Tài liệu Báo cáo khoa học: Biosynthesis of riboflavin Screening for an improved GTP cyclohydrolase II mutant pdf

Biosynthesis of riboflavin
Screening for an improved GTP cyclohydrolase II mutant
Martin Lehmann
1
, Simone Degen
1
, Hans-Peter Hohmann
1
, Markus Wyss
1
, Adelbert Bacher
2
and
Nicholas Schramek
2
1 DSM Nutritional Products Ltd., Basel, Switzerland
2 Lehrstuhl fu
¨
r Biochemie, Technische Universita
¨
tMu
¨
nchen, Lichtenbergstr, Garching, Germany
Introduction
More than 3000 metric tons of vitamin B
2
(riboflavin;
6) are produced per year for use in human nutrition,
animal husbandry and as a food colorant. In recent
years, efficient fermentation processes have replaced
chemical synthesis for manufacturing the vitamin [1,2].

The biosynthetic pathway of riboflavin has been
studied in considerable detail [3–6]. Briefly, GTP is
converted into 2,5-diamino-6-ribosylamino-4(3H)-pyri-
midinone 5¢-phosphate (2) by the catalytic action of
GTP cyclohydrolase II (Fig. 1) [7]. The product is
transformed into 5-amino-6-ribitylamino-2,4(1H,3H)-
pyrimidinedione (3) by a sequence of side-chain reduc-
tion, deamination and dephosphorylation. Condensa-
tion of 3 with 3,4-dihydroxy-2-butanone 4-phosphate
(4) results in the production of 6,7-dimethyl-8-ribityl-
lumazine (5) [8,9]. An unusual dismutation catalyzed
by riboflavin synthase converts the lumazine derivative
into an equimolar mixture of riboflavin (6) and the
pyrimidine 3 which is re-utilized by the lumazine
synthase [10–13]. With the exception of the elusive
phosphatase, all enzymes of the pathway have been
studied at least in some detail.
The enzymes of the riboflavin pathway are generally
characterized by low catalytic rates. This is not surprising
Keywords
biotechnology; directed evolution; GTP
cyclohydrolase; riboflavin biosynthesis;
vitamin B
2
production
Correspondence
N. Schramek, Lehrstuhl fu
¨
r Biochemie,
Technische Universita

¨
tMu
¨
nchen,
Lichtenbergstr. 4, D-85747 Garching,
Germany
Tel: +49 089 289 13336
Fax: +49 089 289 13363
E-Mail:
(Received 16 March 2009, Revised 24 May
2009, accepted 28 May 2009)
doi:10.1111/j.1742-4658.2009.07118.x
GTP cyclohydrolase II catalyzes the first dedicated step in the biosynthesis
of riboflavin and appears to be a limiting factor for the production of the
vitamin by recombinant Bacillus subtilis overproducer strains. Using error-
prone PCR amplification, we generated a library of the B. subtilis ribA
gene selectively mutated in the GTP cyclohydrolase II domain. The ratio of
the GTP cyclohydrolase II to 3,4-dihydroxy-2-butanone synthase activities
of the mutant proteins was measured. A mutant designated Construct E,
carrying seven point mutations, showed a two-fold increase in GTP cyclo-
hydrolase II activity and a four-fold increase in the K
m
value with GTP as
the substrate. Using the analog 2-amino-5-formylamino-6-ribosylamino-
4(3H)-pyrimidinone 5¢-triphosphate as the substrate, the mutant showed a
rate enhancement by a factor of about two and an increase in the K
m
value
by a factor of about 5. A series of UV absorption spectra obtained in
stopped-flow experiments using the wild-type and mutant enzymes revealed

isosbestic points indicative of apparently perfect reactions, which were simi-
lar to the findings obtained with GTP cyclohydrolase II of Escherichia coli.
Initial burst velocities obtained for the mutant and wild-type proteins were
similar. The data suggest that the mutations present in Construct E are
jointly conducive to the acceleration of a late step in the reaction trajec-
tory, most probably the release of product from the enzyme.
Abbreviation
DHB, 3,4-dihydroxy-2-butanone.
FEBS Journal 276 (2009) 4119–4129 ª 2009 The Authors Journal compilation ª 2009 FEBS 4119
in light of the small amounts of the trace metabolite
that are required for metabolism and growth. These
low rates constitute a problem for the further improve-
ment of riboflavin fermentation processes.
Studies on a riboflavin producer strain of Bacil-
lus subtilis showed a significant increase in productivity
following the insertion of an additional gene copy of
ribA, suggesting that this enzyme constitutes a bottle-
neck in the pathway [14].
The complex reaction mechanism of GTP cyclohy-
drolase II has been studied using spectroscopic and
kinetic methods. Notably, the enzyme catalyzes the
release of C-8 from the imidazole moiety of GTP as
formate and also the release of inorganic diphosphate
from the ribose side-chain (Fig. 2). As a side reaction,
a fraction of the substrate, GTP, is converted into
GMP (11) by release of pyrophosphate without con-
comitant ring opening. Kinetic studies suggested that
the first reaction step of the enzyme-catalyzed trajec-
tory is the covalent guanylation of the enzyme under
release of pyrophosphate [12]. Carbon 8 of the purine

