Báo cáo khoa học: Expression and characterization of soluble forms of the extracellular domains of the b, c and e subunits of the human muscle acetylcholine receptor pot

Expression and characterization of soluble forms of the
extracellular domains of the b, c and e subunits of the
human muscle acetylcholine receptor
Kalliopi Kostelidou
1
, Nikolaos Trakas
1
, Marios Zouridakis
1,2
, Kalliopi Bitzopoulou
1,2
,
Alexandros Sotiriadis
1
, Ira Gavra
1,2
and Socrates J. Tzartos
1,2
1 Department of Biochemistry, Hellenic Pasteur Institute, Athens, Greece
2 Department of Pharmacy, University of Patras, Greece
The nicotinic acetylcholine receptor (AChR) is a mem-
ber of the superfamily of ligand-gated ion channels,
which also includes the glycine, c-aminobutyric acid A,
and 5-HT
3
receptors [1]. Its physiological role is to
mediate the fast chemical transmission of electrical
signals in response to acetylcholine released from the
nerve terminal to the end-plate.
The muscle AChR is a transmembrane glycoprotein
( 290 kDa) located on the postsynaptic membrane of

the neuromuscular junction and is composed of five
Keywords
acetylcholine receptor; extracellular domain;
myasthenia gravis; protein expression
Correspondence
S. J. Tzartos, Department of Biochemistry,
Hellenic Pasteur Institute, GR11521 Athens,
Greece
Fax: +30 210 6478842
Tel: +30 210 6478844 or +30 2610 969955
E-mail: ,

(Received 29 March 2006, revised 25 May
2006, accepted 7 June 2006)
doi:10.1111/j.1742-4658.2006.05363.x
The nicotinic acetylcholine receptor (AChR) is a ligand-gated ion channel
found in muscles and neurons. Muscle AChR, formed by five homologous
subunits (a
2
bcd or a
2
bce), is the major antigen in the autoimmune disease,
myasthenia gravis (MG), in which pathogenic autoantibodies bind to, and
inactivate, the AChR. The extracellular domain (ECD) of the human mus-
cle a subunit has been heterologously expressed and extensively studied.
Our aim was to obtain satisfactory amounts of the ECDs of the non-a sub-
units of human muscle AChR for use as starting material for the determin-
ation of the 3D structure of the receptor ECDs and for the characterization
of the specificities of antibodies in sera from patients with MG. We
expressed the N-terminal ECDs of the b (amino acids 1–221; b1–221), c

(amino acids 1–218; c1–218), and e (amino acids 1–219; e1–219) subunits of
human muscle AChR in the yeast, Pichia pastoris. b1–221 was expressed at
 2mgÆL
)1
culture, whereas c1–218 and e1–219 were expressed at 0.3–
0.8 mgÆL
)1
culture. All three recombinant polypeptides were glycosylated
and soluble; b1–221 was mainly in an apparently dimeric form, whereas
c1–218 and e1–219 formed soluble oligomers. CD studies of b1–221 sugges-
ted that it has considerable b -sheet secondary structure with a proportion
of a-helix. Conformation-dependent mAbs against the ECDs of the b or c
subunits specifically recognized b1–221 or c1–218, respectively, and poly-
clonal rabbit antiserum raised against purified b1–221 bound to
125
I-labeled
a-bungarotoxin-labeled human AChR. Moreover, immobilization of each
ECD on Sepharose beads and incubation of the ECD–Sepharose matrices
with MG sera caused a significant reduction in the concentrations of auto-
antibodies in the sera, showing specific binding to the recombinant ECDs.
These results suggest that the expressed proteins present some near-native
conformational features and are thus suitable for our purposes.
Abbreviations
AChR, nicotinic acetylcholine receptor; ECD, extracellular domain; MG, myasthenia gravis; b1–221, amino acids 1–221 of the human AChR b
subunit; c1–218, amino acids 1–218 of the human AChR c subunit; e1–219, amino acids 1–219 of the human AChR e subunit.
FEBS Journal 273 (2006) 3557–3568 ª 2006 The Authors Journal compilation ª 2006 FEBS 3557
homologous subunits in the stoichiometry a
2
bcd
(embryonic muscle) or a

2
bed (adult muscle), with the
subunits arranged around a central ion pore [2,3].
Each mature subunit (after cleavage of the signal
peptide) consists of three domains, an extracellular
domain (ECD) (210–220 residues), a membrane-span-
ning domain, and an intracellular domain [3]. The
N-terminal ECD of each of the two a subunits con-
tains the major part of the binding site for the cho-
linergic ligands. The two sites are nonequivalent, one
being formed at the interface between one a subunit
and the c ⁄ e subunits and the other between the second
a subunit and the d subunit [4]. The c ⁄ e and d subunits
play a major role in shaping the ligand-binding sites
and also in maintaining cooperative interactions
between the a subunits [5–7]. The b subunit is an
important determinant in receptor localization, as
shown by studies on the properties of hybrid muscle
AChRs, in which the muscle b subunit was replaced
by its neuronal counterpart [8].
In addition to its physiological function, the muscle
AChR is involved in the pathology of the autoimmune
disease, myasthenia gravis (MG), being the main anti-
gen against which MG autoantibodies are produced.
These autoantibodies bind to AChR molecules at the
neuromuscular junction, leading to their loss and
the weakness and fatigability of the voluntary muscles,
the main symptoms of MG [9]. A proportion of
patients lacking autoantibodies against the AChR har-
bors antibodies against the muscle-specific kinase,

MuSK [10].
The pathophysiological importance of the AChR
necessitates the solution of its 3D structure. Current
knowledge of its structure is mainly based on data
from electron images of the AChR found in large
amounts in the electric organ of the marine ray,
Torpedo californica [3]. The acquisition of the crystallo-
graphic structure of the mollusc acetylcholine-binding
protein [11] has provided an insight into the ligand-
binding domain of nicotinic receptors. However, the
fact that this protein is most closely related to the a7
subunit of the neuronal AChR (24% identity of amino
acids) than each of the muscle AChR subunits (22%
on average) necessitates the solution of the structure of
the mammalian AChR molecule. A prerequisite for
this is the availability of large amounts of native, sol-
uble AChR molecules, a target that can be partially
achieved by expression of the ECDs of the AChR sub-
units in heterologous expression systems. Several stud-
ies have been carried out on the expression of the
muscle-type a subunit ECD in bacterial systems, in
which the protein is expressed in large amounts, but is
unglycosylated and forms inclusion bodies, requiring
refolding to allow partial renaturation [12–14]. Other
studies involved the expression of different subunits
(whole subunits or ECDs) in mammalian systems, in
which the protein has the correct structure, but is only
produced in limited amounts because of the inherent
difficulty in scaling up expression in cell culture or
oocytes [15,16].

