Báo cáo khoa học: Interaction of selenium compounds with zinc finger proteins involved in DNA repair pdf

Interaction of selenium compounds with zinc finger proteins involved
in DNA repair
Holger Blessing
1
, Silke Kraus
1
, Philipp Heindl
1
, Wojciech Bal
2
and Andrea Hartwig
1,3
1
Institute of Food Chemistry and Toxicology, University of Karlsruhe, Germany;
2
Institute of Biochemistry and Biophysics, Polish
Academy of Sciences, Warsaw, Poland;
3
Institute of Food Technology and Food Chemistry, Technical University Berlin, Germany
As an essential element, selenium is present in enzymes from
several families, including glutathione peroxidases, and is
thought to exert anticarcinogenic properties. A remarkable
feature o f selenium consists of its a bility t o oxidize thiols
under reducing conditions. Thus, one mode of action
recently suggested is the oxidation of thiol groups of metal-
lothionein, thereby providing zinc for essential reactions.
However, tetrahedral z inc ion complexation to four thio-
lates, similar to that foun d in metallothionein, is present in
one of the major classes of transcription factors and other
so-called zinc finger proteins. Within this study we investi-
gated the effect of selenium compounds on the activity of the

formamidopyrimidine-DNA glycosylase (Fpg), a zinc finger
protein involved in base excision repair, and on the DNA-
binding capacity and i ntegrity of xeroderma p igmentosum
group A protein (XPA), a zinc finger protein essential
for nucleotide excision repair. The reducible selenium
compounds phenylseleninic acid, phenylselenyl chloride,
selenocystine, ebselen, and 2-nitrophenylselenocyanate
caused a concentration-dependent decrease of Fpg activity,
while no inhibition was detected with fully reduced
selenomethionine, methylselenocysteine or some sulfur-
containing analogs. Furthermore, reducible selenium com-
pounds interfered with XPA–DNA binding and released
zinc from the zinc finger motif, XPAzf. Zinc release was even
evident at high glutathione/oxidised glutathine ratios p re-
vailing under c ellular conditions. F inally, comparative
studies with metallothionein and XPAzf revealed similar or
even accelerated zinc release from XPAzf. Altogether, the
results indicate that zinc finger motifs are highly reactive
towards o xidizing selenium compounds. This could affect
gene expression, DNA repair and, thus, genomic stability.
Keywords: DNA repair; glutathione; metallothionein;
selenium; zinc finger proteins.
As an essential e lement, selenium is present in enzymes
from several families, including glutathione peroxidases
and thioredoxin reductases [1]. Epidemiological evidence, as
well as animal studies, point towards an inverse relationship
between selenium intake and certain types of c ancer [2,3],
even though there are still some inconsistencies [4] and the
levels required are a matter of d ebate [ 5]. Moreover, a
multicenter, double-blind, randomized, placebo-controlled

cancer prevention trial, originally started up to investigate
whether nutritional supplementation with selenium can
decrease the r isk o f s kin c ancer, revealed s ignificant
reductions in lung, colorectal and prostate cancers as
secondary end-points [6]. Nevertheless, a follow-up of this
study demonstrated an increased incidence of squamous cell
carcinoma a nd of total nonmelanoma skin cancer [7]. As
selenocysteine is an essential constituent of glutathione
peroxidases [8], selenium has been proposed to be an
antioxidant, but careful consideration of i ts manifold
chemical properties and biological activities reveals far
more complex roles with respect to cancer, artherosclerosis
and n eurodegenerative diseases [9]. From a biochemical
point of view, selenium substitutes for sulfur in defined
cysteines in selenoproteins. It differs from sulfur by redox
potentials and stabilities of oxidation states, leading to
multiple catalytic potentials. A r emarkable feature of
selenium consists of its ability to oxidize thiols under
reducing conditions that are present in the cytosol [2,10,11].
One mode of action recently suggested, which may be
related to the protective properties of selenium, is its
involvement in cellular zinc homeostasis. This assumption is
based on the capacity of certain selenium compounds to
catalyse thiol/disulfide interchange reactions, which mobil-
ize redox-inert zinc from its binding sites, and to reduce
protein disulfides, thereby generating potential binding sites
for zinc in proteins. In this context, reducible selen ium
compounds have been shown to release zinc from metal-
lothionein (MT) in isolated systems, which may thus be
available for essential reactions [12–16]. However, tetrahe-

dral zinc ion complexation to four thiolates, similarly to that
found in MT, is present in one of the major classes of
transcription factors and other so-called zinc finger proteins
Correspondence to A. Hartwig, Technical University Berlin, Institute
of Food Technology and Food Chemistry, Sekr. TIB 4/3-1,
Gustav-Meyer-Allee 25, D-13355 Berlin, Germany.
Fax: +49 30 314 72823, Tel.: +49 30 314 72789,
E-mail:
Abbreviations: Fpg, formamidopyrimidine-DNA glycosylase; GSH,
reduced glutathione; GSSG, oxidized glutathione; MT, metallo-
thionein; NER, nucleotide excision repair; PAR, 4-(2-pyridylazo)-
resorcinol; XPA, xeroderma pigmentosum group A protein;
XPAzf, synthetic polypeptide corresponding to the
XPA zinc finger domain.
(Received 5 February 2004, revised 6 June 2004, accepted 9 June 2004)
Eur. J. Biochem. 271, 3190–3199 (2004) Ó FEBS 2004 doi:10.1111/j.1432-1033.2004.04251.x
(Fig. 1), raising the question of whether reducible selenium
compounds are able to release zinc also from this group of
proteins. They represent a family of proteins where zinc is
complexed through four invariant cysteine and/or histidine
residues, forming a zinc finger domain that is mostly
involved in DNA binding but also in protein–protein
interactions [17]. Originally identified as being present in
different transcription factors, it is now known that zinc
finger structures are among the most abundant protein
motifs in the eukaryotic genome and have diverse functions
in many cellular processes [18]: from human genome
sequencing it is estimated that % 3% of the identified genes
encode proteins with zinc finger domains [19]. It is assumed
that many of these proteins are regulated by the oxida tion of

zinc-binding cysteine residues, which leads to a loss of DNA
binding, zinc release and/or formation of disulfide bridges
[20]. With respect to selenium compounds, it has recently
been shown that selenite impairs the DNA-binding activity
of TFIIIH, a transcription factor with three zinc finger
motifs of the Cys
2
His
2
type [21]. Furthermore, nanomolar
concentrations of glutathione peroxidase mimics were
demonstrated to facilitate the H
2
O
2
-induced oxidation of
a Sp1 transcription factor fragment [22]. While interactions
of selenium compounds with redox-regulated transcription
factors have been repeatedly discussed to be involved in
selenium-based chemopreventive effects [23,24], it has to be
taken into account that, besides transcription factors, zinc
finger structures are also present in other proteins t hat have
essential functions in maintaining genomic stability. These
include factors involved in DNA damage signaling and
repair, such as poly(ADP-ribose) polymerase-1, formami-
dopyrimidine-DNA glycosylase (Fpg), which is involved in
the repair of certain types o f oxidative DNA base damage
[25], and xeroderma pigmentosum group A protein (XPA),
which is essential for the assembly of the DNA damage
recognition/incision complex during nucleotide excision