system of intermediate 8 is then hydrolytically released,
and the reaction is terminated by hydrolysis of the
phosphodiester bond between the covalently bound
intermediate 9 and the protein.
This article describes studies directed at an increase
in the overall reaction rate of GTP cyclohydrolase II.
Results
Whereas most enzymes of the riboflavin biosynthetic
pathway have low catalytic rates, the activity of GTP
cyclohydrolase II appears to be rate limiting for the
overall productivity of a recombinant B. subtilis strain
[14]. Both initial steps of the convergent riboflavin bio-
synthetic pathway are catalyzed in B. subtilis by the
bifunctional RibA protein comprising a GTP cyclohy-
drolase II and a 3,4-dihydroxy-2-butanone 4-phosphate
domain on the same subunit. In order to increase selec-
tively the GTP cyclohydrolase II activity, the gene seg-
ment specifying the cognate protein domain was
subjected to in vitro mutagenesis by error-prone PCR
(on average, two to five mutations per gene), and the
resulting amplificates were ligated to the gene segment
specifying the 3,4-dihydroxy-2-butanone 4-phosphate
domain (that had not been subjected to mutagenesis).
The resulting, mutated genes were ligated into the
expression plasmid pQE60 and transformed into an
Escherichia coli strain carrying a ribA
)
mutation
(Fig. 3). Growth occurred only if the mutated ribA
A

B
C
D
E
Fig. 1. Pathway of riboflavin biosynthesis.
(A) GTP cyclohydrolase II. (B) Sequence of
deaminase, reductase and phosphatase.
(C) 3,4-Dihydroxy-2-butanone 4-phosphate
synthase. (D) 6,7-Dimethyl-8-ribityllumazin
synthase. (E) Riboflavin synthase.
Biosynthesis of riboflavin – generation of an improved cyclohydrolase II M. Lehmann et al.
4120 FEBS Journal 276 (2009) 4119–4129 ª 2009 The Authors Journal compilation ª 2009 FEBS
gene specified a recombinant protein that retained sig-
nificant GTP cyclohydrolase II activity. The library of
recombinant E. coli strains afforded a library of mutant
proteins that was assayed for GTP cyclohydrolase II
and 3,4-dihydroxy-2-butanone 4-phosphate synthase
activities. Mutant proteins with a relative increase in
GTP cyclohydrolase II activity (compared with the 3,4-
dihydroxy-2-butanone 4-phosphate synthase activity)
were purified; purification was facilitated by the pres-
ence of a polyhistidine tag at the N-terminus.
A total of 3300 recombinant E. coli strains were
screened and provided nine candidate strains with
apparent enhancements in GTP cyclohydrolase II activ-
ity; the largest enhancements observed were in the
range of 1.5-fold. Combination of the gene mutations
of the most improved mutant genes A#1 G2 (T203S,
A290T, A296T) and A#4 C9 (K195T, V264A, V275A,
K397E) did not result in a further improved mutant.

Numbering of the amino acid residues included the 14
amino acids of the His-tag. The original start methio-
nine of RibA became amino acid residue 15. The
neutral mutation, T203S, of A#1 G2, was removed,
and mutation Y210C, which was found in another
mutant of the library, was introduced in return. By
SDS gel chromatography it became apparent that the
Fig. 2. Hypothetical reaction mechanism of GTP cyclohydrolase II
[13].
mrgshhhhhhgidh
Fig. 3. Generation of the cyclohydrolase II mutant library. The DHB
synthase and cyclohydrolase II domains were separately amplified
by PCR to permit the integration of random mutations only into the
cyclohydrolase II domain. Afterwards, the two PCR products were
combined by a third PCR, digested by EcoRI and BamHI, and trans-
formed into the cyclohydrolase II-deficient E. coli strain Rib7
(pREP4).
M. Lehmann et al. Biosynthesis of riboflavin – generation of an improved cyclohydrolase II
FEBS Journal 276 (2009) 4119–4129 ª 2009 The Authors Journal compilation ª 2009 FEBS 4121
mutation reduced the susceptibility to proteolytic
cleveage into two typical fragments of the RibA wild-
type protein. The new mutant (Y210C, A290T, A296T)
was used as template for a second cycle of mutagenesis
and selection (10 000 mutants). It afforded 351 novel
candidate strains. After rescreening, 10 mutant proteins
were purified and characterized, and their effective
mutations were determined. The best combinations of
the newly found mutations resulted in Constructs C
(Y210C, A290T, Q293R, A296T, K322R, M361I) and
E (Y210C, A290T, Q293R, A296T, K322R, F339Y,

