regulation of TPD52. TPD52 depleted cells were incubated
with 50 nm DIOC
6
(Molecular Probes, Carlsbad, CA,
USA) at 37 °C for 30 min. After washing with NaCl ⁄ P
i
,
20 000 cells were analysed by fluorescence activated cell
sorting (FL-1 detector of FACS CaliburÔ System). The
results were analysed by cellquest software (Becton Dick-
inson, Franklin Lakes, NJ, USA).
Western blotting
Cells were lysed in 2DE lysis buffer and the protein concen-
tration was determined by modified Bradford assay. Protein
extracts were separated by 12% SDS ⁄ PAGE and electro-
phoretically transferred onto nitrocellulose membrane.

Blocking was carried out in 1· Rotiblock solution (Roth
Chemicals) followed by incubating the membrane with pri-
mary antibody [mouse anti-(human EGFP); 1 : 2000
(Roche Chemicals); rabbit anti-(human GAPDH) (Roche
Chemicals) 1 : 2000 or rabbit anti-(human AKT) or Ser473
phospho AKT 1 : 1000 (Cell Signalling Technology, Frank-
furt, Germany)] overnight at 4 °C. Excess antibodies were
removed by washing with NaCl–Tris–Tween 20. Incubation
with secondary antibody conjugated to horseradish per-
oxidase [anti-(mouse IgG) or anti-(rabbit IgG), diluted
1 : 5000 in 1· Rotiblock] was performed for 1 h at room
temperature. After three washes, the reaction was developed
by the addition of LumiGLO substrate (Cell Signalling
Technology). The emitted light was captured on X-ray film.
Acknowledgements
Ramesh Ummanni was supported by the Alfried-
Krupp von Bohlen und Halbach Stiftung, Graduierten-
kolleg Tumorbiologie. We thank Chithra devi Palani
for technical support concerning the caspase activity
measurements.
References
1 Scardino PT (1989) Early detection of prostate cancer.
Urol Clin North Am 16, 635–655.
2 Macoska JA, Trybus TM, Sakr WA, Wolf MC, Benson
PD, Powell IJ & Pontes JE (1994) Fluorescence in situ
hybridization analysis of 8p allelic loss and chromosome
8 instability in human prostate cancer. Cancer Res 54,
3824–3830.
3 Macoska JA, Trybus TM, Benson PD, Sakr WA,
Grignon DJ, Wojno KD, Pietruk T & Powell IJ (1995)

Evidence for three tumor suppressor gene loci on
chromosome 8p in human prostate cancer. Cancer Res
55, 5390–5395.
4 Byrne JA, Tomasetto C, Garnier JM, Rouyer N, Mattei
MG, Bellocq JP, Rio MC & Basset P (1995) A screen-
ing method to identify genes commonly overexpressed
in carcinomas and the identification of a novel comple-
mentary DNA sequence. Cancer Res 55, 2896–2903.
5 Byrne JA, Mattei MG & Basset P (1996) Definition of
the tumor protein D52 (TPD52) gene family through
cloning of D52 homologues in human (hD53) and
mouse (mD52). Genomics 35, 523–532.
6 Rhodes DR, Barrette TR, Rubin MA, Ghosh D &
Chinnaiyan AM (2002) Meta-analysis of microarrays:
interstudy validation of gene expression profiles reveals
pathway dysregulation in prostate cancer. Cancer Res
62, 4427–4433.
7 Balleine RL, Fejzo MS, Sathasivam P, Basset P, Clarke
CL & Byrne JA (2000) The hD52 (TPD52) gene is a
R. Ummanni et al. Tumor protein D52 in prostate cancer
FEBS Journal 275 (2008) 5703–5713 ª 2008 The Authors Journal compilation ª 2008 FEBS 5711
candidate target gene for events resulting in increased
8q21 copy number in human breast carcinoma. Genes
Chromosomes Cancer 29, 48–57.
8 Pollack JR, Sorlie T, Perou CM, Rees CA, Jeffrey
SS, Lonning PE, Tibshirani R, Botstein D, Borresen-
Dale AL & Brown PO (2002) Microarray analysis
reveals a major direct role of DNA copy number
alteration in the transcriptional program of human
breast tumors. Proc Natl Acad Sci USA 99 , 12963–