In this report, we present the expression and charac-
terization of the ECDs of the b, c and e subunits of
the human muscle AChR. We describe their expression
in a soluble, glycosylated form and in satisfactory
amounts using the yeast Pichia pastoris expression sys-
tem, which combines the speed of bacterial systems
with the advantages of eukaryotic expression systems
(e.g. post-translational modification) and which had
been successfully used in the past by our group to
express the ECDs of human muscle a1 [17] and human
neuronal a7 [18]. CD analysis of amino acids 1–221 of
the human AChR b subunit (b1–221) showed that the
protein has a b-structure with a contribution from
a-helices. Two conformation-dependent mAbs (one
anti-b and one anti-c) specifically bound to their cog-
nate ECDs, whereas autoantibodies in MG sera, the
binding of which is highly conformation-dependent
[19,20], bound to all three ECDs.
As all three ECDs were expressed in satisfactory
amounts and were recognized by human MG autoanti-
bodies, they may be suitable as starting material for
preliminary biophysical and structural studies and for
the study of MG.
Results
Rationale for the construction and testing
of AChR ECD variants
N-Terminal addition of the FLAG peptide (DY-
KDDDDK) or addition of the first transmembrane
amino acid of the mouse muscle a subunit, a proline,
which is conserved in human AChR subunits, results in

higher expression of the mouse muscle a ECD [21]. To
test the effect of these additional epitopes ⁄ tags on the
yield of the present proteins, we constructed a set of
eight human c ECD variants (c, amino acids 1–218)
with or without a proline at position 219 and ⁄ or the
FLAG epitope and ⁄ or a 6-His tag (6-HIS) (Fig. 1A).
We then performed small-scale cultures for each pro-
tein and quantified the amounts of expressed protein in
the culture supernatant using dot-blots and a series of
supernatant dilutions. Expression varied depending on
the presence of the different modifications (Fig. 1B).
The yield of amino acids 1–218 of the human AChR c
subunit (c1–218) without additional tags was taken as
Soluble extracellular domains of AChR subunits K. Kostelidou et al.
3558 FEBS Journal 273 (2006) 3557–3568 ª 2006 The Authors Journal compilation ª 2006 FEBS
the 100% reference ( 0.3 mgÆL
)1
, see below). Addi-
tion of the proline residue had no significant effect on
expression (less than 10%). The presence of the FLAG
tag increased expression of c1–218 by almost 20%, but
did not improve expression of c1–219. The presence of
the HIS tag alone reduced the expression of both con-
structs by 30–40% (Fig. 1B, bars 2 and 6), and further
addition of FLAG to c1–218HIS gave 100% expression
(construct FLAG ⁄ c1–218HIS, bar 4). Strangely, when
both epitopes were present on c1–219, no expression
was observed (Fig. 1B, lane 8). We purified two c ECD
variants, FLAG ⁄ c1–218HIS and c1–219HIS from 1-L
cultures, obtaining  0.3 mgÆL

)1
and 0.2 mgÆL
)1
pro-
tein, respectively. We then constructed b1–221HIS and
FLAG ⁄ b1–221HIS and expressed, purified and quanti-
fied them using 2-L cultures. The results showed that
expression was increased threefold when the protein
carried the FLAG tag (2 mgÆL
)1
protein instead of
0.7 mgÆL
)1
).
Expression and purification of the b, c and e ECDs
As (a) the presence of the HIS tail on the constructs
greatly facilitates purification, (b) its negative effect on
the yield of c1–128 was considerably counteracted by
the addition of the FLAG epitope, and (c) the pres-
ence of the proline residue did not improve expression,
we proceeded to large-scale expression of the b, c and
e ECDs using constructs carrying both the FLAG and
6-HIS tags and no additional proline (i.e. FLAG ⁄ b1–
221HIS, FLAG⁄ c1–218HIS and FLAG⁄ e1–219HIS)
(Fig. 2A). The yields ranged from 2 mgÆL
)1
culture for
FLAG ⁄ b1–221HIS to 0.3–0.8 mgÆL
)1
for both FLAG ⁄

c1–218HIS and FLAG ⁄ e1–219HIS. The ECDs were
purified using Ni
2+
⁄ nitrilotriacetate affinity chroma-
tography under native conditions. Typically, the pro-
teins were eluted with 150 mm imidazole, although
some protein was eluted at 100 mm (less than 10% of
the total). Each protein migrated on SDS ⁄ PAGE with
an apparent molecular mass of  35 kDa compared
with the estimated molecular mass of  29 kDa, which
was apparently due to the glycosylation of the product
in the yeast cell (see below). The proteins were  90%
pure, based on quantification of the protein bands on
Coomassie Brilliant Blue-stained SDS ⁄ polyacrylamide
gel (Fig. 2B).
Deglycosylation of b1–221, c1–218 and e 1–219
Each recombinant protein carries at least one Asn-
X-Ser motif (glycosylation pattern for eukaryotes),
b1–221 at Asn141, c1–218 at Asn30 and Asn141, and
amino acids 1–219 of the human AChR e subunit (e1–
219) at Asn66 and Asn141. To verify that the recom-
binant proteins were glycosylated in the yeast cell (as
suggested by the observed difference in the molecular
mass of the purified proteins on SDS ⁄ PAGE), each
protein was deglycosylated with peptide–N-glycosidase
F. For each of the three proteins, this resulted in the
appearance of a band migrating at the expected mass
of  29 kDa (Fig. 2C), confirming that the proteins
were glycosylated.
Gel-filtration analysis of polypeptides

To examine the solubility and oligomerization state of
the recombinant polypeptides, we performed FPLC
analysis in detergent-free solution (50 mm phosphate
buffer, 300 mm NaCl, pH 8.0) in the presence of trace
amounts of
125
I-labeled soluble 66-kDa and 29-kDa
protein markers. To verify that the observed peaks on
the FPLC coincided with the presence of our proteins,
dot-blots were performed using anti-b (mAb 73) or
anti-c (mAb 67) [22] (Fig. 3). As the expected molecu-
lar mass of a monomer of each of the three ECD pro-
teins was  30–32 kDa, the results showed that b1–221
was probably eluted as a dimer with an apparent
A
B
His
His
1-219
FLAG
1-219
His
1-219
His
FLAG
1-219
His
FLAG
1-218
1-218

FLAG
1-218
His
1-218
0
20
40
60
80
100
120
140
1-218 1-218
HIS
FLAG
1-218
FLAG
1-218HIS
1-219 1-219
HIS
FLAG
1-219
FLAG
1-219HIS
Recombinant polypeptide
Yield % of 1-218
Fig. 1. Expression of the c ECD variants. (A) Schematic representa-
tion of the various c ECD constructs. The drawings depict the poly-
peptides with their tags ⁄ epitopes; the additional amino acid,
proline, is shown as a black bar at the C-terminus of some c

ECD(s). (B) Relative yields of the different c ECD constructs. All
yields were expressed as a percentage of the yield of the non-
tagged c1–218 construct, measured as the pixels for the positive
dot-blots of the culture expressing c1–218. The results shown are
the mean from five experiments.
K. Kostelidou et al. Soluble extracellular domains of AChR subunits
FEBS Journal 273 (2006) 3557–3568 ª 2006 The Authors Journal compilation ª 2006 FEBS 3559
A
γ
γ
1-218
His
FLAG
α
r
ot
c
af
-
ε
ε
1-219
His
FLAG
α r
ot
c
a
f
-

β
β
1-221
His
FLAG
α
r
o
t
ca
f
-
C
64
3
3
64
33
+-
esaGNP
+-+
-
54
53
B
5
4
53
54
53

54
53
Fig. 2. Purification and deglycosylation of the AChR ECDs. (A) Schematic representation of the constructs used for expression of the
b1–221, c1–218 and e1–219 ECDs of the human AChR in yeast P. pastoris. The arrowhead indicates the cleavage site of the a-factor peptide
after secretion, and the circles indicate putative glycosylation sites (Asn-X-Ser motif). (B) SDS ⁄ PAGE of the proteins purified by Ni
2+
⁄ nitrilotri-
acetate metal affinity chromatography stained with Coomassie Brilliant Blue; the left lane in each panel contains molecular mass markers,
and the right lane the test protein. (C) Deglycosylation of the b, c, and e ECDs using N-glycosidase F. Purified proteins (1 lg) were incubated
for3hat37°C in the absence (lane 1) or presence (lane 2) of N-glycosidase F, then the mixture was analyzed by SDS ⁄ PAGE (12% gel) and
western blotting using anti-FLAG mAb M2. The arrows indicate the bands corresponding to the glycosylated (upper) and deglycosylated
(lower) forms of each protein.
66kDa
29kDa
158kDa
0
500
1000
1500
2000
0
500
1000
1500
2000
ml
β
1-221
A
B