M361I), which were selected for more detailed kinetic
studies.
Steady-state kinetic experiments were conducted at
pH 8.5 and 30 °C. The reaction was monitored photo-
metrically at 310 nm. Figure 4 shows experiments
using GTP as substrate. Experimental data points
showed good agreement with the Michaelis–Menten
approximation over a wide range of substrate concen-
trations (0.017–1.7 mm). The V
max
value of Construct
C exceeded that of the wild-type protein by a factor of
1.9. Constructs C and E both showed K
m
values that
were increased substantially, by a factor in the range
of three- to four-fold, compared with that of the wild-
type protein. Notably, the steady-state parameters of
the B. subtilis wild-type protein were similar to those
of GTP cyclohydrolase II of E. coli that has been stud-
ied previously in some detail [11,15].
Steady-state kinetic experiments were also performed
with the reaction intermediate 10 (prepared from GTP
by enzymatic treatment with a mutated GTP cyclohy-
drolase I, as described in Ref. [16]). Experiments were
monitored photometrically at 310 nm (Fig. 5). The
maximum rate observed with Construct E was again
increased by a factor of about 2. Again, the mutated
Constructs C and E showed markedly increased K
m

values (Table 1).
It appears likely that the hydrolytic opening of the
imidazole ring of GTP has the highest Gibbs free
energy barrier of all partial reactions in the GTP
cyclohydrolase II trajectory. However, the comparative
steady-state analysis using the natural substrate, GTP,
and the ring-opened reaction intermediate 10, suggests
that the increase in the overall rate constants observed
with the mutated proteins is not caused by a lowering
of that free energy barrier.
Previously, we studied GTP cyclohydrolase II of
E. coli using presteady-state kinetic analysis [13]. Unex-
pectedly, those experiments had suggested a relatively
slow formation of the phosphoguanosyl derivative 7
under release of pyrophosphate. That covalently bound
moiety appeared to undergo rapid hydrolytic release of
formate from the imidazole ring and ⁄ or hydrolytic
cleavage of the phosphodiester bond. It was, in fact, a
Fig. 4. Steady-state kinetics of GTP cyclohydrolase II from Bacil-
lus subtilis, using GTP as the substrate. Symbols represent the
experimental data. Lines represent the Michaelis–Menten approxi-
mation (—, wild-type; —, Construct E; ÆÆÆÆ, Construct C).
Fig. 5. Steady-state kinetics of GTP cyclohydrolase II from Bacil-
lus subtilis using 2-amino-5-formylamino-6-ribosylamino-4(3H)-pyri-
midinone 5¢-triphosphate (Compound 10) as the substrate. Symbols
represent the experimental data (310 nm). Lines represent the
Michaelis–Menten approximation (—, wild-type; - - -, Construct E).
Table 1. Kinetic properties of different GTP cyclohydrolase II
proteins from Bacillus subtilis.
GTP as

substrate
Compound
10 as substrate
k
cat
(min
)1
) K
m
(lM) k
cat
(min
)1
) K
m
(lM)
Wild-type 2.1 ± 0.02 10 ± 1 3.0 ± 0.2 31 ± 7
Construct E 4.3 ± 0.04 44 ± 2 6.0 ± 0.3 122 ± 20
Construct C 3.9 ± 0.04 49 ± 3 5.4 ± 0.1 79 ± 8
Biosynthesis of riboflavin – generation of an improved cyclohydrolase II M. Lehmann et al.
4122 FEBS Journal 276 (2009) 4119–4129 ª 2009 The Authors Journal compilation ª 2009 FEBS
surprising finding that the opening of the imidazole ring
was not in any way rate-limiting, despite the relatively
high free-energy barrier of that reaction step.
We have now conducted similar stopped-flow experi-
ments with the wild-type and mutant enzymes of
B. subtilis. By comparison with the earlier study, the
present experiments were hampered by the tendency of
the B. subtilis enzymes to form precipitates after the
addition of GTP that were conducive to corruption of

the photometric signal by stray light. An in-depth
kinetic analysis of the single-turnover data was not
possible under these experimental conditions. Never-
theless, the data enabled a comparison to be made
of the different B. subtilis proteins as well as a
comparison with the E. coli protein.
Figure 6 shows a single-turnover experiment with
wild-type GTP cyclohydrolase II of B. subtilis that was
performed using an enzyme ⁄ substrate ratio of 1 : 0.7.
The reaction was characterized by a decrease in absor-
bance at 252 nm and an apparently synchronous
increase in absorbance at 292 nm. The superposition
of spectra taken from the series showed an apparent
isosbestic point at 278 nm, which suggests an apparent
0.160
0.120
0.080
0.040
0.0
240 260 280 300 320 340 360 380 400
Wavelength (nm)
Absorbance
0.1
0.5
1
10
50
Time (s)
5
Fig. 6. Optical spectra from a stopped-flow experiment with wild-