12968.
9 Rubin MA, Varambally S, Beroukhim R, Tomlins SA,
Rhodes DR, Paris PL, Hofer MD, Storz-Schweizer M,
Kuefer R, Fletcher JA et al. (2004) Overexpression,
amplification, and androgen regulation of TPD52 in
prostate cancer. Cancer Res 64, 3814–3822.
10 Wang R, Xu J, Saramaki O, Visakorpi T, Sutherland
WM, Zhou J, Sen B, Lim SD, Mabjeesh N, Amin M
et al. (2004) PrLZ, a novel prostate-specific and andro-
gen-responsive gene of the TPD52 family, amplified in
chromosome 8q21.1 and overexpressed in human pros-
tate cancer. Cancer Res 64, 1589–1594.
11 Byrne JA, Balleine RL, Schoenberg FM, Mercieca J,
Chiew YE, Livnat Y, St HL, Peters GB, Byth K, Kar-
lan BY et al. (2005) Tumor protein D52 (TPD52) is
overexpressed and a gene amplification target in ovarian
cancer. Int J Cancer 117, 1049–1054.
12 Scanlan MJ & Jager D (2001) Challenges to the devel-
opment of antigen-specific breast cancer vaccines.
Breast Cancer Res 3, 95–98.
13 Chen SL, Zhang XK, Halverson DO, Byeon MK,
Schweinfest CW, Ferris DK & Bhat NK (1997) Charac-
terization of human N8 protein. Oncogene 15, 2577–
2588.
14 Nelson PS, Clegg N, Arnold H, Ferguson C, Bonham
M, White J, Hood L & Lin B (2002) The program of
androgen-responsive genes in neoplastic prostate epithe-
lium. Proc Natl Acad Sci USA 99, 11890–11895.
15 Kaspar KM, Thomas DD, Taft WB, Takeshita E,
Weng N & Groblewski GE (2003) CaM kinase II regu-

lation of CRHSP-28 phosphorylation in cultured muco-
sal T84 cells. Am J Physiol Gastrointest Liver Physiol
285, G1300–G1309.
16 Tiacci E, Orvietani PL, Bigerna B, Pucciarini A, Cor-
thals GL, Pettirossi V, Martelli MP, Liso A, Benedetti
R, Pacini R et al. (2005) Tumor protein D52 (TPD52):
a novel B-cell ⁄ plasma-cell molecule with unique expres-
sion pattern and Ca(2+)-dependent association with
annexin VI. Blood 105, 2812–2820.
17 Wilson SH, Bailey AM, Nourse CR, Mattei MG &
Byrne JA (2001) Identification of MAL2, a novel mem-
ber of the mal proteolipid family, though interactions
with TPD52-like proteins in the yeast two-hybrid sys-
tem. Genomics 76, 81–88.
18 Parente JA, Goldenring JR, Petropoulos AC, Hellman
U & Chew CS (1996) Purification, cloning, and expres-
sion of a novel, endogenous, calcium-sensitive, 28-kDa
phosphoprotein. J Biol Chem 271, 20096–20101.
19 Lewis JD, Payton LA, Whitford JG, Byrne JA, Smith
DI, Yang L & Bright RK (2007) Induction of tumori-
genesis and metastasis by the murine orthologue of
tumor protein D52. Mol Cancer Res 5, 133–144.
20 Wang R, Xu J, Mabjeesh N, Zhu G, Zhou J, Amin M,
He D, Marshall FF, Zhau HE & Chung LW (2007)
PrLZ is expressed in normal prostate development and
in human prostate cancer progression. Clin Cancer Res
13, 6040–6048.
21 Hullinger TG, McCauley LK, DeJoode ML & Somer-
man MJ (1998) Effect of bone proteins on human pros-
tate cancer cell lines in vitro.

Prostate 36, 14–22.
22 Ummanni R, Junker H, Zimmermann U, Venz S, Teller
S, Giebel J, Scharf C, Woenckhaus C, Dombrowski F
& Walther R (2008) Prohibitin identified by proteomic
analysis of prostate biopsies distinguishes hyperplasia
and cancer. Cancer Lett 266, 171–185.
23 Chen SL, Maroulakou IG, Green JE, Romano-Spica V,
Modi W, Lautenberger J & Bhat NK (1996) Isolation
and characterization of a novel gene expressed in multi-
ple cancers. Oncogene 12, 741–751.
24 Thomas DD, Taft WB, Kaspar KM & Groblewski GE
(2001) CRHSP-28 regulates Ca(2+)-stimulated secre-
tion in permeabilized acinar cells. J Biol Chem 276,
28866–28872.
25 Proux V, Provot S, Felder-Schmittbuhl MP, Laugier D,
Calothy G & Marx M (1996) Characterization of a leu-
cine zipper-containing protein identified by retroviral
insertion in avian neuroretina cells. J Biol Chem 271,
30790–30797.
26 Ellis JA, Sinclair R & Harrap SB (2002) Androgenetic
alopecia: pathogenesis and potential for therapy. Expert
Rev Mol Med 4, 1–11.
27 DePrimo SE, Diehn M, Nelson JB, Reiter RE, Matese
J, Fero M, Tibshirani R, Brown PO & Brooks JD
(2002) Transcriptional programs activated by exposure
of human prostate cancer cells to androgen. Genome
Biol 3, RESEARCH0032.
28 Cho S, Ko HM, Kim JM, Lee JA, Park JE, Jang MS,
Park SG, Lee DH, Ryu SE & Park BC (2004) Positive
regulation of apoptosis signal-regulating kinase 1 by