Absorbance Units (×10
–3
)Absorbance Units (×10
–3
)
66kDa
29kDa
158kDa
20191817161514131211109876543210
20
19
1817
1615
14
131211
10
987
6
543210
ml
γ
γ
1-218
Fig. 3. Gel filtration analysis of the polypep-
tides. (A) 2.0 mg b1–221 or (B) 2.0 mg
c1–218 protein was run on a Superose-12
column (Amersham-Pharmacia) at a flow
rate of 0.5 mLÆmin
)1
, together with

125
I-labeled protein markers of known mole-
cular mass (66 and 29 kDa). The fractions
were screened for ECD protein by dot-blots
using anti-b (mAb 73) or anti-c (mAb 67).
The position of the 158-kDa (aldolase)
marker is also shown (nonradioactive,
obtained from a separate run).
Soluble extracellular domains of AChR subunits K. Kostelidou et al.
3560 FEBS Journal 273 (2006) 3557–3568 ª 2006 The Authors Journal compilation ª 2006 FEBS
molecular mass of 60–65 kDa (Fig. 3A), whereas
c1–218 was mainly present as an oligomer (possibly
trimers-pentamers) (Fig. 3B). e1–219 displayed a sim-
ilar pattern to c1–218 (data not shown), indicative of
an oligomeric state. Although these elution patterns
are typical of the proteins produced, occasional prepa-
rations showed a considerable percentage (10–20) of
higher aggregates.
CD spectra
When the b subunit ECD was subjected to far-UV CD
analysis to examine its secondary structure, the CD
spectrum in 50 mm phosphate buffer containing
0.15 m NaCl, pH 8.0, was characterized by a positive
Cotton effect in the 190–200 nm region (peak
 196 nm) and a negative effect in the 200–240 nm
region (Fig. 4), suggesting a major contribution from a
b-sheet structure. However, the quite high negative
dichroism intensity over a relatively wide region
 215 nm is indicative of the presence of bands at 208
and 222 nm, characteristic of a contribution of a-heli-

cal regions [23].
Binding of mAbs to the ECDs using ELISA
ELISAs were performed using the conformation-
dependent mAbs 73 (binds to an epitope on the extra-
cellular side of the b subunit) [22] and 67 (binds to an
epitope on the extracellular side of the c subunit) [22]
and the nonconformation-dependent mAb M2 (anti-
FLAG). As a negative control, mAb 25 [24] was used,
which recognizes an epitope on Electrophorus electricus
AChR, but not on mammalian AChR. Figure 5 shows
that mAbs 73 and 67 specifically recognized their cog-
nate proteins, whereas mAb 25 did not bind to any of
the three polypeptides, as expected. The strong and
specific binding of the mAbs to the appropriate ECD
suggested the correct folding of at least b1–221 and
c1–218. Owing to the unavailability of a conforma-
tion-dependent e subunit mAb, only binding of anti-
FLAG mAb was tested.
Binding of the rabbit anti-b serum to recombinant
b1–221 and human AChR
Purified b1–221 was used to raise a rabbit anti-b ECD
serum. After three immunizations, the antiserum was
tested for its ability to bind to the antigen (b1–221)
using ELISA. The results (Table 1) showed strong and
specific binding to b1–221 ( 1.8 absorbance units),
with relatively weak cross-reactivity with either a1–210
or yeast proteins ( 0.4 absorbance units). The anti-
serum was then tested for its ability to bind to native
human TE671 AChR [25] in RIA experiments. The
high titer of the anti-(b ECD) serum for native AChR

(870 nm, Fig. 6) further suggests that recombinant
b1–221 retains some native-like conformational features.
Binding of human MG antibodies to recombinant
ECDs
To further examine the structure of the ECDs pro-
duced and their potential as tools for MG studies, we
tested their capacity to bind the highly conformation-
dependent AChR antibodies present in MG sera. We
had previously identified MG patient sera in which the
antibodies are mainly directed against the a subunit
195 200 205 210 215
220 225
230
235
240 245 250
-14
-12
-10
-8
-6
-4
-2
0
2
4
6
8
10
{θ}*10
–3

deg cm
–2
dmol
–1
Wavelength (nm)
Fig. 4. Far-UV CD spectrum of b1–221.
0
0,5
1
1,5
2
2,5
β1-221 γ1-218 ε1-219
BSA
Recombinant ECD
A
450
n
A
t
i
-
β
nAti
-
γ
nA
t
i-F GAL
ta

g
e
n
e
vi
no
c
t
o
r
l
Fig. 5. mAb binding to b, c,ande ECDs using ELISA. ELISA plates
were coated with one of the three ECDs or BSA as a control, and
the binding of mAbs tested by ELISA as described in Experimental
procedures (duplicate samples). mAb 73, checker-board bars; mAb
67, dark gray bars; FLAG mAb, light gray bars. mAb 25 (black bars)
was used as the negative control.
K. Kostelidou et al. Soluble extracellular domains of AChR subunits
FEBS Journal 273 (2006) 3557–3568 ª 2006 The Authors Journal compilation ª 2006 FEBS 3561
(anti-a sera) and others with a very small proportion
of antibodies against a (nonanti-a sera) [26]. We incu-
bated five nonanti-a and one anti-a (82% antibodies
against a) sera with a single ECD (b, c or e)–Seph-
arose or BSA–Sepharose resin, then measured the
nonbound AChR antibodies in the initial and final
samples. If the AChR antibodies in the MG serum
recognized and bound to the recombinant, immobi-
lized proteins, there would be a reduction in the
amount of antibodies in the sample incubated with the
ECD–Sepharose, and this reduction should be propor-

tional to the percentage of subunit-specific antibodies
in each serum. The anti-a serum should display little
or no reduction when incubated with any of the test
ECDs. Table 2 shows that incubation of each of the
five nonanti-a sera (samples 1–5) with different ECD–
Sepharose resins resulted in different percentage reduc-
tions in AChR antibody titers. In contrast, the anti-a
serum (sample 6) did not show any significant reduc-
tion in titer when incubated with any of the non-a
ECDS, as expected, but 82% loss of antibodies when
incubated with a ECD–Sepharose. Similar results were
obtained even when much higher serum quantities
were incubated with the ECD–Sepharose resins (data
not shown), which suggests that the immunoadsor-
bents in this experiment adsorbed all corresponding
subunit antibodies. As the binding to the AChR of
AChR antibodies in MG patient sera is highly confor-
mation-dependent, our findings support the presence
of native-like conformational features on all three
recombinant ECDs.
Discussion
In this paper, we describe the expression of soluble
forms of the ECDs of non-a subunits of the human
muscle AChR, using the yeast P. pastoris system. We
have successfully used this system for the human
muscle a ECD (a1–210) [17] and human neuronal
type a7 subunit (a7 1–208) [18]. Based on this experi-
ence, we embarked on the expression of three of the
four non-a ECDs, namely b, c and e. The expression
of the d subunit ECD, which is currently under pro-

gress, presents major difficulties, which require further
investigation.
Aiming to improve expression yields, we designed,
constructed and tested different variants of the c ECD
with and without a 6-HIS tail and ⁄ or the FLAG
Table 1. Binding of the rabbit anti-(b ECD) serum to purified b1–
221 in ELISA tests. Results shown are the mean from two experi-
ments. Recombinant human a ECD (a1–210) was used to test for
nonspecific binding of the rabbit anti-(b ECD) serum to a protein
related to b1–221, rather than to a totally unrelated protein, such as
BSA. The purified b1–221 used for immunization was purified from
a P. pastoris yeast culture and possibly contained traces of yeast
culture components (e.g. peptides originating from yeast protein
degradation and other metabolic by-products). To eliminate the pos-
sibility that rabbit antibodies raised against such components could
lead to spurious ELISA results, a control yeast supernatant sample
was prepared as described in Experimental procedures. BSA was
used as a negative control.
Rabbit anti-(b ECD)
serum (A
450
)
Normal rabbit
serum (A
450
)
Purified b1–221 1.80 0.10
Purified a1–210 0.40 0.08
Yeast supernatant 0.39 0.10
BSA 0.05 0.04