type GTP cyclohydrolase II from Bacillus subtilis, using GTP as the
substrate.
AB
CD
Fig. 7. Absorbance changes during single-turnover stopped-flow experiments with wild-type GTP cyclohydrolase II (A, B) and Construct E
(C, D), using GTP as the substrate. Reaction mixtures contained 50 m
M Tris–HCl (pH 8.5), 100 mM NaCl, 10 mM MgCl
2
and 2 mM dithio-
threitol. The enzyme solution was mixed with substrate solution at a molar ratio of 1 : 0.7, at a temperature of 35 °C.
M. Lehmann et al. Biosynthesis of riboflavin – generation of an improved cyclohydrolase II
FEBS Journal 276 (2009) 4119–4129 ª 2009 The Authors Journal compilation ª 2009 FEBS 4123
perfect reaction (data not shown). These findings are
all similar to the earlier findings made for GTP cyclo-
hydrolase II of E. coli [13].
A comparison between the B. subtilis wild-type pro-
tein and Construct E can be based on the progression
curves at selected wavelengths, as shown in Fig. 7.
Figure 7B,D also shows the total differentials of absor-
bance obtained at selected wavelengths versus time.
The absorbance at 278 nm showed minimal variation
for both proteins.
The wild-type and mutant proteins showed similar
progression curves for the differentials at 310, 295 and
254 nm, suggesting that the two proteins under com-
parison perform similarly under single-turnover condi-
tions. This unexpected finding will be discussed in
more detail below.
In similar experiments shown in Fig. 8, the pro-
tein ⁄ substrate ratio was varied over a range of 1 : 0.7–

1 : 2.5. Progression curves are shown at 295 nm, a
wavelength where the absorption is dominated by
the nascent 2,5,6-triaminopyrimidinone motif present
in the hypothetical covalent intermediate 9 and the
product 10, with only a minor contribution (by the
substrate, GTP 1) to the absorbance. Differentials of
the absorbance at 295 nm (dA
295
⁄ dt) are shown in the
frames on the right side of the Figure. Whereas the
curves for wild-type and mutant proteins were similar
under conditions where there was a slight excess of
protein over substrate, the similarity broke down
under presteady-state conditions with an excess of
AB
C
D
Fig. 8. Numerical simulation of stopped-flow data of wild-type GTP cyclohydrolase II from Bacillus subtilis (A, B) and Construct E (C, D),
using GTP as the substrate. The enzyme solution was mixed with substrate solution at molar ratios of 1 : 0.7 (s), 1 : 1.3 (
) and 1 : 2.5 ( ).
Symbols represent the experimental data and lines represent the numerical simulation using the kinetic constants in Table 2. Data sets were
analyzed using the program
DYNAFIT [24].
Table 2. Single-turnover rate constants of different GTP cyclo-
hydrolase II proteins from Bacillus subtilis using GTP as the
substrate.
Wild type Construct E
k2 ⁄ k1 (l
M) 4.36 ± 0.18 25.6 ± 0.8
k3 (min

)1
) 13.0 ± 0.11 27.4 ± 0.4
k4 (min
)1
) 3.18 ± 0.02 6.84 ± 0.05
Biosynthesis of riboflavin – generation of an improved cyclohydrolase II M. Lehmann et al.
4124 FEBS Journal 276 (2009) 4119–4129 ª 2009 The Authors Journal compilation ª 2009 FEBS
substrate at the start of the reaction. Under these
conditions, we observed a significantly higher initial
rate for the mutant protein compared with the wild-
type protein. More specifically, dA
295
⁄ dt at t = 0 was
0.125 for the mutant protein and 0.085 for the wild-
type protein. In the case of the wild-type protein, a
plateau of dA
295
⁄ dt at a level of about 0.02, which
extended from about 10 to 30 s, followed the initial
steep decline. By contrast, the reaction catalyzed by
the mutant protein was virtually complete within 30 s.
As described in more detail below, this is best
explained by the hypothesis that the rate enhancement
observed for the mutant under steady-state conditions
is caused by differences in the rate of product release.
Discussion
Four types of GTP cyclohydrolases are known to cata-
lyze the hydrolytic cleavage of the bond between C-8
and N-9 of the guanine moiety. The ring-opening
reaction can be preceded and ⁄ or followed by other