repair (NER) in mammalian cells [26].
Within the present study we invest igated the effects of
selenium compounds in different oxidation states, as listed in
Table 1 , on the activities of the DNA repair proteins Fpg and
XPA, as well as on zinc release from a synthetic polypeptide,
corresponding to the XPA zinc finger domain (XPAzf).
Furthermore, comparative studies with MT and XPAzf were
conducted to elucidate the efficiency of zinc release, and,
finally, different concentrations of reduced and oxidized
glutathione (GSH and GSSG, respectively) were used to
investigate the effects under reducing vs. oxidizing condi-
tions. We used methylselenocysteine and selenomethionine,
as well as selenocystine, as constituents of selenium-enriched
yeast, broccoli and onion [27,28]. Our study also included
ebselen, phenylseleninic acid, phenylselenyl chloride and
2-nitrophenylselenocyanate – synthetic organic compounds
with functional selenium groups exerting cancer-preventive
activities and/or which have been shown previously to release
zinc from MT [13–16]. We demonstrate that the reducible
selenium compounds included in this study (a) inhibit Fpg
activity, (b) modulate XPA–DNA interactions, and (c)
release zinc from XPAzf with equal or stronger efficiency
than MT. The release of zinc also occurred at high ratios of
GSH/GSSG, indicating that this reaction mechanism may
also be relevant for cellular conditions.
Fig. 1. Structures of metallothionein (MT) and XPAzf (a synthetic
polypeptide corresponding to the xeroderma pigmentosum group A
protein zinc finger domain). (A) C rystal st ructure of Cd
5
Zn

2
-MT-2
from rat liver, showing the N-terminal b-dom ain (upper part) and the
C-terminal a-domain (lower part) [56]. (B) Solut ion structure of
XPAzf, based o n the NMR structure of XPA-MBD [31,58]. Side-
chains of the zinc coordinating cysteines are colored in black. Both MT
and XPA zf exert tetrahedral m etal ion coordination [31,57]. Coordi-
nating cysteines are numbered 105, 108, 126 and 129 in XPA and 5, 7,
13, 15, 19, 21, 24, 26, 29, 33, 34, 36, 37, 41, 44, 48, 50, 57, 59 and 60 in
MT. These stru ctures are adapted from e ntries made to the Brook-
haven protein databank (accession code 4mt2 for MT and 1xpa for
XPA) and modified with
CHIME
(version 2.6 SP6).
Ó FEBS 2004 Selenium and zinc finger DNA repair proteins (Eur. J. Biochem. 271) 3191
Materials and methods
Materials
Agarose t ype II, dimethylsulfoxide, phenylseleninic acid,
methylselenocysteine, diamide, Ficoll 400, zinc metallo-
thionein II and BSA were from Sigma-Aldrich (Deisenho-
fen, Germany).
L
-cystine, phenylsulfinic acid,
L
-methionine,
methylene blue, xylene cyanol FF and 2-2¢-dithiodipyridine
were obtained from Fluka Chemie (Buchs, Switzerland).
Bromophenol blue sodium salt, phenylselenyl chloride,
acrylamide/bisacrylamide solution (37.5 : 1, w/w; 40%,
w/v), ammonium peroxodisulfate, as well as zinc(II) chlor-

ide, were products of Merck (Darmstadt, Germany). Anti-
digoxigenin Fab fragments and blocking reagent were
obtained from Boehringer (Mannheim, Germany), and
dithiothreitol, maleic acid, TEMED and Tween-20 were
from Serva (Heidelberg, Germany). Enhanced chemilumi-
nescence (ECL)
TM
detection reagents were provided by
Amersham (Bucks., UK). 4-(2-Pyridylazo)-resorcinol
monosodium salt (PAR) was from Riedel-de Haen (Seelze,
Germany). Ebselen, 2-nitrophenylselenocyanate,
L
-seleno-
methionine and
L
-selenocystine were obtain ed from Acros
(Geel, Belgium).
Fpg activity
Fpg was a kind gift of S. Boiteux (Commissariat a
l’Energie Atomique, Fontenay aux Roses, France). The
concentration applied in the activity assay (1 lgÆmL
)1
)was
selected based on the results of dose–response experiments
leading to saturation in DNA damage recognition, as
determined for each batch of the enzyme. No nonspecific
DNA cleavage was observed. Fpg activity was quantified by
incision of oxidatively d amaged PM2 DNA, essentially as
described previously [29] with some modifications. Briefly,
PM2 bacteriophage was amplified in Alteromonas espejiana

and its circular supercoiled DNA of 10 kb was purified,
yielding % 90% supercoiled molecules. PM2 DNA was
dissolved in enzyme buffer (40 m
M
sodium phosphate,
100 m
M
NaCl, pH 7 .4) and oxidatively d amaged by
addition of the photoreactive thiazin dye methylene blue
(final concentra tion 10 lgÆmL
)1
) and irradiation with visible
light (216 JÆm
)2
). After precipitation (at 4 °C for 30 min)
with ethanol containing 125 m
M
sodium acetate, the DNA
wascentrifugedfor5minat7000g. The supernatant was
discarded and the DNA pellet resuspended in enzyme
buffer. Damage induction and all subsequent steps were
carried out in the dark to prevent additional DNA damage.
Oxidatively damaged PM2 DNA (300 ng per sample) and
Fpg (1 lgÆmL
)1
;30lL per sample) were incubated for
30 min at 37 °C; the reaction was terminated by adding
7 lL of stop solution (0.25% bromophenol blue, 0.25%
xylene cyanol, 15% Ficoll 400, w/w/w). When investigating
the effects o f selenium c ompounds, Fpg was preincubated

with the respective compounds for 30 min at 37 °Cin
enzyme buffer. DNA strand breaks or nicks generated by
Fpg convert the supercoiled PM2 molecule into the open
circular form; both forms were separated by electrophoresis
in a 1% agarose gel in buffer (89 m
M
Trizma-Base, 89 m
M
boric acid, 1 m
M
EDTA, pH 8.2) for 2.5 h at 90 V and
stained with ethidium bromide. The bands were quantified
by applying a HEROLAB gel detection system (
E.A.S.Y
.
WIN 32
). For calculation of break frequencies, a Poisson
distribution was assumed and a correction factor of 1.4 was
applied to compensate for the relatively lower fluorescence
of the supercoiled form [30]:
N ¼Àln½ð1:4  IÞ=ð1:4  I þ IIÞ
where N ¼ the number of s trand breaks per molecule of
PM2, I ¼ the p ercentage of supercoiled PM2 DNA, and
II ¼ the percentage of open circular PM2 DNA. The
overall number of s trand breaks p er 10 000 bp represents
the sum of single-strand breaks and incisions generated by
the repair enz yme.
DNA-binding activity of XPA
Purified recombinant mouse XPA protein was kindly
provided by A. Eker (University of Rotterdam, Rotterdam,

the Netherlands). The DNA-binding activity was d eter-
mined by gel mobility shift experiments using a digoxygenin
end-labeled synthetic double-strand oligonucleotide (70 bp;
MWG Biotech, Ebersberg, Germany) of the following
5¢fi3¢ sequence: 5¢-ATATGTGCACATGGCGCACGT
ATGTATCTATAGTCTGCCATCACGCCAGTCAAT
CGCTGTGGTATATGCA-3¢. XPA (500 ng) was pre-
treated with selenium compounds for 30 min at 37 °Cin
the gel shift buffer (final concentration 25 m
M
Hepes-
KOH, 10% glycerol, 30 m
M
KCl, 4 m
M
MgCl
2
,1m
M
EDTA, 45 lgÆmL
)1
BSA, 15 l
M
dithiothreitol, pH 8.3)
previously purged with argon. Afterwards, 240 fmol of
the irradiated (18 kJÆm
)2
UVC; 254 nm germicidal lamp,
Table 1. Structures and oxidation states of selenium compounds used in
the present study.