0
200
400
600
800
1000
1200
0,001 0,01 0,1
Serum Volume (µl)
Immunoprecipitated
125
I-α-Btx
labeled human AChR (cpm)
Fig. 6. Binding of the rabbit anti-(b ECD) serum to
125
I-a-bungaro-
toxin-labeled native human AChR. Various amounts of the rabbit
anti-(b ECD) serum were incubated with 14 fmol intact
125
I-a-bung-
arotoxin-labeled human AChR, then bound receptor was precipita-
ted with sheep anti-rabbit IgG, and radioactivity was measured.
Samples were processed in duplicate, and the results shown are
the mean of those of three experiments. The titer of b antibodies
in the serum was calculated to be 870 n
M.
Table 2. Adsorption of AChR antibodies from human MG sera by
immobilized ECDs. AChR antibody titer given in parentheses in n
M.
The reduction in total AChR antibodies present in MG sera

observed after incubation of sera with b1–221, c1–218, or e1–219
immobilized on CNBr–Sepharose beads was measured by RIA
using
125
I-a-bungarotoxin-labeled native AChR.
Serum
Reduction (%) in AChR antibodies in MG serum
after incubation with immobilized ECDs
a1–210
a
b1–221 c1–218 e1–219
MG 1 (50) 3 ± 3 53 ± 6 31 ± 1 29 ± 8
MG 2 (163) 8 ± 4 4 ± 2 8 ± 2 27 ± 4
MG 3 (99) 1 ± 1 89 ± 11 5 ± 2 22 ± 5
MG 4 (11) 3 ± 1 19 ± 4 29 ± 5 12 ± 1
MG 5 (6) 6 ± 2 1 ± 1 39 ± 7 18 ± 1
MG 6 (5) 82 ± 4 2 ± 1 13 ± 4 6 ± 2
anti-a serum
a
Data from [26].
Soluble extracellular domains of AChR subunits K. Kostelidou et al.
3562 FEBS Journal 273 (2006) 3557–3568 ª 2006 The Authors Journal compilation ª 2006 FEBS
epitope and ⁄ or the first transmembrane amino acid of
the AChR c subunit (proline), which is found at this
position in all human muscle subunits and has been
shown to positively affect expression of the mouse
AChR a subunit [21]. Our results showed that the
addition of a Pro residue and the presence of common
epitopes ⁄ tags used for purification influenced the
expression yield. When the widely used 6-HIS tail was

added to the C-terminus of c1–218, it reduced expres-
sion almost twofold, whereas an N-terminal FLAG, a
peptide sequence rich in charged residues, improved
expression of c1–218 by 20% and that of c1–218HIS
by 40% (Fig. 1B). The effect of the hydrophilic FLAG
epitope was most dramatically seen with the b1–221
ECD, its addition leading to an almost threefold
increase in expression. Although Yao et al. [21]
showed that addition of a Pro to the mouse a ECD
increased expression fourfold, no such effect was seen
with the non-a human ECDs in our system. Aiming
simultaneously at easy purification (achievable using
the 6-HIS tail) and high yields, we used the N-FLA-
G ⁄ ECD ⁄ HIS-C constructs for the large-scale expres-
sion of the proteins and found that b1–221 was
consistently expressed at a concentration of 2 mgÆL
)1
of culture and the c and e ECDs at a concentration of
0.3–0.8 mgÆL
)1
. These yields are an improvement over
the previous 0.1–0.2 mgÆL
)1
expression of the a1–210
protein [17], which, however, was in the monomeric
form, in contrast with the three recombinant proteins
described here. Gel-filtration analysis showed that b1–
221 existed mainly as a dimer, whereas both c1–218
and e1–219 were mainly present as oligomers, possibly
trimers–pentamers (Fig. 3). The state of the proteins

was confirmed by dynamic light scattering experiments
(data not shown); the proteins appeared polydisperse
with an estimated diameter of 7.5–9.8 nm (b ECD)
and 12.0–13.8 nm (c ECD), suggesting, respectively, a
dimeric or an oligomeric structure and confirming the
FPLC data, considering that the ‘height’ of the ECD
of the AChR is  6 nm [3]. This difference in solubility
between the c–e and the b ECDs might be attributed
to the primary structure of the protein: in addition to
the ‘standard’ cysteine pair (residues 128 and 142) [27],
present in all AChR subunit ECDs, both c and e carry
extra cysteine residues at residues 61, 105, and 115 (c)
and 190 (e), which could be involved in the formation
of intramolecular or intermolecular bonds, leading to
oligomer formation. However, if ‘free’ cysteines were
the only factors responsible for multimer formation,
then the b ECD should exist as a monomer; as this
was not the case, exposed hydrophobic regions, which
are presumably present in the b ECD, may also con-
tribute to intermolecular association of monomers.
The results from a range of experiments suggested
that the recombinant polypeptides are, at least to some
extent, properly folded. Firstly, they were glycosylated,
like native AChR [28] (Fig. 2C). Even though we lack
direct evidence about the site and structure of the
glycosylation sites on the ECDs, indirect evidence of
correct glycosylation of our ECDs comes from our
previous studies on the a ECD [17]: deglycosylation
abolished a-bungarotoxin activity, strongly suggesting
that glycosylation was at the right site and possibly of

correct structure. Secondly, the CD spectrum of the b
ECD indicated a folded protein consisting mainly of
b-sheet (Fig. 4). The solved crystallographic structures
of the molluscan Lymnaea stagnalis [11] and Bulli-
nus truncatus [29] acetylcholine-binding proteins, which
provide the prototypes for the AChR ligand-binding
domain, show a predominance of b-sheet, and the CD
spectra for these proteins largely resemble our spectra
[29] and are also similar to those for mouse a1
expressed in mammalian cells [16] or yeast [21] and the
Torpedo a ECD expressed in Escherichia coli [13].
These results suggest that the acetylcholine-binding
proteins and the b ECD have similar structures and
that the secondary structures of a non-a ECD (b) and
the a ECD resemble one another, being largely com-
posed of b-structure. Thirdly, conformation-dependent
anti-b and anti-c (mAbs 73 and 67, respectively)
bound specifically to their cognate ECD (Fig. 5), and
a polyclonal serum raised against the b1–221 polypep-
tide specifically bound to native AChR in RIA experi-
ments (Fig. 6). Finally, AChR antibodies in different
MG sera were specifically adsorbed by matrix-immobi-
lized ECDs, with variable concentrations of AChR
antibodies being retained on each ECD matrix (up to
89% of b antibodies for MG serum 3; Table 2). The
presence of antibodies against several AChR subunits
in a single serum (e.g. MG serum 1; Table 2) is inter-
esting, although it was not unexpected because of pre-
vious indirect information (e.g. from competition
experiments between mAbs against different subunits

and MG sera) [22]. The actual autoantigen in anti-
AChR-mediated MG is still uncertain. It may be intact
AChR, AChR subunit(s) or fragments, or an AChR
cross-reactive molecule. The polyspecificity of the sera
may either mean that the autoantigen is an intact
AChR or that epitope spreading occurred after initial
induction by a single AChR subunit or a cross-reactive
molecule. The adsorption results also indicated the
presence of a considerable percentage (29–39%) of c
antibodies in three of the five tested nonanti-a MG
sera (e.g. MG sera 1, 4 and 5; Table 2). The c subunit,
present in the fetal isoform of the AChR, is replaced
by the e subunit in adult muscle; however, this fetal
K. Kostelidou et al. Soluble extracellular domains of AChR subunits
FEBS Journal 273 (2006) 3557–3568 ª 2006 The Authors Journal compilation ª 2006 FEBS 3563
isoform is expressed in myoid cells in the thymus
[30,31], and c expression persists into adulthood in
mouse and bovine ocular fibers [32,33], justifying the
presence of c antibodies in adult MG sera. The major-
ity of AChR antibodies in MG sera are directed
against various nonlinear, conformation-dependent
epitopes on the extracellular part of the AChR mole-
cule, a fact that has prevented their characterization
using synthetic peptides or denatured recombinant
polypeptides obtained using prokaryotic expression
systems [20,34]. In addition, the immune responses
against the non-a AChR subunits have not been exam-
ined as carefully as those against the a subunit, even
though the differential expression of the different sub-
units may be highly significant in the pathogenesis of