reaction steps catalyzed by the respective enzyme.
Specifically, GTP cyclohydrolase I catalyzes the ring
opening of GTP, followed by hydrolytic deformyla-
tion, Amadori re-arrangement and ring closure
resulting in the production of dihydroneopterin
triphosphate, which serves as the first committed
precursor in the biosynthesis of tetrahydrofolate and
tetrahydrobiopterin (for review see Refs. [17]). The
recently discovered MptA protein produces the 2¢,3¢-
cyclophosphate of dihydroneopterin that is believed to
serve as a precursor for the biosynthesis of tetrahydro-
methanopterin, a one-carbon transfer cofactor of
methanogenic coenzymes [18]. GTP cyclohydrolase II,
the subject of this article, is believed to catalyze the
release of phosphate from GTP, which is conducive to
the formation of a covalent guanylyl adduct that can
be resolved by a sequence of ring opening, deformyla-
tion and ⁄ or phosphodiester cleavage resulting in the
production of 2, the first committed intermediate in
the biosynthesis of riboflavin. The covalent adduct
remains to be confirmed by direct evidence, but the
recently reported 3D structure suggests that Arg128 is
the acceptor of the phosphodiester linkage in the
E. coli protein [19]. GTP cyclohydrolase III of Archae-
bacteria catalyzes ring opening without accessory
reactions [20,21]. The resulting 2-amino-5-formylami-
no-6-ribosylamino-4(3H)-pyrimidinone 5¢-triphosphos-
phate is believed to serve as the first committed
intermediate in the biosynthesis of riboflavin and of
the deazaflavin-type cofactor F420.

Divalent cations appear to be essential for all known
GTP cyclohydrolases. Specifically, the type I enzyme
uses a zinc ion that is coordinated by one cysteine resi-
due and two histidine residues. The type II enzyme
requires Mg
2+
and a zinc ion that is coordinated by
three cysteine residues. It appears plausible that the
opening of the imidazole ring involves a relatively
large Gibbs free-energy barrier; however, the pre-
steady-state analysis of the type I and type II enzymes
indicates that the ring opening is not by any means the
rate-determining step of the respective reaction trajec-
tory; in the case of the E. coli ortholog, which has
been studied in some detail, the ring-opening reaction
has a rate constant of 0.23 s
)1
compared with a rate
constant of 0.025 s
)1
for the overall reaction.
Stopped-flow kinetic studies of wild-type and
muta nt GTP cyclohydrolase II of B. subtilis, as
described above, were conducted in close analogy to
earlier studies on the E. coli enzyme. However, in con-
trast to the E. coli enzyme, the B. subtilis proteins had
a marked tendency to form precipitates upon mixing
with GTP. This behavior suggests that substra te bind-
ing is cond ucive to a more hydrophobic and aggrega-
tion-prone state of the protein. Owing to the resulting

corruption of the optical readout by the stray light
contribution, it was not possible to perform a detailed
deconvolution of the stopped-flow kinetic da ta, in
analogy to the earlier study performed with the E. coli
enzy me; despite this shortcoming, the data suggest
that the kinetic profile of the B. subtilis enzyme is
indeed similar to that of the E. coli enzyme, with the
formation of the covalent adduc t as a relatively slow
initial step.
Even without the opportunity to conduct a compre-
hens ive data deconvolution, stopped- flow analysis
under single-turnover conditions, as well as prest eady-
state conditions, afforded useful information for
comp arison of the wild-type protein with the mutant
Cons truct E. Specifically, absorbance progression
curves of the two pr oteins were similar under strict
single-turnover conditions conducted with a molar
excess of enzyme over substrate (Figs 7 and 8). By
contrast, the kinetic differences became progressively
larger when the substrate was proffered in excess ( pre-
steady-state conditions with a protein ⁄ substrate ratio
up to a value of 1 : 2.5; Fig. 8). Clearly, under these
conditions, the mutan t protein generated product at a
higher overall rate than did the wild-type protein.
Moreover, these observations are perfectly in line with
the stea dy-state analysis, indicati ng an approximately
two-fold increased k
cat
of Construct E compared with
the wild-type protein. These findings are best

explained by the hypothesis that the mutations in
Cons truct E affect the rate of product release rather
than the ra te of product formation. This hypothesis is
M. Lehmann et al. Biosynthesis of riboflavin – generation of an improved cyclohydrolase II
FEBS Journal 276 (2009) 4119–4129 ª 2009 The Authors Journal compilation ª 2009 FEBS 4125
also well in line with the increased K
m
values deter-
mined for Constructs C and E (Table 1); in fact,
preliminary data showed that various mutant protein s
selected for their increa sed V
max
value also showed an
increase in their K
m
value.
The increased K
m
values of the mutant constructs
may be caused predominantly by an increased off-rate
for dissociation of the Michaelis complex. For the time
being, we are limited to speculation because off-rates
have not been measured for any of the B. subtilis
proteins under study. Speculating further along these
lines, it is conceivable that an increased off-rate may
apply not only to the enzyme ⁄ substrate complex
(Michaelis complex) but also to the enzyme ⁄ product
complex. That hypothesis is well in line with the
observed reaction acceleration under substrate saturat-
ing conditions. An increased off-rate of the Michaelis