3192 H. Blessing et al. (Eur. J. Biochem. 271) Ó FEBS 2004
VL-6C; Bioblock Scientific, Illkirch, France) digoxigenin-
labeled oligonucleotide were added and incubated for
30 min at room temperature in the dark. The binding
mixture was loaded onto a 5% polyacrylamide gel
[acrylamide/bisacrylamide (37.5 : 1.0, w/w), 50 m
M
Tris/
HCl, 50 m
M
boric acid, 1 m
M
EDTA, pH 8.0] and
electrophoresis was conducted for 75 min. Southern
blotting was carried out in a semidry electroblotting
apparatus using a positively charged nylon membrane
(Hybond-N
+
Amersham, Braunschweig, Germany), fol-
lowed by fixation at 90 °C for 1.5 h. Digoxigenin-labelled
oligonucleotide was detected by chemiluminescence with
an anti-digoxigenin immunoglobulin conjugated to
horseradish peroxidase, using the ECL
TM
detection
system (Amersham, UK).
Zinc release from XPAzf and MT
The XPAzf peptide with the sequence: Ac-DYVICEE
CGKEFMDSYLMNHFDLPTCDNCRDADDKHK-am
(purity > 95%) was custom synthesized by Schafer-N

(Copenhagen, Denmark). The identity and purity of the
peptide was confirmed by HPLC and ESI-MS, as described
previously [31]. R econstitution of the z inc finger structure
was performed by the addition of equimolar amounts o f
zinc, which resulted in correct folding, as demonstrated by
CD spectra and fluorescence spectroscopy [31].
Unbound zinc and salts were removed from MT by
ultrafiltration and MT was further characterized by quan-
tification of the thiol groups with 2-2¢-dithiodipyridine
[32,33], y ielding 19.2 t hiol groups per molecule. Protein
concentrations were determined spectrophotometrically by
using the extinction coefficients published p reviously [34].
Determination of the metal content of MT by complete zinc
release after oxidation with 10 m
M
H
2
O
2
and ICP-MS
revealed 6.4 zinc atoms per molecule of MT and negligible
amounts of cadmium and copper.
Zinc release from XPAzf and MT was measured spectro-
photometrically by quantifying the formation o f complexes
between two m olecules of the chelating dye PAR and zinc(II)
[35,36]. XPAzf (20 l
M
)orMT(5l
M
) were incubated with

the respective selenium compounds for 30 min at 37 °Cin
20 m
M
Hepes-NaOH buffer (pH 7.4), previously purged
with argon. Following the addition of 100 l
M
PAR, the
absorption was measured immediately at 492 nm. As
positive controls, XPAzf or MT were exposed to 10 m
M
H
2
O
2
for 30 m in at 37 °C to fully oxidize the thiol groups in
the respective m olecule. Zinc r elease occurring under these
conditions was maximal and considered to be 100%.
Results
Effect of selenium and corresponding sulfur compounds
on Fpg activity
First, the effect of selenium compounds on the activity of
the isolated Fpg was investigated. Fpg recognizes and
removes 7 ,8-dihydro-8-oxoguanine (8-oxoguanine), the
imidazol ring opened purines 2,6-diamino-4-hydroxy-5-
formamidopyrimidine (Fapy-Gua), 4,6-diamino-5-form-
amidopyrimidine (Fapy-Ade) and, to a smaller extent,
7,8-dihydro-8-oxoadenine (8-oxoadenine), as well as apuri-
nic/apyrimidinic sites, and converts them into DNA single-
strand breaks by its associated DNA endonuclease activity
[37, 38]. We applied supercoiled isolated PM2 DNA, which

had been oxidatively damaged with methylene blue and
visible light, a treatment shown to generate predominantly
8-oxoguanine and small amounts o f Fapy-Gua [38, 39]; if
Fpg i s active, then oxidatively damaged supercoiled P M2
molecules are converted into the open circular form. None
of the selenium compounds induced DNA strand breaks by
themselves (data not shown); however, Fpg activity was
inhibited to differing extents, depending on the selenium
compound (Fig. 2). Wh ile fully reduced selenomethionine
and methylselenocysteine did not affect enzyme activity at
concentrations up to 1 m
M
(data not shown), phenylselenyl
chloride, selenocystine, phenylseleninic acid, 2-nitrophenyl-
selenocyanate and ebselen reduced the Fpg activity in a
dose-dependent manner, yielding complete inhibition. The
strongest inhibition was observed when using ebselen; the
enzyme was almost completely inactivated at 100 n
M
selenium compound. To determine whether these inhibi-
tions were mediated by selenium, comparative studies were
conducted with some sulfur analogues. As shown in Fig. 3,
neither cystine nor phenylsulfinic acid affected Fpg activity
at strongly inhibitory concentrations of the respective
selenium compounds. Furthermore, no inhibition was
observedwithupto1m
M
methionine.
Effect of selenium compounds on XPA-DNA binding
Next, the effects of different selenium compounds on the

activity of the XPA protein were investigated. XPA binds
specifically to damaged DNA, including lesions induced by
UVC and benzo[a]pyrene [40–42]; in the present study we
analyzed its ability t o bind to a UVC-damaged oligonucle-
otide by gel mobility shift assay. One re presentative
outcome of the experiments is shown in Fig. 4, d erived
after a 30 min preincubation of XPA with selenocystine. In
the absence of XPA, selenocystine did not affect the
migration of free oligonucleotide (data not shown). In the
absence of selenocystine, a shift in UVC-irradiated free
Fig. 2. Effects of phenylselenyl chloride, phenylseleninic acid,
2-nitrophenylselenocyanate, selenocystine and ebselen on the activity of
formamidopyrimidine-DNA glycosylase (Fpg) on methylene blue-
damaged PM2 DNA. The protein was incubated with the respective
selenium compound for 30 min at 37 °C, at t he c oncentration s indi-
cated. T he m ean values of a t least four det erminations + SD a re
shown.
Ó FEBS 2004 Selenium and zinc finger DNA repair proteins (Eur. J. Biochem. 271) 3193
oligonucleotide (lane 1, band 1) mobility was observed, thus
demonstrating specific binding of XPA (lane 2, band 2).
With increasing concentrations of selenocystine (lanes
3–10), the intensity of band 2 decreased. Nevertheless,
instead of free oligonucleotide, which would be expected in
the event of diminished XPA–DNA binding, a new band of
even slower migration appeared (band 3), indicative of high
molecular m ass DNA–protein complexes. Similarly, com-
plete inhibition of oligonucleotide migration was seen with
25 l
M
phenylseleninic acid or 75 l