MG [35].
All four ECDs of the Torpedo AChRs have previ-
ously been expressed as soluble proteins using baculo-
virus-infected insect cells [36], and the proteins showed
proper folding, but the amounts produced were insuffi-
cient for crystallization trials. Moreover, the a ECDs
of Torpedo and human AChR, which have been pro-
duced as inclusion bodies in bacteria in quantities suf-
ficient for structural studies [13,14], require denaturing
conditions for solubilization of the protein and refold-
ing and also do not undergo post-translational modifi-
cations. In the present study, we obtained stable
Pichia clones expressing satisfactory amounts of three
non-a ECDs (b1–221, c1–218 and e1–219) which were
in a soluble, secreted form and probably correctly
folded, a fact that may permit preliminary crystalliza-
tion trials. Crystallization trials require protein sam-
ples of concentration  10 mgÆmL
)1
, purity of at least
95%, and monodispersity. Based on the yields of our
yeast cultures (0.5–2 mgÆL
)1
), a medium-scale expres-
sion would suffice to provide material that, after puri-
fication and gel filtration, should be sufficiently
concentrated. The risk in this case would be the puta-
tive formation of aggregates that would render the
sample unusable for downstream processing, especially
for the recombinant c1–218 and e1–219, which were

already in the form of oligomers; this approach, how-
ever, could possibly be applicable to b1–221, which is
dimeric, stable on concentration (data not shown),
and exhibits the highest expression yield. For the c
and e ECDS, improvement in their solubility is
required before attempts at structural trials. We are
working towards this by constructing mutant forms of
the proteins. Nevertheless, these polypeptides, together
with the already produced a1–210 [17], were all specif-
ically recognized by human AChR antibodies in MG
sera, allowing their immediate use for the detailed
study of the specificities of the antibodies in MG sera
and the development of antigen-specific therapeutic
approaches.
Experimental procedures
Bacterial and yeast strains, growth conditions,
plasmids and DNA manipulations
The E. coli K-12 strain TOP10F¢ (Invitrogen, San Diego,
CA, USA) was used for replication of plasmid DNA. Clo-
ning of the ORFs encoding the b1–221, c1–218 and e1–219
ECDs was performed by standard techniques [37]. Luria–
Bertani broth and agar were used for amplification of
transformed bacteria. Ampicillin (100 lgÆmL
)1
) was used in
liquid or solid media.
The vector pPIC9 (Invitrogen) was used to clone the
ORFs in-frame with a leader sequence allowing secretion
of the produced protein after cleavage of the secretion
signal. An oligonucleotide, 5¢-GTAGATTACAAGGATG

ACGATGACAAAG-3¢ encoding the FLAG sequence,
DYKDDDDK, was introduced into the vector between the
unique SnaBI and EcoRI sites. This allowed the subsequent
in-frame cloning of our PCR products with a 5¢-EcoRI site
in such a way that the cloned ORF was expressed as a
polypeptide carrying the FLAG peptide at its N-terminus.
The resulting plasmid was named pPIC9 ⁄ FLAG.
Cloning using PCR
We used PCR to amplify the extracellular region of each of
the b, c and e subunits, using the plasmid templates,
pcDNA3.1 ⁄ Beta, pcDNA3.1 ⁄ Gamma and pcDNA3.1 ⁄
Epsilon (cDNA clones of the human b, c and e AChR sub-
units in pcDNA3.1 respectively; all kindly provided by D.
Beeson, University of Oxford, UK) [38]. PCR was per-
formed on the appropriate template for each subunit on a
Perkin-Elmer (Boston, MA, USA) thermal cycler; 5 min
denaturation at 94 °C was followed by 25 cycles of 94 °C
for 20 s, 58 °C for 30 s, and 72 °C for 90 s, and a final
5-min extension step at 72 °C. The reaction mix consisted
of 10 ng template, 50 mm each dNTP, 20 pmol each pri-
mer, and 1 U Taq DNA polymerase in a volume of 50 lL
10-fold diluted reaction buffer (Promega, Madison, WI,
USA). For b1–221, the forward primer was 5¢-GCG
GA
ATTCTCGGAGGCGGAGGGTCGAC-3¢ and the reverse
primer 5¢-ATAGTTTA
GCGGCCGCTCAATGGTGATGG
TGATGGTGCTTGCGGCGGATGATGAG-3¢. For the
c1–218 variants (some with an additional C-terminal Pro
giving c1–219), the forward primer 5¢-GGTGTA

GA
ATTCCGGAACCAGGAGGAG CGC-3¢ was used in all
cases, together with the reverse primer (a) 5¢-ATA
GTTTA
GCGGCCGCTTACTTGCGCTGGATGATGAG
CAGG-3¢ for c1–218, (b) 5¢-ATAGTTTA
GCGGCCGC
TTAGTGATGGTGATGGTGATGCTTGCGCTGGATG
Soluble extracellular domains of AChR subunits K. Kostelidou et al.
3564 FEBS Journal 273 (2006) 3557–3568 ª 2006 The Authors Journal compilation ª 2006 FEBS
AGCAGG-3¢ for c1–218HIS (c1–218 with a 6-HIS tag
at its 3¢ en d t o facilitate purification), (c) 5¢-ATAG
TTTA
GCGGCCGCTTAGGGCTTGCGCTGGATGAGCA
GG-3¢ for c1–219, or (d) 5¢-ATAGTTTA
GCGGCC
GCTTAGTGATGGTGATGGTGATGGGGCTTGCGCT
GGATGAGCAGG-3¢ for c1–219HIS. For the e1–219
variants (e1–220 with additional Pro), the forward pri-
mer 5¢-GGTGTA
GAATTCAAGAACGAGGAACTGCG-3¢
was combined with (a) 5¢-ATAGTTTAGCGGCCG
CTTACTTCCGGCGGATGATGAGCGAG-3¢ for e1–219,
(b) 5¢-ATAGTTTAGCGGCCGCTTAGTGATGGTGATG
GTGATGCTTCCGGCGGATGATGAGCGAG-3¢ for e1–
219HIS, (c) 5¢-ATAGTTTAGCGGCCGCTTACGGCTT
CCGGCGGATGATGAGCGAG-3¢ for e1–220, or (d) 5¢-
ATAGTTTAGCGGCCGCTTAGTGATGGTGATGGTGA
TGCGGCTTCCGGCG-GATGATGAGCGAG-3¢ for e1–
220HIS (underlined EcoRI and NotI). The PCR products