complex would be irrelevant for the catalytic rate
under saturating conditions.
There is precedent for enzymes with substrate release
as the rate-limiting step for the overall reaction. Never-
theless, it came as a surprise that the extensive
enzyme-evolution process conducted in this study
failed to increase the rate constant significantly for any
of the catalytical partial reactions sensus strictiori
(resulting in chemical modification of the reactant),
although the overall reaction velocity was increased
(via accelerated product release, as described earlier).
For the practical purpose of improving the produc-
tivity of a riboflavin-overproducing strain by intro-
ducing the improved GTP cyclohydrolase II domain
into a riboflavin-producing strain, it is irrelevant
whether the rate acceleration is caused by enhanced
substrate conversion or by enhanced product-release
rates. The increase in K
m
accompanying the increase
in V
max
can be tolerated in the technical application
because the cellular GTP concentrations are well
above the K
m
, even for Construct E; moreover, this
enzyme would be working under substrate-saturating
conditions in the in vivo situation.
Based on the recently reported X-ray structure of the

E. coli enzyme [22], the location of the mutations
introduced by the enzyme-evolution strategy in relation
to its reaction center can be described at least approxi -
mately. In the crystal structure, the location of the cata-
lytic site is clearly defined by the position of the zinc
and magnesium ions and by bound GMP, one of the
products of GTP cyclohydrolase II. As shown in Fig. 9,
all mutations in Const ruct E are located outside the
first amino acid shell of the substrate ⁄ metal ion-binding
cavity. It appears quite plausible that remote mutatio ns
can be conducive to subtle deformations of the active-
site cavity. This could be conducive to a lowered
ligand-binding affinity predominantly caused by an
increased off-rate for both substrate and product. An
increased off-rate would not be conducive to the
premature loss of int ermediates because these are all
covalently tethered to the protein.
Experimental procedures
Materials
2-Amino-5-formylamino-6-ribosylamino-4(3H)-pyrimidinone
5¢-triphosphate (10) was prepared as described previously
[16]. Protease inhibitors without EDTA, Taq polymerase,
high-fidelity polymerase, restriction enzymes, DNase I, T4
ligase and the nucleotide mixture used for PCR were from
Roche Diagnostics (Rotkreuz, Switzerland). Kanamycin sul-
fate, ampicillin and most of the other fine-chemicals were
supplied by Fluka (Buchs, Switzerland). LB (Luria–Bertani)
medium was from Becton Dickinson (Basel, Switzerland).
Generation of mutant libraries
For the generation of the ribA mutant library, the plasmid

pQE60-ribANhis (Table 1) was used in which ribA from
B. subtilis was cloned between the EcoR1 and the BamH1
sites of pQE60 (Table 1). The gene itself was slightly modi-
fied by the addition of the DNA sequence motif 5¢-GAA
TTCattaa
agaggagaaattaact ATG AGA GGA TCT CAC
CAT CAC CAT CAC CAT GGG ATC GAT CAT-3¢ in
front of the start codon. The modified ORF features an
Nde1 site at the start codon and specifies a RibA protein
carrying an N-terminal 6· His tag. In order to introduce
mutations exclusively into the cyclohydrolase II domain of
ribA and not into the 3,4-dihydroxy-2-butanone (DHB)
synthase domain, error-prone PCR was performed [(using
the oligonucleotides ribA3S and ribA4AS (Table 4) as
primers] only on the DNA fragment coding for the cyclo-
hydrolase II domain. Reaction mixtures for error-prone
PCR contained 5 mm MgCl
2
, 0.7 mm MnCl
2
, 0.2 mm
Fig. 9. Structure of wild-type GTP cyclohydrolase II from Escheri-
chia coli [22]. The positions that are homologous to the mutations
in Construct E are marked in yellow.
Biosynthesis of riboflavin – generation of an improved cyclohydrolase II M. Lehmann et al.
4126 FEBS Journal 276 (2009) 4119–4129 ª 2009 The Authors Journal compilation ª 2009 FEBS
nucleotide triphosphates, 10 ng of template DNA, 2 lm of
each primer and 2.5 U of Taq polymerase in 50 lL of the
1· buffer supplied with the polymerase. The reaction condi-
tions were as follows: step 1, 3 min, 95 °C; step 2, 30 s,