M
phenylselenyl chloride,
as well as with the thiol-oxidizing compound, diamide (data
not shown), indicating that thiol oxidation, and probably
disulfide formation, may account for this effect. In contrast,
oligonucleotide–XPA binding was not affected at up to
1m
M
concentrations of fully reduced methylselenocysteine
and selenomethionine (data not shown).
Zinc release from XPAzf by selenium compounds
To investigate the inte ractions with the zinc finger structure
more directly, a peptide consisting of 37 amino acid s
(XPAzf) was applied a s a model, representing the amino
acid sequence and structure o f the zinc finger domain of
human XPA [31]. Zinc release was followed spectrophoto-
metrically by formation of the zinc–PAR c omplex, as
described in the Materials and methods. As a positive
control, the Zn(II)-complexed peptide (20 l
M
)wastreated
with 10 m
M
hydrogen p eroxide, leading to a saturation of
zinc release caused by f ully oxidized thiolates. In negative
controls (bidistilled water in the absence of selenium) no
considerable zinc release was observed (data not shown).
Concerning the selenium compounds, % 50% zinc release
(equivalent to 10 l
M

Zn
2+
) was observed with 3 l
M
2-nitrophenylselenocyanate, 6 l
M
selenocystine, 12 l
M
phe-
nylseleninic acid, 16 l
M
ebselen or 21 l
M
phenylselenyl
chloride. In contrast, methylselenocysteine and seleno-
methionine, when used at concentrations up to 1000 l
M
,
were unable to release zinc (Fig. 5).
To compare zinc release by selenium compounds with
zinc release by the cellular oxidant GSSG, a nd to
investigate the potential physiological relevance of zinc
release by selenium compounds, experiments were per-
formed by applying 3 m
M
GSSG, 1 m
M
GSH or 10 l
M
phenylseleninic acid, as well as different GSH/GSSG

ratios. A s expected, only marginal zinc r elease was
observed in the presence of 1 m
M
GSH. In contrast,
3m
M
GSSG induced % 22% zinc release, while 10 l
M
phenylseleninic acid (in the absence o f GSH and GSSG)
resulted in % 40% zinc release (data not shown), indica-
ting that reducible selenium is a stronger oxidant than
GSSG. At GSH/GSSG concentration ratios of 1 : 1 to
3 : 1, which is observed in t he end oplasmic reticulum [43],
zinc release m ediated by phenylseleninic acid was accel-
erated, f rom 40% in the absence of GSH/GSSG to 50%
or 70%, respectively. At high GSH/GSSG ratios between
40 and 100 prevailing in the overall cell, zinc release was
still evident, although to a smaller extent (Fig. 6).
Comparative studies on zinc release from MT and XPAzf
As stated in the Introduction, previous studies by Maret and
co-workers have demonstrated zinc release from MT,
induced by reducible selenium compounds, a s a potential
indication for the involvement of selenium in zinc homeo-
stasis [12–16]. Thus, in the present study, comparative
experiments were conducted to elucidate whether, in the
presence of selenium compounds, zinc is released more,
equal to or less efficiently from XPAzf than MT. As shown
in Fig. 7, all reducible selenium compounds mediated zinc
Fig. 4. Effect of selenocystine on the DNA-
binding activity of xeroderma pigmentosum

group A protein (XPA) to a UVC-irradiated
oligonucleotide. XPA was incubated with
selenocystine for 30 min at 37 °Candits
binding activity was analysed by gel mobility
shift assay, as described in the Materials and
methods. One representative experiment is
shown.
Fig. 3. Effects of selenomethionine, selenocystine and phenylseleninic
acid and the sulfur analogous methionine, cystine and phenylsulfinic acid
on formamidopyrimidine-DNA glycosylase (Fpg) activity. Fpg was
incubated with the respective compound for 3 0 min at 37 °C, at the
concentrations indicated. The mean values of at least four determi-
nations + SD are shown.
3194 H. Blessing et al. (Eur. J. Biochem. 271) Ó FEBS 2004
release also from MT, while fully reduced selenomethionine
and methylselenocysteine were inactive, as seen previously
with XPAzf. As MT contains 20 zinc-binding cysteines as
compared to four cysteine s in XPAzf, for better compar-
ison, zinc release was plotted against the ratio of selenium
compound/cysteine. In the case of selenocystine and
2-nitrophenylselenocyanate, zinc was released with an even
higher efficiency from XPAzf than from MT (Fig. 8); with
respect to ebselen, phenylseleninic acid and phenylselenyl
chloride, zinc release occurred at similar concentrations
from both molecules (Fig. 9).
Discussion
The cancer-preventive activities of selenium compounds
have long been discussed, such as the effects of different
dietary levels as a result of geographical variation, the
potential benefits of d ietary supplements, a nd the c linical

applications as chemopreventive agents [2–4,6,9]. Further-
more, selenium deficiency has been linked to increased viral
pathogenicity in humans (Keshan disease) and in animal
experiments [44]. One obvious function of selenium relates
to its role as an antioxidant as a constituent part of
glutathione peroxidases in the detoxification of peroxides,
which leads to a reduction in the level of reactive oxygen
species in cells and tissues. I n addition, in recent y ears,
Fig. 5. Release of zinc from XPAzf by phenylselenyl chloride, phenyl-
seleninic acid, 2-nitrophenylselenocyanate, se lenocystine, ebselen, sele-
nomethionine and methylselenocysteine. The XPAzf peptide was
incubated with the respective selenium compound for 30 min at 37 °C.
Zinc release was measured spectrophotometrically after the addition of
100 l
M
4-(2-pyridylazo)-resorcinol (PAR). The mean values of at least
six determinations + SD are shown.
Fig. 6. Release of zinc from XPAzf by various ratios of reduced gluta-
thione (GSH)/oxidized glutathione (GSSG), in the presence (s)or
absence (h)of10l
M
phenylseleninic acid. GSSG was applied from
10 l
M
to 3 m
M
, while GSH was maintained at 1 m
M
. The peptide was
incubated with the respective compoun ds for 30 min at 37 °C. Zinc