were purified (Qiagen PCR clean-up kit; Qiagen, Hilden,
Germany), EcoRI–NotI digested, repurified, and cloned
into the EcoRI–NotI-digested pPIC9 or pPIC9 ⁄ FLAG plas-
mid. Each PCR product was cloned into both plasmids.
Sequencing was used to verify the identity of the inserts.
Yeast transformation and dot-blot screening
of positive clones
Plasmids (10 lg) encoding the b1–221 ECD (with or with-
out the FLAG epitope) and the various c1–218 and e1–219
ECDs were linearized using SacI (for b1–221) or SalIor
SacI (for c1–218 and e1–219) and electroporated into
freshly made competent GS115 P. pastoris cells. Selection of
positive transformants (cells able to grow in the absence of
histidine) was achieved by plating on regeneration dextrose
plates (1 m sorbitol, 2% dextrose, 1.34% yeast nitrogen
base, 4 · 10
)5
% biotin, 0.005% l-glutamic acid, l-lysine,
l-methionine, l-leucine, and l-isoleucine, 2% agar) without
histidine. Small-scale cultures of single colonies were tested
after growth overnight in 3 mL BMGY medium (1% yeast
extract, 2% peptone, 100 mm potassium phosphate, pH 6.0,
1.34% yeast nitrogen base, 4 · 10
)5
% biotin, 1% glycerol)
and resuspension of the cells in 3 mL BMMY medium to
induce expression (BMMY medium is identical with
BMGY, but contains 0.5% methanol instead of glycerol)
(day 0). Methanol was added to 0.5% every 24 h to main-
tain induction, and 0.75 mL liquid medium was removed

every 24 h after day 0 to test for the expression and secre-
tion of the produced protein. The cleared supernatant was
tested on dot-blots using mAb 73, mAb 67, or anti-FLAG
mAb M2 (Sigma, St Louis, MO, USA) to test for the
expression of b, c or all ECDs, respectively. After the initial
screening, phosphate buffers with a pH of 6.5 or 7.0 were
also tested, and the pH 7.0 buffer was finally adopted for
large-scale expression. Expression levels of the different c or
e variants were estimated by quantification of the positive
signal on dot-blots of culture supernatant (at serial dilu-
tions) using imagej software (http.//rsb.info.nih.gov/ij/).
Large-scale expression and purification of
proteins
The best expressing clone was selected for each protein. A
0.1-mL sample of a small overnight culture of 20 mL
BMGY medium was used to inoculate 1 L fresh BMGY
medium. After growing to an A
600
of 3 ( 18–20 h), the
cells were spun down, washed, and resuspended in 3 L
BMMY medium to induce expression. On day two, the cul-
tures were cleared of cells by centrifugation for 20 min at
2500 g (Jouan 11175372 M4 rotor), and the supernatant
concentrated using a Millipore (Bedford, MA, USA) ultra-
filtration system (filter cut-off 10 kDa); these steps and all
subsequent steps were performed at 4 °C. The concentrate
was dialyzed overnight against 50 mm phosphate buffer,
2 m NaCl, pH 8.0, for the c and e ECDs or 50 mm phos-
phate buffer, 0.5 m NaCl, pH 8.0, for the b ECD before
binding of the protein to 1.5 mL pre-equilibrated Ni

2+
⁄ ni-
trilotriacetate ⁄ agarose (Qiagen). The protein was purified
under native conditions following the manufacturer’s
instructions. Eluates were analyzed by SDS ⁄ PAGE (12%
gel) and Coomassie blue staining or western blotting using
mAb 73 (for the b ECD) or anti-(FLAG M2) (Sigma). The
purity of the protein was estimated from Coomassie Brilli-
ant Blue-stained gels and quantification of the bands using
imagej software, and protein concentration was determined
using the Bradford method (Bio-Rad, Hercules, CA, USA).
In vitro deglycosylation
A sample (1 lg) of purified protein was deglycosylated by
incubation for 3 h at 37 °C with 1000 U N-glycosidase F
(New England Biolabs, Frankfurt, Germany) in a final vol-
ume of 50 lL under the conditions recommended by the
manufacturer for a nondenatured protein. The protein was
then precipitated by the addition of 200 lL methanol ⁄ acet-
one (1 : 1, v ⁄ v), incubation at )20 °C for 20 min, centrifu-
gation for 15 min, and resuspension in 15 lL distilled
water. The samples were analyzed by SDS ⁄ PAGE and
western blotting using FLAG mAb M2.
FPLC analysis of polypeptides
To determine the size of b1–221, c1–218 or e1–219, FPLC
analysis on a Superose-12 column (Amersham-Pharmacia,
Munich, Germany) was performed in 50 mm sodium phos-
phate buffer ⁄ 300 mm NaCl, pH 8.0, at a flow rate of
0.5 mLÆmin
)1
. Samples of each fraction (normally 1 and

10 lL of each 0.5-mL fraction) were tested for the presence
of the specific protein by dot-blotting with FLAG mAb
M2.
K. Kostelidou et al. Soluble extracellular domains of AChR subunits
FEBS Journal 273 (2006) 3557–3568 ª 2006 The Authors Journal compilation ª 2006 FEBS 3565
Radioactive labeling of protein markers and
a-bungarotoxin
a-Bungarotoxin (24 lg) or 2 lg either bovine erythrocyte
carbonic anhydrase ( 29 000 Da) or BSA ( 66 200 Da)
(both from Fluka; Sigma-Aldrich, Athens, Greece) was
labeled, respectively, with 2 mCi or 0.1 mCi
125
I, using the
chloramine T method [39], loaded on to a G50-Fine column
(Amersham-Pharmacia), and the labeled protein collected
and stored at )20 °C. Approximately 100 000 c.p.m. of
each of the
125
I-labeled protein markers was loaded on
every FPLC run as size markers.
Preparation of rabbit anti-(b subunit) serum
An 8-week-old female New Zealand White rabbit was injec-
ted subcutaneously with  0.5 mg purified b1–221 protein
in 50% (v ⁄ v) complete Freund’s adjuvant, followed by
three injections at monthly intervals in 50% incomplete
Freund’s adjuvant. One week after the last injection, anti-
serum was collected, aliquoted, and stored at )20 °C in the
presence of 0.05% sodium azide. Use of experimental ani-
mals abides by law 2015/27-2-1992 of the Greek Republic
and Presidential Decree 160/3-5-1991 in accordance with

directive 86/609EOK of the Council of Europe for protec-
tion of vertebrates/animals used for experimental or other
research purposes.
CD spectra
CD spectra were measured at 20 °C using a Jasco model
J-715 spectropolarimeter (located at NCSR, Demokritos,
Athens, Greece) in semi-automatic slit adjustment mode.
The scan speed was set at 50 nmÆmin
)1
, the response time
at 2 s, and the scan range at 180–260 nm. Optical activity
was expressed as the mean residue ellipticity (Q), in degree-
sÆcm
2
Ædmol
)1
, based on a mean residue weight of 115 for
the b ECD polypeptide. The derived spectrum represents
the mean of eight scans and was corrected for light scatter-
ing by buffer subtraction. The protein concentration was
optimized as 0.2 mgÆmL
)1
, and the quartz cell path length
was 1 mm. All samples were optically homogeneous.
ELISA
ELISA plates (Maxi-Sorb; Nun Roskilde, Denmark) were
coated, as described previously [14], using 0.25 lg purified
recombinant protein (b1–221, c1–218 or e1–219) per well.
Control wells were coated with BSA (0.25 lg). Additional
control wells were coated with 0.25 lg a ECD (a1–210) or

100 lL yeast culture supernatant prepared as follows:
100 mL of a culture of P. pastoris GS115 strain was spun,
and the supernatant filtered, concentrated 40-fold, and dia-
lyzed against 50 mm phosphate buffer, pH 8.0.
The plates were washed with phosphate-buffered saline,
pH 7.5 (NaCl ⁄ P
i
) and blocked for 30 min at 37 °C with
blocking solution (5% nonfat milk in NaCl ⁄ P
i
), then incu-
bated for 1 h at 25 °C with primary antibody in blocking
solution; mAbs were used at a 1 : 100 dilution (the concen-
tration of the undiluted mAb ‘stock solution’ was 0.1–
0.5 mgÆmL
)1
), and the rabbit antiserum was used at dilu-
tions of 1 : 100–1 : 10 000. After three washes with block-
ing solution, the plates were incubated for 1 h at 25 °C
with secondary antibody [horseradish peroxidase-conju-
gated rabbit anti-rat IgG (Dako, Glostrup, Denmark) in
the case of the mAbs and sheep anti-rabbit IgG (Dako)] at
a 1 : 500 dilution in blocking solution. No secondary anti-
body was used when the FLAG mAb M2 was used, as the
antibody was supplied in its horseradish peroxidase-conju-
gated form (Sigma). The ELISA plate was developed using
3,3¢,5,5¢-tetramethylbenzidine ready-to-use substrate (MBI-
Fermentas, St Leon-Rot, Germany), stopping the reaction
with 0.2 m H
2