94 °C; step 3, 30 s, 52 °C; step 4, 45 s, 72 °C; and step 5,
7 min, 72 °C; steps 2 to 4 were repeated 35 times.
For reconstruction of the entire ribA gene, the DHB syn-
thase domain was also amplified using the oligonucleotides
ribA1S and ribA2AS (Table 4) as primers under the follow-
ing conditions: 100 ng of template DNA, 2 lm of each pri-
mer, 2.5 U high-fidelity polymerase mixture and 0.2 mm
nucleotides in 50 lL of the 1· buffer supplied with the poly-
merase, using the heating protocol as described above. Both
PCR products were purified by agarose-gel electrophoresis
and subsequent elution of the desired DNA fragments from
the gel. In a third PCR, the purified PCR products were
assembled to create the complete ribA gene (100 ng of PCR
product 1, 100 ng of PCR product 2, 2.5 U high-fidelity
polymerase, 0.2 m m of nucleotides, 2 mm primer ribA1S
and 2 mm primer ribA4AS (Table 4) in 50 lL of the buffer
supplied with the polymerase; PCR protocol: step 1, 3 min,
95 °C; step 2, 30 s, 94 °C, step 3, 30 s, 52 °C; step 4, 2 min,
72 °C; and step 5, 7 min, 72 °C; steps 2 to 4 were repeated
35 times). The PCR product was purified by using the PCR
purification kit from Qiagen. The purified PCR product was
digested with EcoRI and BamHI and ligated into pQE60
(Table 3) also digested with EcoRI and BamHI. The ligation
product was transformed into the riboflavin auxotrophic
strain E. coli RB7 [15] [pREP4] (Table 3). Selection took
place on LB plates containing 100 mgÆmL
)1
of ampicillin.
Transformants were picked into 96-well plates containing
200 lL of LB medium (supplemented with 25 lgÆmL

)1
of
kanamycin and 100 lgÆmL
)1
of ampicillin) and were grown
overnight. Dimethylsulfoxide (15 lL per well) was added,
and the plates were stored at )80 ° C. For further rounds of
mutagenesis, the original ribA gene was replaced with the
improved mutants, as selected.
Bacterial culture
Aliquots (5 lL) from each well of a master plate were trans-
ferred into a deep-well plate filled with 250 lL of LB medium
(supplemented with 25 lgÆmL
)1
of kanamycin and
100 lgÆmL
)1
of ampicillin) per well. The plates were incu-
bated overnight (37 °C, 250 r.p.m.) on a rotary shaker. The
next morning, LB medium (1.2 mL) supplemented with
25 lgÆmL
)1
of kanamycin and 100 lgÆmL
)1
of ampicillin
was added to each well. The plates were incubated at 30 °C
on a rotary shaker at 250 r.p.m. After 6 h, isopropyl thio-b-
d-galactoside was added to a final concentration of 0.5 mm.
The plates were incubated for another 16 h at 30 °C with
shaking (250 r.p.m.). At the end of this incubation period,

the cells were pelleted by centrifugation (20 min, 3220 g) and
stored at )80 °C.
Screening
Cell pellets in deep-well plates were suspended in 300 lLof
20 mm Tris–HCl (pH 7.5) containing 10 mm MgCl
2
, 15%
sucrose, 0.1% Triton X-1000, 0.1 mgÆ mL
)1
of lysozyme and
5mgÆmL
)1
of DNase I, and the recommended concentra-
tion of Roche protease inhibitor without EDTA. The plates
were incubated at 20 °C under shaking at 200 r.p.m. for
25 min, followed by centrifugation (20 min, 4000 g). Aliqu-
ots (100 lL) of the supernatants were mixed with 150 lLof
a reaction mixture containing 100 mm Tris–HCl (pH 8.5),
10 mm MgCl
2
,15mm mercaptoethanol and 1.6 mm GTP.
The absorbance increase at 310 nm was monitored at 37 °C.
In parallel experiments, 50-lL aliquots of the supernatants
were mixed with 75 lL of a reaction mixture containing
50 mm Tris–HCl (pH 7.5), 10 mm MgCl
2
,5mm ribose-5-
phosphate and 2.7 U of ribose 5-phosphate isomerase in a
total volume of 100 lL. The mixtures were incubated for
20 min at 37 °C. A solution (100 lL) containing 2 m NaOH

and 35 gÆL a-naphthol was added together with 50 lLof
saturated creatine solution. The mixture was incubated at
20 °C for periods of 60 to 120 min, and the absorbance at
525 nm was determined [23].
Protein purification
Frozen E. coli cell mass (25 g) was thawed in 60 mL of
50 mm Tris–HCl (pH 8.0), containing 0.3 m sodium chlo-
ride and 10 mm magnesium chloride. The cells were
Table 3. Microorganisms and plasmids used in this study.
Strain or plasmid
Genotype or relevant
characteristics
Reference
or source
Escherichia coli Rib7 thi leu pro lac ara xyl
endA recA hsd r
-
m
-
pheS supE44 rib
[15]
Plasmids
pREP4 Low-copy-number plasmid
expressing lacI
Quiagen Inc.
pQE60 Expression plasmid for
E. coli
Quiagen Inc.
pQE60-ribA-Nhis pQE60 with an N-terminally
tagged ribA from