release was measured spe ctrophotom etrically by the addition of
100 l
M
4-(2-pyridylazo)-resorcinol (PAR). About 40% zin c release
was observed with 10 l
M
phenylseleninic acid in the absence of GSH
and GSSG (data not shown). The mean values of at least nine deter-
minations + SD are shown.
Fig. 7. Release of zinc from metallothionein (MT) by phenylselenyl
chloride, phenylseleninic acid, 2-nitrophenylselenocyanate, selenocystine,
ebselen, selenomethionine and methylselenocysteine. MT was incubated
with the respective selenium compound for 30 min at 37 °C. Zinc
release was measured spe ctrophotometrically by the addition of
100 l
M
4-(2-pyridylazo)-resorcinol (PAR). The mean values of at least
six determinations + SD are shown.
Fig. 8. Release of zinc from metallothionein (MT) or XPAzf by
2-nitrophenylselenocyanate and selenocystine. The data are derived
from the experiments shown in Figs 5 and 7, but plotted against the
number of cyst eines p resent in XPAzf and MT. The mean values of at
least six determinations + SD are shown.
Ó FEBS 2004 Selenium and zinc finger DNA repair proteins (Eur. J. Biochem. 271) 3195
greater emphasis has been given to specific cellular reac-
tions, based on selenium catalysis. This concerns reversible
cysteine/disulfide transformations in redox-regulated pro-
teins, such as transcription factors [24], and MT, as a zinc
storage protein [11,14]. Nevertheless, there is increasing
evidence that zinc finger structures are among the most

common protein motifs, present not just in transcription
factors, but in basically all families of proteins involved in
maintaining genomic stability, including DNA repair pro-
teins and cell cycle control proteins [18]. This prompted us
to investigate the effect of selenium compounds in different
oxidation states o n the integrity and function of two z inc
finger proteins (Fpg and XPA) with tetrahedral zinc ion
complexation to four cysteines involved in DNA repair,
as compared to zinc release from MT. Our experiments
demonstrate, for the first time, that reducible selenium
compounds (i.e. with an oxidation state of –I or higher)
including selenocystine, phenylselenyl chloride, ebselen,
2-nitrophenylselenocyanate and phenylseleninic acid, are
able to react with the thiolates o f these zinc finger
DNA-repair proteins, resulting in enzyme inactivation and
release of zinc.
The bacterial Fpg was used as the first model. Fpg i s a
glycosylase that initiates base excision repair in Escheri-
chia coli , which recognizes and removes several oxidative
DNA base modification s. Fpg has the high est affinity for
8-oxoguanine, w hich, owing to its mutagenic potential, is
believed to be the biologically most relevant substrate
[37,38]. DNA binding of Fpg is mediated by a single zinc
finger domain in the C-terminal region of the enzyme, where
zinc is complexed tetrahedrally by fo ur cysteines (Cys244,
Cys247, Cys264 and Cys267) [45,46]. Within the present
study we demonstrated that all reducible selenium com-
pounds inhibited Fpg activity completely, albeit at different
concentrations. As fully reduced methylselenocysteine and
selenomethionine were not inhibitory, the observed enzyme

inactivation is probably caused by the oxidation of zinc-
complexing thiol groups in the enzyme and a simultaneous
reduction of the selenium compound. This interpretation is
in agreement with the mutational analysis of Fpg, which
revealed that substitution of any of the cysteines in the zinc
finger destroys DNA-binding capacity and enzyme func-
tion, while substitution of the other two cy steines outside the
zinc finger has little effect [25]. The participation of selenium
is further demonstrated by the lack of inhibition by the
sulfur-containing analogues cystine and phen ylsulfinic acid.
Similarly, selenocystamine reacted with the zinc/sulfur
clusters of MT at much lower concentrations than cysta-
mine [12,47]. Although sulfur shares similar chemical
properties with selenium [48], one difference is the redox
chemistry, which allows selenium to act a t much lower
physiological concentrations than sulfur.
The effects of different selenium compounds on the
mammalian X PA protein were i nvestigated in the second
model. In vivo, XPA is absolutely required for incision
during NER by co-ordinating the binding of ERCC1–
XPF and presumably activating XPG [49]. In vitro,it
binds specifically to bulky DNA lesions, such as (6–4)-
photoproducts induced by UVC [40]. Even though its
zinc finger motif is not directly involved in DNA binding,
it is required for the correct folding of the minimal DNA-
binding domain [50]; substitution of any of its zinc-
complexing cysteines (Cys105, Cys108, Cys126 and
Cys129) leads to diminished DNA binding and a severe
reduction in NER activity [26]. In the present study, all
reducible selenium compounds investigated in this set of

experiments (selenocystine, phenylselenyl chloride, phenyl-
seleninic acid) led to profound changes in the gel m obility
shift experiments performed to investigate XPA–DNA
interactions. If DNA–protein interactions would have
been disturbed, one would expect the appearance of free
oligonucleotide with increasing concentrations of redu-
cible selenium compounds. Surprisingly, this was not the
case; however, a third band appeared with almost no
migration in t he gel, indicative of high molecular mass
DNA–protein complexes. As selenium compounds exert
higher reactivity towards free cysteines as compared to
zinc-bound thiolates [16], intermolecular disulfide bridges
may be formed betw een two or more XPA molecules
which still retain their DNA-binding activity. It cannot be
excluded that selenium compounds also react with the
zinc finger thiol groups, but, o wing to the completely
retarded migration o f the complexes, this cannot be
discriminated by gel mobility shift analysis.
To elucidate interactions with the zinc finger domain of
XPA more directly, the effects of selenium compounds on a
synthetic 37 amino acid peptide, representing the zinc finger
domain o f the human XPA protein (XPAzf), were inves-
tigated by determining zinc release. Similarly to the results
obtained with Fpg, all reducible selenium compounds
caused zinc release i n a concentration-dependent manner,
starting at the low micromolar range, while fully reduced
selenomethionine and methylselenocysteine were inactive.
For comparison, a 10 m
M
H

2
O
2
solution was required to
mediate complete zinc release.
The experiments demonstrate that in principle any
reducible selenium compound should be able to release zinc
from zinc finger structures. Nevertheless, there w ere c lear
differences with respect to the reactivities of different
Fig. 9. Release of zinc from metallothionein (MT) or XPAzf (a synthetic
polypeptide corresponding to the xeroderma pigmentosum group A
protein zinc finger domain) by various concentrations of phenylselenyl
chloride, phenylseleninic acid and ebselen. The data are derived from the
experiments shown in Figs 5 and 7, but plotted against the number of
cysteines present in XPAzf and MT. The mean values of at least six
determinat ions + SD are shown.
3196 H. Blessing et al. (Eur. J. Biochem. 271) Ó FEBS 2004
selenium compounds. In the experiments with Fpg, inhi-
bitory concentrations were not related to the re spective
oxidation state. Thus, for selenium compounds of the
oxidation state 0, the strongest inhibition was observed with
ebselen, where full inhibition was evident at 100 n
M
, while
2-nitrophenylselenocyanate and phenylselenyl chloride exer-
ted similar inhibition at 2.5 and 10 l
M
, respectively. Full
inhibition was obtained w ith 100 l
M