SO
4
. The plate was read at 450 nm on a
microtiter plate reader.
Preparation of ECD–Sepharose beads
ECD (0.25 mg) mixed with BSA (1.25 mg, as carrier) were
bound to 0.25 g CNBr-activated Sepharose beads (Pharma-
cia, Munich, Germany) according to the manufacturer’s
protocol as described previously [26]. The beads were then
diluted in NaCl ⁄ P
i
⁄ 2% BSA ⁄ 0.05% NaN
3
so that 120 lL
of the mixture contained 1 lg recombinant protein. Control
beads were prepared using 1.5 mg BSA.
Use of the ECD–Sepharose matrix for binding
AChR antibodies in MG sera
Depending on the AChR antibody titer, different dilutions
of sera were prepared: the MG sera were diluted 1 : 10 (for
serum titer 5 nm) to 1 : 500 (for titer 290 nm) supplemented
with normal human serum to a final serum dilution of
1 : 10. This guaranteed that the amount present in the
untreated sample would immunoprecipitate  50% of the
labeled AChR. A 40-lL portion of the dilution was incuba-
ted for 2 h at 4 °C with 120 lL Sepharose–ECD or Seph-
arose–BSA matrix (final volume 160 lL), and then
duplicate 40-lL samples of supernatant (containing 1 lL
serum) were tested in the RIA described below.
RIA for MG sera or rabbit anti-(b1–221) serum

We tested the ability of MG sera to precipitate a-bungaro-
toxin-labeled human AChR prepared from either TE671
cells or a mixture of CN21 ⁄ TE671 cells (CN21 cells express
the e and c AChR subunits at a ratio of approximately
2 : 1 [40], whereas TE671 cells express only the c subunit
AChR [25]). The TE671-derived AChR was used when sera
Soluble extracellular domains of AChR subunits K. Kostelidou et al.
3566 FEBS Journal 273 (2006) 3557–3568 ª 2006 The Authors Journal compilation ª 2006 FEBS
had been preincubated with c1–218–Sepharose beads, and
the mixed AChR was used when the sera were preincubated
with the other ECD–Sepharose beads. Human AChR (14
fmol) was labeled for 4 h at 4 °C with 50 000 c.p.m.
125
I-a-bungarotoxin ( 70 fmol) in a volume of 20 lL,
then 40 lL of the ‘treated’ MG serum (preincubated with
either ECD–Sepharose or BSA–Sepharose) was added. The
mixtures were incubated for 16–18 h at 4 °C, then immune
complexes were precipitated by incubation for 1.5 h at 4 °C
with 10 lL goat anti-(human c-globulin) serum (Lampire
Biological Laboratories, Pipersville, PA, USA), followed
by centrifugation. The samples were washed twice by the
addition of 1 mL NaCl ⁄ P
i
(pH 7.4) ⁄ 0.5% Triton X-100
and centrifugation at 3500 g for 10 min at 4 °C. The preci-
pitated radioactivity was counted on a c-counter. If the
antibodies bound specifically to the test ECD protein, a
reduction in the amount of antibodies would be detected in
the MG serum sample incubated with ECD–Sepharose
(sample 1) compared with the same sample incubated with

BSA–Sepharose (sample 2). This reduction should be pro-
portional to the fraction of autoantibodies reactive with the
subunit. The percentage immunoadsorption was estimated
as 100 · {[Dc.p.m. (Sample 2)] – [ Dc.p.m. (Sample 1)]} ⁄
[Dc.p.m. (Sample 2)], where Dc.p.m. is the difference
between the individual sample c.p.m. value (from precipita-
ted
125
I-labeled AChR) and that from the corresponding
negative serum control sample.
When the rabbit anti-(b1–221) serum was used supplemen-
ted with normal rabbit serum to a total volume of 0.1 lL, the
immune complexes were precipitated using 0.3–1 lL goat
anti-rabbit IgG (Sigma) and incubation for 1.5 h at 4 °C, all
other steps being identical with those described above.
Acknowledgements
This work was supported by grants from the Quality
of Life program of the EU (contract QLG3-CT-2001-
00225), the Association Franc¸ aise contre les Myopathies
(AFM), and the Muscular Dystrophy Association of
USA (MDA). We are grateful to Anna Kokla for
excellent technical assistance, and Dr D. Beeson (Uni-
versity of Oxford) for the cDNA clones.
References
1 Karlin A (2002) Emerging structure of the nicotinic
acetylcholine receptors. Nat Rev Neurosci 3, 102–114.
2 Le Novere N, Corringer PJ & Changeux JP (2002) The
diversity of subunit composition in nAChRs: evolution-
ary origins, physiologic and pharmacologic conse-
quences. J Neurobiol 53, 447–456.

3 Unwin N (2005) Refined structure of the nicotinic acet-
ylcholine receptor at 4 A
˚
resolution. J Mol Biol 346,
967–989.
4 Blount P & Merlie JP (1989) Molecular basis of the two
nonequivalent ligand binding sites of the muscle nicoti-
nic acetylcholine receptor. Neuron 3, 349–357.
5 Sine S & Claudio T (1991) Gamma- and delta-subunits
regulate the affinity and the cooperativity of ligand
binding to the acetylcholine receptor. J Biol Chem 266,
19369–19377.
6 Sine S, Bren N & Quiram PA (1998) Molecular dissec-
tion of subunit interfaces in the nicotinic acetylcholine
receptor. J Physiol (Paris) 92, 101–105.
7 Krusek J & Vyskocil F (2003) Different degree of coop-
erativity in adult, embryonic and mutated mouse muscle
nicotinic receptors. Biochim Biophys Acta 1646, 119–130.
8 Wheeler SV, Jane SD, Cross KM, Chad JE & Foreman
RC (1994) Membrane clustering and bungarotoxin
binding by the nicotinic acetylcholine receptor: role of
the beta subunit. J Neurochem 63, 1891–1899.
9 Vincent A, Palace J & Hilton-Jones J (2001) Myasthenia
gravis. Lancet 357 , 2122–2128.
10 Hoch W, McConville J, Helms S, Newsom-Davis J,
Melms A & Vincent A (2001) Auto-antibodies to the
receptor tyrosine kinase MuSK in patients with
myasthenia gravis without acetylcholine receptor antibo-
dies. Nat Med 7, 365–368.
11 Brejc K, VanDijk WJ, Klaassen RV, Schuurmans M,