hD53L1. J Biol Chem 279, 16050–16056.
29 Dias N & Stein CA (2002) Antisense oligonucleotides:
basic concepts and mechanisms. Mol Cancer Ther 1,
347–355.
30 Brummelkamp TR, Bernards R & Agami R (2002) A
system for stable expression of short interfering RNAs
in mammalian cells. Science 296, 550–553.
31 Hanahan D & Weinberg RA (2000) The hallmarks of
cancer. Cell 100, 57–70.
32 Wang L, Guo Y, Huang WJ, Ke X, Poyet JL, Manji
GA, Merriam S, Glucksmann MA, DiStefano PS,
Alnemri ES et al. (2001) Card10 is a novel caspase
Tumor protein D52 in prostate cancer R. Ummanni et al.
5712 FEBS Journal 275 (2008) 5703–5713 ª 2008 The Authors Journal compilation ª 2008 FEBS
recruitment domain ⁄ membrane-associated guanylate
kinase family member that interacts with BCL10 and
activates NF-kappa B. J Biol Chem 276, 21405–21409.
33 Zeng L, Sachdev P, Yan L, Chan JL, Trenkle T,
McClelland M, Welsh J & Wang LH (2000) Vav3
mediates receptor protein tyrosine kinase signaling,
regulates GTPase activity, modulates cell morphology,
and induces cell transformation. Mol Cell Biol 20,
9212–9224.
34 Alghisi GC & Ruegg C (2006) Vascular integrins in
tumor angiogenesis: mediators and therapeutic targets.
Endothelium 13, 113–135.
35 Janes SM & Watt FM (2006) New roles for integrins in
squamous-cell carcinoma. Nat Rev Cancer 6, 175–183.
36 Plow EF, Haas TA, Zhang L, Loftus J & Smith JW
(2000) Ligand binding to integrins. J Biol Chem 275,

21785–21788.
37 Giancotti FG & Ruoslahti E (1999) Integrin signaling.
Science 285, 1028–1032.
38 Varner JA & Cheresh DA (1996) Tumor angiogenesis
and the role of vascular cell integrin alphavbeta3.
Important Adv Oncol 1996, 69–87.
39 Zheng DQ, Woodard AS, Tallini G & Languino LR
(2000) Substrate specificity of alpha(v)beta(3) integrin-
mediated cell migration and phosphatidylinositol
3-kinase ⁄ AKT pathway activation. J Biol Chem 275,
24565–24574.
40 Witkowski CM, Rabinovitz I, Nagle RB, Affinito KS &
Cress AE (1993) Characterization of integrin subunits,
cellular adhesion and tumorgenicity of four human
prostate cell lines. J Cancer Res Clin Oncol 119, 637–
644.
41 Chatterjee S, Brite KH & Matsumura A (2001) Induc-
tion of apoptosis of integrin-expressing human prostate
cancer cells by cyclic Arg-Gly-Asp peptides. Clin Cancer
Res 7, 3006–3011.
42 Putz E, Witter K, Offner S, Stosiek P, Zippelius A,
Johnson J, Zahn R, Riethmuller G & Pantel K (1999)
Phenotypic characteristics of cell lines derived from dis-
seminated cancer cells in bone marrow of patients with
solid epithelial tumors: establishment of working models
for human micrometastases. Cancer Res 59, 241–248.
43 Brooks PC, Klemke RL, Schon S, Lewis JM, Schwartz
MA & Cheresh DA (1997) Insulin-like growth factor
receptor cooperates with integrin alpha v beta 5 to pro-
mote tumor cell dissemination in vivo. J Clin Invest 99,

1390–1398.
44 Wong NC, Mueller BM, Barbas CF, Ruminski P, Qua-
ranta V, Lin EC & Smith JW (1998) Alphav integrins
mediate adhesion and migration of breast carcinoma
cell lines. Clin Exp Metastasis 16, 50–61.
45 Zhang H, Wang J, Pang B, Liang RX, Li S, Huang PT,
Wang R, Chung LW, Zhau HE, Huang C et al. (2007)
PC-1 ⁄ PrLZ contributes to malignant progression in
prostate cancer. Cancer Res 67, 8906–8913.
46 Cooper CR, Bhatia JK, Muenchen HJ, McLean L,
Hayasaka S, Taylor J, Poncza PJ & Pienta KJ (2002)
The regulation of prostate cancer cell adhesion to
human bone marrow endothelial cell monolayers by
androgen dihydrotestosterone and cytokines. Clin Exp
Metastasis 19, 25–33.
47 Bradford MM (1976) A rapid and sensitive method
for the quantitation of microgram quantities of protein
utilizing the principle of protein-dye binding. Anal
Biochem
72, 248–254.
48 Eymann C, Dreisbach A, Albrecht D, Bernhardt J,
Becher D, Gentner S, Tam LT, Buttner K, Buurman G,
Scharf C et al. (2004) A comprehensive proteome map
of growing Bacillus subtilis cells. Proteomics 4, 2849–
2876.
49 Metivier D, Dallaporta B, Zamzami N, Larochette N,
Susin SA, Marzo I & Kroemer G (1998) Cytofluoro-
metric detection of mitochondrial alterations in early
CD95 ⁄ Fas ⁄ APO-1-triggered apoptosis of Jurkat
T lymphoma cells. Comparison of seven mitochon-

drion-specific fluorochromes. Immunol Lett 61, 157–163.
R. Ummanni et al. Tumor protein D52 in prostate cancer
FEBS Journal 275 (2008) 5703–5713 ª 2008 The Authors Journal compilation ª 2008 FEBS 5713