selenocystine (oxida-
tion state –I) or 100 l
M
phenylseleninic acid (oxidation state
+II). In experiments with XPAzf, the strongest effect was
observed with 2-nitrophenylselenocyanate, while compar-
able reactivities were found for the other selenium com-
pounds in different oxidation states. As the results were
somehow more uniform in the isolated zinc finger peptide,
XPAzf, one reason for the differences observed with Fpg
may be the h igher order p rotein structure s and differences in
accessibility in the intact protein, one major determinant for
the sensitivity of zinc finger thiolates towards oxidation [20].
Nevertheless, zinc release i s not merely a stoichiometric
process, but also exerts a catalytic component owing to the
oxidation of selenolates, for example by trace amounts of
oxygen. This catalytic component has been shown to occur
in 2-nitrophenylselenocyanate with respect to zinc release
from MT [14] and may differ depending on the actual
selenium compound.
In cells there is an excess of free SH groups, predomin-
antly provided by GSH, raising the question of whether
under conditions of high concentrations of GSH and/or
GSSG, the cysteines in zinc fi nger structures remain as
targets for oxidation by selenium compounds. As shown in
the present study, zinc release is even accelerated in the
presence of GSSG and at GSH/GSSG ratios between 0.3
and 3, and is only partly prevented even at a 100-fold excess
of GSH over both phenylseleninic acid and GSSG. This
indicates that reducible selenium compounds are able to

attack zinc-sulfur bonds also under cellular conditions,
where GSH/GSSG ratios between 1 and 3 for the
endoplasmatic reticulum and between 40 and 100 for the
overall cell have been reported [43]. Similarly, Maret and co-
workers observed zinc rele ase from zinc-sulfur c lusters in
MT, catalyzed by reducible selenium compounds, at a high
excess of GSH over MT [13]. O ne possible explanation
relates to the formation of mixed selenodisulfides between
selenium compounds and GSH, which are s till sufficiently
reactive towards zinc finger thiols. Furthermore, in the
presence of GSSG, redox cycling could take place by
oxidation of reduced selenium species, which would explain
the enhanced zinc release in the presence of GSSG observed
in our experiments. In this context, reducible selenium
coumpounds have been shown t o efficiently c ouple the
GSH/GSSG redox pair with the MT/thionein system [15]
and a similar mechanism would be plausible in the case of
zinc finger proteins. Under cellular co nditions, redox
changes of selenium are part of the essential reactions, for
example within t he catalytic cycle of glutathione peroxidases
[51,52]. In an isolated test system, recent investigations
demonstrated that glutathione peroxidase mimics in the
presence of hydrogen peroxide are able to oxidize the zinc
finger peptide fragment of transcription factor, SP1 [22].
With respect to oxid ized selenium species, Youn et al.
reported a concentration-dependent decreased binding of
zinc finger transcription factors Sp1 and Sp3 to their
consensus recognition sequence when cells were treated with
either 1,4-phenylenebis(methylene)selenocyanate (p-XSC)
or selenite, even though the authors did not investigate

whether the zinc finger was affected directly [23].
As stated in the I ntroduction, one mechanism suggested
to contribute to t he cancer-preventive p roperties of selenium
compounds is the involvement in cellular zinc homeostasis
by mediating zinc release from MT, thus providing i t for
essential reactions. However, significant p rotection would
require preferential reaction with MT, compared with zinc
finger proteins, to minimize toxic reactions. Our experiments
confirm zinc release by reducible selenium compoun ds
described previously by Maret and co-workers [12–15], but
revealed additionally that the zinc finger domain of XPA is
at least as susceptible towards thiol oxidation by reducible
selenium compounds as MT. During incubation with
selenocystine and 2-nitrophenylselenocyanate, zinc was
released at even lower concentrations from XPAzf compared
with MT. The reason for this is unclear at the moment;
potential contributing factors are b etter asse ssibility of the
peptide vs. MT combined with more pronounced catalytic
reaction components, as discussed above. Whether or not
zinc finger DNA repair proteins are affected under cellular
conditions has yet to be elucidated. In the cytosol of c ells,
MT is present in excess over DNA repair proteins; however,
owing to the coupling of zinc-binding structures (either in
MT or in zinc finger proteins) by selenium compounds with
the cellular r edox system GSH/GSSG, reducible selenium
may be regenerated within catalytic cycles and thu s is not
necessarily inactivated by an e xcess of M T.
Taken together, the results presented in this study
demonstrate that low concentrations of selenium com-
pounds in reducible oxidation states may inactivate DNA

repair processes by t he oxidation of zinc finger structures in
DNA repair proteins. As these observations are derived
from subcellular systems, experiments on interactions with
DNA repair systems in intact cells are urgently needed. The
hypothesis o n DNA repair inhibition seems to contradict
observations published recently, where selenomethionine
even stimulated DNA repair after UV irradiation of human
fibroblasts [53]. Nevertheless, selenomethionine is fully
reduced (oxidation state –II) and was found not to interfere
with zinc finger proteins in the present study. In principle,
our results are in agreement with the growing experimental
evidence that the r ole of selenium c ompounds in biological
systems is not merely antioxidative (by detoxification of
reactive oxygen species as part of glutathione peroxidases),
but rather complex, owing to multiple interactions with
cellular thiol groups. Importantly, it was shown t hat not
only free SH groups are targets of reducible selenium
compounds, but also zinc-complexed thiol groups, which
are commonly thought to be more resistant towards redox
reactions [54, 55]. While interactions with isolated DNA
repair proteins are demonstrated for the first time, recent
studies by other groups also showed inhibition of transcrip-
tion factor–DNA binding by reducible selenium com-
pounds [21, 23]. In fact, these interactions with either
transcription factors or MT have repeatedly been discussed
to contribute to the protective prope rties of selenium
compounds with respect to t umor prevention or tumor
therapy. However, as shown i n the present study, these
reactions may also have detrimen tal consequences: because
Ó FEBS 2004 Selenium and zinc finger DNA repair proteins (Eur. J. Biochem. 271) 3197

zinc finger proteins are involved in b asically all cellular
reactions required to maintain genomic stability, their
inactivation may lead to increased genetic instability. Thus,
functioning DNA repair processes are urgently required to
protect the genome not only from DNA damage induced by
environmental agents such as UV radiation, food mutagens
and polycyclic aromatic hydrocarbons, but also from
endogenous DNA damage generated continuously, for
example by reactive oxygen species arising in the course of
oxygen consumption. As redox reactions are important for
the regulation of zinc finger proteins and thus the cellular
pathways that are dependent on these proteins, an imbal-
ance in selenium compounds as powerful mediators of
cellular redox reactions, provoked by either selenium
deficiency or oversupply, may considerably decrease
genomic stability.
Acknowledgements
The Fpg protein was a kind gift of Dr Serge Boiteux, Commisariat
Energie Atomique, Fontanay aux Roses, France and XPA was kindly
provided by Dr Andre
´
Eker, Erasmus University of Rotterdam, the
Netherlands. This work was supported by grants Ha 2372/1-3 and Ha
2372/3-2 from the Deutsche Forschungsgemeinschaft, and by a grant
from the Alexander von Hum boldt Foundation (a maintenance grant
to W.B.).
References
1. Ko
¨
hrle, J., Brigelius-Flohe