Van der Oost J, Smit AB & Sixma TK (2001) Crystal
structure of an ACh-binding protein reveals the ligand-
binding domain of nicotinic receptors. Nature 411,
269–276.
12 Schrattenholz A, Pfeiffer S, Pejovic V, Rudolph R,
Godovac-Zimmermann J & Maelicke A (1998) Expres-
sion and renaturation of the N-terminal extracellular
domain of Torpedo nicotinic acetylcholine receptor
a-subunit. J Biol Chem 273, 32393–32399.
13 Alexeev T, Krivoshein A, Shevalier A, Kudelina I,
Telyakova O, Vincent A, Utkin Y, Hucho F & Tsetlin
V (1999) Physicochemical and immunological studies of
the N-terminal domain of the Torpedo acetylcholine
receptor a-subunit expressed in Escherichia coli. Eur
J Biochem 259, 310–319.
14 Tsouloufis T, Mamalaki A, Remoundos M & Tzartos SJ
(2000) Reconstitution of conformationally dependent
epitopes on the N-terminal extracellular domain of the
human muscle acetylcholine receptor alpha subunit expres-
sed in Escherichia coli: implications for myasthenia gravis
therapeutic approaches. Int Immunol 12, 1255–1265.
15 Forsayeth JR, Franco A Jr, Rossi AB, Lansman JB &
Hall ZW (1990) Expression of functional mouse muscle
acetylcholine receptors in Chinese hamster ovary cells.
J Neurosci 10, 2771–2779.
16 West AP, Bjorkman PJ, Dougherty DA & Lester HA
(1997) Expression and circular dichroism studies of the
extracellular domain of the a subunit of the nicotinic
acetylcholine receptor. J Biol Chem 272, 25468–25473.
K. Kostelidou et al. Soluble extracellular domains of AChR subunits

FEBS Journal 273 (2006) 3557–3568 ª 2006 The Authors Journal compilation ª 2006 FEBS 3567
17 Psaridi-Linardaki L, Mamalaki A, Remoundos M &
Tzartos SJ (2002) Expression of soluble ligand- and
antibody-binding extracellular domain of human muscle
acetylcholine receptor a subunit in yeast Pichia pastoris:
role of glycosylation in a-bungarotoxin binding. J Biol
Chem 227, 26980–26986.
18 Avramopoulou V, Mamalaki A & Tzartos SJ (2004)
Soluble, oligomeric, and ligand-binding extracellular
domain of the human alpha7 acetylcholine receptor
expressed in yeast: replacement of the hydrophobic
cysteine loop by the hydrophilic loop of the ACh-bind-
ing protein enhances protein solubility. J Biol Chem
279, 38287–38293.
19 Vincent A, McConville J, Farrugia ME, Bowen J, Plest-
ed P, Tang T, Evoli A, Matthews I, Sims G, Dalton P,
et al. (2003) Antibodies in Myasthenia gravis and rela-
ted disorders. Ann NY Acad Sci 998, 324–335.
20 Tzartos SJ, Barkas T, Cung MT, Mamalaki A, Mar-
raud M, Orlewski P, Papanastasiou D, Sakarellos C,
Sakarellos-Daitsiotis M, Tsantili P, et al. (1998) Anat-
omy of the antigenic structure of a large membrane
autoantigen, the muscle-type nicotinic acetylcholine
receptor. Immunol Rev 163, 89–120.
21 Yao Y, Wang J, Viroonchatapan N, Samson A, Chill J,
Rothe E, Anglister J & Wang Z-Z (2002) Yeast expres-
sion and NMR analysis of the extracellular domain of
muscle nicotinic acetylcholine receptor a subunit. J Biol
Chem 277, 12613–12621.
22 Tzartos S, Seybold ME & Lindstrom JM (1982) Specifi-

cities of antibodies to acetylcholine receptors in sera
from myasthenia gravis patients measured by monoclo-
nal antibodies (experimental autoimmune myasthenia
gravis). Proc Natl Acad Sci USA 79, 188–192.
23 Fasman GD (1995) The measurement of transmembrane
helices by the deconvolution of CD spectra of mem-
brane proteins: a review. Biopolymers (Peptide Sci) 37,
339–362.
24 Tzartos SJ, Rand DE, Einarson BL & Lindstrom JM
(1981) Mapping of surface structures of Electrophorus
acetylcholine receptor using monoclonal antibodies.
J Biol Chem 256, 8635–8645.
25 Luther MA, Schoepfer R, Whiting P, Casey B, Blatt Y,
Montal MS, Montal M & Lindstrom J (1989) A muscle
acetylcholine receptor is expressed in the human cerebel-
lar medulloblastoma cell line TE671. J Neurosci 9,
1082–1096.
26 Psaridi-Linardaki L, Trakas N, Mamalaki A & Tzartos
SJ (2005) Specific immunoadsorption of the autoantibo-
dies from myasthenic patients using the extracellular
domain of the human muscle acetylcholine receptor
a-subunit. Development of an antigen-specific therapeu-
tic strategy. J Neuroimmunol 159 , 183–191.
27 Green W & Wanamaker P (1997) The role of the
cysteine loop in acetylcholine receptor assembly. J Biol
Chem 272, 20945–20953.
28 Anderson DJ & Blobel G (1981) In vitro synthesis, gly-
cosylation and membrane insertion of the four subunits
of Torpedo acetylcholine receptor. Proc Natl Acad Sci
USA 78, 5598–5602.

29 Celie PHN, Klaassen RV, van Rossum-Fikkert SE, van
Elk R, van Nierop P, Smit AB & Sixma TK (2005)
Crystal structure of acetylcholine-binding protein from
Bulinus truncatus reveals the conserved structural scaf-
fold and sites of variation in nicotinic acetylcholine
receptors. J Biol Chem 280, 26457–26466.
30 Geuder KI, Marx A, Witzemann V, Schalke B, Toyka
K, Kirchner T & Muller-Hermelink HK (1992) Pathoge-
netic significance of fetal-type acetylcholine receptors on
thymic myoid cells in myasthenia gravis. Dev Immunol
2, 69–75.
31 Missias AC, Chu GC, Klocke BJ, Sanes JR & Merlie
JP (1996) Maturation of the acetylcholine receptor in
skeletal muscle: Regulation of the AChR c-to-e switch.
Dev Biol 179, 223–238.
32 Schluep M, Willcox N, Vincent A, Dhoot GK &
Newsom-Davis J (1987) Acetylcholine receptors in
human thymic myoid cells in situ: an immunohistologi-
cal study. Ann Neurol 22, 212–222.
33 Horton RM, Manfredi AA & Conti-Tronconi BM
(1993) The ‘embryonic’ gamma subunit of the nicotinic
acetylcholine receptor is expressed in adult extraocular
muscle. Neurology 43, 983–986.
34 Vincent A, Whiting PJ, Schluep M, Heidenreich F,
Lang B, Roberts A, Willcox N & Newsom-Davis J
(1987) Antibody heterogeneity and specificity in
myasthenia gravis. Ann NY Acad Sci 505, 106–120.
35 Ragheb S & Lisak R (2003) Differences between the e
and c subunits of the acetylcholine receptor (AChR)
may be significant in autoimmune myasthenia gravis.

Ann NY Acad Sci 998, 336–338.
36 Tierney. ML. & Unwin N (2000) Electron microscopic
evidence for the assembly of soluble pentameric extra-
cellular domains of the nicotinic acetylcholine receptor.
J Mol Biol 303, 185–196.
37 Sambrook J, Fritsch EF & Maniatis T (1989) Molecular
Cloning: A Laboratory Manual. Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, NY.
38 Beeson D, Brydson M, Betty M, Jeremiah S, Povey S,
Vincent A & Newsom- Davis J (1993) Primary structure
of the human muscle acetylcholine receptor: cDNA clon-
ing of the c and e subunits. Eur J Biochem 215, 229–238.
39 Lindstrom J, Einarson B & Tzartos S (1981) Production
and assay of antibodies to acetylcholine receptors.
Methods Enzymol 74, 432–460.
40 Beeson D, Amar M, Bermudez I, Vincent A &
Newsom-Davis J (1996) Stable functional expression of
the adult subtype of human muscle acetylcholine recep-
tor following transfection of the human rhabdomyosar-
coma cell line TE671 with cDNA encoding the epsilon
subunit. Neurosci Lett 207, 57–60.
Soluble extracellular domains of AChR subunits K. Kostelidou et al.
3568 FEBS Journal 273 (2006) 3557–3568 ª 2006 The Authors Journal compilation ª 2006 FEBS