´
,R.,Bock,A.,Gartner,R.,Meyer,O.
&Flohe
´
, L . (2000) Selenium in biolo gy: facts and medical p er-
spectives. Biol. Chem. 381, 849–864.
2. Ganther, H.E. (1999) Selenium metabolism, selenoproteins and
mechanisms of cancer prevention: complexities with thioredoxin
reductase. Carcinogenesis 20, 1657–1666.
3. El-Bayoumy, K. (2001) The protective role of selenium on genetic
damage and on cancer. Mutat. Res. 475, 123–139.
4. Vinceti, M., Rovesti, S., Bergomi, M. & Vivoli, G. (2000) The
epidemiology of selenium and human cancer. Tumori 86, 105–118.
5. Thomson, C.D. (2004) Assessment of requirements for selenium
and adequacy of selenium status: a review. Eur. J. Clin. Nutr. 58,
391–402.
6. Clark, L.C., Combs, G.F. Jr, Turnbull, B.W., Slate, E.H., Chal-
ker, D.K., Chow, J., Davis, L.S., Glover, R.A., Graham, G.F.,
Gross,E.G.,Krongrad,A.,Lesher,J.L.Jr,Park,H.K.,Sanders,
B.B. Jr, Smith, C.L. & Taylor, J.R. (1996) Effects of selenium
supplementation f or ca ncer p reven tion in patients with carcinoma
of the skin. A randomized con trolled trial. Nutritional Preve ntion
of Cancer Study Group. JAMA 276, 1957–1963.
7. Duffield-Lillico, A.J., Slat e, E.H., Reid, M.E., Turnbull, B.W.,
Wilkins,P.A.,Combs,G.F.Jr,Park,H.K.,Gross,E.G.,Graham,
G.F.,Stratton,M.S.,Marshall,J.R.&Clark,L.C.(2003)Sele-
nium supplementation and secondary preven tion of non-
melanoma skin cancer in a randomized trial. J. Natl Cancer Inst.
95, 1477–1481.
8. Flohe

´
, L., Gunzler, W.A. & Schock, H.H. (1973) Glutathione
peroxida se: a selenoenzyme. FEBS Lett. 32, 132–134.
9. Brigelius-Flohe
´
, R., Maiorino, M., Ursini, F. & Flohe, L. (2001)
Selenium: An antioxidant? In Handbook of Antioxidants,2ndedn.
(Cadenas, E. & Packer, L., eds), pp. 633–664. Marcel Dekker, Inc.,
New York, Basel.
10. Turan, B., Fliss, H. & Desilets, M. (1997) Oxidants increase the
intracellular free Zn
2+
concentratio n in rabbit v entricula r myo-
cytes. Am.J.Physiol.272, 2095–2106.
11. Jacob, C., Giles, G.I., Giles, N.M. & Sies, H. (2003) Sulfur and
selenium: the role of oxidation state in protein structure and
function. Angew Chem. Int. Ed. Engl. 42, 4742–4758.
12. Jacob,C.,Maret,W.&Vallee,B.L.(1998)Controlofzinctransfer
between thionein, metalloth ionein, and zin c proteins. Proc. Natl
Acad. Sci. USA 95, 3489–3494.
13. Jacob,C.,Maret,W.&Vallee,B.L.(1999)Seleniumredoxbio-
chemistry of zinc-sulfur coordination sites in proteins and
enzymes. Proc. Natl Acad. Sci. USA 96, 1910–1914.
14. Chen, Y. & Maret, W. (2001) Catalytic oxidation of zinc/sulfur
coordination sites in proteins by selenium compounds. Antioxid.
Redox Signal. 3, 651–656.
15. Chen, Y. & Maret, W. (2001) Catalytic selenols couple the redox
cycles of metallothionein and glutathione. Eur. J. Biochem. 268,
3346–3353.
16. Jacob,C.,Maret,W.&Vallee,B.L.(1998)Ebselen,aselenium-

containing redox dru g, release s zinc from metallothionein. Bio-
chem. Biophys. Res. Commun. 248, 569–573.
17. Mackay, J.P. & Crossley, M. (1998) Zinc fingers are sticking
together. Trends Biochem. Sci. 23,1–4.
18. Laity, J.H., Lee, B.M. & Wright, P.E. (2001) Zinc finger proteins:
new insigh ts into structural and functional diversity. Curr. Opin.
Struct. Biol. 11, 39–46.
19. Maret, W. (2003) Cellular zinc and redox states converge in the
metallothionein/thionein pair. J. Nutr. 133, 1460S–1462S.
20. Wilcox, D.E., Schenk, A.D., Feldman, B.M. & Xu, Y. (2001)
Oxidation of zinc-binding cysteine residues in transcription factor
proteins. Antioxid. Redox Signal. 3, 549–564.
21. Larabee, J.L., Hocker, J.R., Hanas, R.J., Kahn, F.M. & Hanas,
J.S. (2002) Inhibition of zinc finger protein–DNA interactions by
sodium selenite. Biochem. Pharmacol. 64, 1757–1765.
22. Giles, N.M., Gutowski, N.J., Giles, G.I. & Jacob, C. (2003) Redox
catalysts as sensitisers towards oxidative stress. FE BS Lett. 535,
179–182.
23. Youn, B.W., Fiala, E.S. & Sohn, O.S. (2001) Mechanisms of
organoselenium compounds in chemoprevention: effects on tran-
scription factor-DNA binding. Nutr. Cancer 40, 28–33.
24. Kim, Y.S. & Milner, J. (2001) Molecular targets for selenium in
cancer prevention. Nutr. Cancer 40, 50–54.
25. O’Connor, T.R., Graves, R.J., d e Murcia, G., Castaing, B. &
Laval, J. (1993) Fpg protein of Escherichia coli is a zinc finger
protein whose cysteine residu es have a structural and/or functional
role. J. Biol. Chem. 268, 9063–9070.
26. Miyamoto, I., Miura, N., Niwa, H., Miyazaki, J. & Tanaka, K.
(1992) Mutational analysis of the structure and function of the
xeroderma pigmentosum group A complementing protein. Iden-

tification of essential domains for nuclear localization and DNA
excision repair. J. Biol. Chem. 267, 12182–12187.
27. Cai, X J., Block, E., Uden, P.C., Zhang, X., Quimby, B.D. &
Sullivan, J.J. (1995) Allium c hemistry: i dentification of seleno-
amino acids in ordinary and selenium-enriched garlic, onion, and
broccoli using gas ch romatograph y with atomic emission detec-
tion. J. Agric. Food Chem. 43, 1754–1757.
28. Bird, S., Uden, P.C., Tyson, J.F.,Block,E.&Denoyer,E.(1997)
Speciation of selenoamino acids and organoselen ium compounds
in selenium-enriched yeast using high-performance liquid chro-
matography-inductively coupled plasma mass spectrometry.
J. Anal. Atomic Spectrom. 12, 785–788.
29. Asmuss, M., Mullenders, L.H., Eker, A. & Hartwig, A. (2000)
Differential effects of toxic metal compou nds on the activities of
Fpg and XPA, two zinc finger proteins involved in DNA repair.
Carcinogenesis 21, 2097–2104.
30. Mu
¨
ller, E., Boiteux, S., Cunningham, R.P. & Epe, B. (1990)
Enzymatic recognition o f DNA m odifications induced by singlet
oxygen and photosensitizers. Nucleic Acids Res. 18, 5969–5973.
3198 H. Blessing et al. (Eur. J. Biochem. 271) Ó FEBS 2004
31. Bal, W., Schwerdtle, T. & Hartwig, A. (2003) Mechanism of nickel
assault on the zinc finger of DNA repair protein XPA. Chem. Res.
Toxicol. 16, 242–248.
32. Grassetti, D.R. & Murray, J.F. Jr (1967) Determination of sulf-
hydryl groups with 2,2¢-or4,4¢-dit hi odip y rid ine. Arch. Biochem.
Biophys. 119, 41–49.
33. Vasak, M. (1991) Criteria of purity for metallothioneins. Methods
Enzymol. 205, 44–47.

34. Schaeffer, A. ( 1991) Abso rption, c ircular dic hroism, a nd magnet ic
circular dichroism spectroscopy of metallothionein. Methods
Enzymol. 205, 529–540.
35. Hunt, J.B., Neece, S.H., Schachman, H.K. & Ginsburg, A. (1984)
Mercurial-promoted Zn
2+
release from Escherichia coli aspartate
transcarbamo ylase. J. Biol. Chem. 259, 14793–14803.
36. McCall, K.A. & Fierke, C.A. (2000) Colorimetric and fluorimetric
assays to quantitate micromolar concentrations of tran sition
metals. Anal. Biochem. 284, 307–315.
37.Tchou,J.,Kasai,H.,Shibutani,S.,Chung,M.H.,Laval,J.,
Grollman, A.P. & Nishimura, S. (1991) 8-oxoguanine (8-hydro-
xyguanine) DNA glycosylase and its substrate specificity. Proc.
NatlAcad.Sci.USA88, 4690–4694.
38. Boiteux, S., Gajewski, E., Laval, J. & Dizdaroglu, M. (1992)
Substrate specificity of the Escherichia coli Fpg protein (for-
mamidopyrimidine-DNA gl ycosylase): exc ision of purine le sions
in D NA produced by ionizing r adiation or photosensitization.
Biochemistry 31, 106–110.
39. Floyd, R.A., West, M.S., Ene ff, K.L. & Schneider, J.E. (1990)
Mediation of 8-hydroxy-guanine formation in DNA by thiazin
dyes plus light. Free Radic. Biol. Med. 8, 327–330.
40. Robins, P., Jones, C.J., Biggerstaff, M., Lindahl, T. & Wo od, R.D.
(1991) Complementation of DNA repair in xeroderma p igmen-
tosum grou p A cell extracts by a pro tein with affinity for damaged
DNA. EMBO J. 10, 3913–3921.
41. Jones, C.J. & Wood, R.D. (1993) Preferential binding of the
xeroderma pigmentosum grou p A co mplementing protein to
damaged DNA. Biochemistry 32, 12096–12104.

42. Asahina, H., K uraoka, I ., Shira kawa, M., Morita, E.H., M iura, N.,
Miyamoto,I.,Ohtsuka,E.,Okada,Y.&Tanaka,K.(1994)The
XPA protein is a zinc metalloprotein with an ability to recognize
various kinds of DNA damage. Mutat. Res. 315, 229–237.
43. Hwang, C., Sinskey, A.J. & Lodish, H.F. (1992) Oxidized redox
state of glutathione in the endoplasmic reticulum. Science 257,
1496–1502.
44. Beck, M.A. (2001) Antioxidants an d viral infections: host i mmune
response and viral pathogenicity. J. Am. Coll. Nutr. 20, 384S–
388S.
45. Buchko,G.W.,Hess,N.J.,Bandaru,V.,Wallace,S.S.&Kennedy,
M.A. (2000) Spectroscopic studies of zi nc (II)- and cobalt
(II)-associated Escherichia c oli formamidopyrimidine-DNA gly-
cosylase: extended X-ray absorption fine structure evidence for a
metal-bi ndin g domain. Bioche mistr y 39, 12441–12449.
46. Zharkov, D.O., Shoham, G. & Grollman, A.P. (2003) Structural
characterization of th e Fpg f amily of DNA glycosylases. DNA
Repair (Amst). 2, 839–862.
47. Maret, W. (1995) Metallothionein/disulfide interactions, oxidative
stress, and the mobilization of c ellular zinc. Neurochem. Int. 27,
111–117.
48. Barceloux, D.G. (1999) Selenium. J. Toxicol. Clin. Toxicol. 37,
145–172.
49. Volker, M., Mone, M.J., Karmakar, P., van Hoffen, A.,
Schul, W., Vermeulen, W., Hoeijmakers, J.H., van Driel, R., van
Zeeland, A.A. & Mullenders, L .H. (2001) Se quential assembly
of the nucleotide excision repair factors in vivo. Mol. Cell. 8,213–
224.
50.Buchko,G.W.,Ni,S.,Thrall, B.D. & Kennedy, M.A. (1998)
Structural features of the minimal DNA binding domain (M98–

F219) of human nucleotide excision repair protein XPA. Nucleic
Acids Res. 26, 2779–2788.
51. Wendel, A., Pilz, W., Ladenstein, R., Sawatzki, G. & Weser, U.
(1975) Substrate-induced redox change of selenium in glutathione
peroxidase studied by x-ray photoelectron spectroscopy. Bioc him.
Biophys. Acta 377, 211–215.
52. Aumann, K.D., Bedorf, N., Brigelius-Flohe
´
, R., Schomburg, D. &
Flohe
´
, L. (1997) Glutathione peroxidase revisited – simulation of
the catalytic cycle by c omputer-assisted molecular modelling.
Biomed. Environ. Sci. 10, 136–155.
53. Seo, Y.R., Kelley, M.R. & Smith, M.L. (2002) Selenomethionine
regulation of p53 by a ref1-dependent redox mechanism. Proc.
NatlAcad.Sci.USA99, 14548–14553.
54. Bettger, W.J. (1993) Zinc and selenium, site-specific versus general
antioxidation. Can. J. Physiol. Pharmacol. 71, 721–724.
55. Knoepfel, L., Steinkuhler, C., Carri, M.T. & Rotilio, G. (1994)
Role of zinc-coordination and of the g lutathione redox couple
in the redox susceptibility of human transcription factor Sp1.
Biochem. Biophys. Res. Commun. 201, 871–877.
56. Robbins, A.H., McRee, D.E., Williamson, M., Collett, S.A.,
Xuong, N.H., Furey, W .F., Wang, B.C. & Sto ut, C.D. (1991)
Refined crystal structure of Cd, Zn metallothionein at 2.0 A
resolution. J. Mol. Biol. 221, 1269–1293.
57. Romero-Isart, N. & Vasak, M. (2002) Advances in the struc-
ture and c hemistry of metallothioneins. J. Inorg. Biochem. 88 ,388–
396.

58. Ikegami, T., Kuraoka, I., Saijo, M., Kodo, N., Kyogoku, Y.,
Morikawa, K., Tanaka, K. & Shirak awa, M. (1998) S olution
structure of the DNA- and R PA-binding dom ain of the hum an
repair factor XPA. Nat. Struct. Biol. 5, 701–706.
Ó FEBS 2004 Selenium and zinc finger DNA repair proteins (Eur. J. Biochem. 271) 3199