Bacillus subtilis
This study
Table 4. Oligonucleotides used in this study.
Oligonucleotide Nucleotide sequence (5¢-to3¢)
ribA3S TCGCGAAAAAGCATCAATTAAAAATG
ribA4AS TAATTAAGCTTGGATCCTTAG;
ribA1S TAACAATTTCACACAGAATTC
ribA2AS GATGCTTTTTCGCGATTTCAATGAGC
M. Lehmann et al. Biosynthesis of riboflavin – generation of an improved cyclohydrolase II
FEBS Journal 276 (2009) 4119–4129 ª 2009 The Authors Journal compilation ª 2009 FEBS 4127
disrupted by ultrasonic treatment, and the suspension was
centrifuged. The supernatant was applied to a column of
Ni-chelating Sepharose FF (GE Healthcare Europe GmbH,
Otelfingen, Switzerland; column volume 20 mL), which had
been equilibrated with 50 mm Tris–HCl (pH 8.0) containing
0.3 m sodium chloride and 10 mm magnesium chloride
(flow rate, 2 mLÆmin
)1
). The column was washed with
100 mL of the equilibration buffer and was then developed
with a gradient of 0–200 mm imidazole in 50 mm Tris–HCl
(pH 8.0) containing 0.3 m sodium chloride, 10 mm magne-
sium chloride and 5% glycerol (total volume, 100 mL).
Fractions were combined and dialyzed overnight against
50 mm Tris–HCl (pH 8.5) containing 100 mm sodium chlo-
ride, 10 mm magnesium chloride, 2 mm dithiothreitol and
5% glycerol. The enzyme was stored at 4 °C.
Steady-state kinetics
Reaction mixtures contained 50 mm Tris–HCl (pH 8.5),
100 mm NaCl, 10 mm MgCl

2
,2mm dithiothreitol and pro-
tein in a total volume of 400 lL. Experiments were per-
formed at 30 °C. The reaction was initiated by the addition
of GTP to a predetermined concentration (0.017–1.7 mm).
The assay was monitored photometrically at 310 nm. Reac-
tion rates were calculated using an absorption coefficient of
7.43 mm
)1
Æcm
)1
for 2,5-diamino-6-ribosylamino-4(3H)-pyri-
midinone 5¢-phosphate .
Stopped-flow kinetic experiments
Experiments were performed using an SFM4 ⁄ QS apparatus
from Bio-Logic (Claix, France) equipped with a linear
array of three mixers and four independent syringes. The
content of a 1.5-mm light path quartz cuvette behind the
last mixer was monitored using a Tidas diode array spec-
trophotometer (200–610 nm) equipped with a 15 W deute-
rium lamp as the light source (J&M Analytische Meß- und
Regeltechnik, Aalen, Germany). The reaction buffer con-
tained 50 mm Tris–HCl (pH 8.5), 100 mm NaCl, 10 mm
MgCl
2
and 2 mm dithiothreitol. The enzyme solution was
mixed with substrate solution at a temperature of 35 °C
and a total flow rate of 4 mLÆs
)1
. The calculated dead time

was 7.6 ms. Spectra integrated over 96 ms were recorded at
intervals of 100 ms.
References
1 Stahmann KP, Revuelta JL & Seulberger H (2000)
Three biotechnical processes using Ashbya gossypii,
Candida famata, or Bacillus subtilis compete with
chemical riboflavin production. Appl Microbiol Biotech-
nol 53, 509–516.
2 Perkins JB, Pero JG & Sloma A (1991) Riboflavin over-
producing bacteria expressing the rib operon of Bacillus.
pp. 70. Hoffmann-La Roche, F., und Co. A G.,
Switzerland. Application: EP.
3 Young DW (1986) The biosynthesis of the vitamins thia-
min, riboflavin, and folic acid. Nat Prod Rep 3, 395–419.
4 Bacher A, Eberhardt S & Richter G (1996) In Escheri-
chia coli and Salmonella typhimurium (Neidhardt FC,
Ingraham JL, Low KB, Magasanik B, Schaechter M &
Umbarger HE, eds), pp. 657–664, ASM Press, Washing-
ton D.C.
5 Bacher A, Eberhardt S, Eisenreich W, Fischer M, Herz
S, Illarionov B, Kis K & Richter G (2001) Biosynthesis
of riboflavin. Vitam Horm 61, 1–49.
6 Fischer M & Bacher A (2005) Biosynthesis of flavo-
coenzymes. Nat Prod Rep 22, 324–350.
7 Foor F & Brown GM (1975) Purification and properties
of guanosine triphosphate cyclohydrolase II from
Escherichia coli. J Biol Chem 250, 3545–3551.
8 Kis K, Volk R & Bacher A (1995) Biosynthesis of
riboflavin. Studies on the reaction mechanism of 6,7-
dimethyl-8-ribityllumazine synthase. Biochemistry

(Mosc) 34, 2883–2892.
9 Volk R & Bacher A (1990) Studies on the 4-carbon pre-
cursor in the biosynthesis of riboflavin. Purification and
properties of L-3,4-dihydroxy-2-butanone-4-phosphate
synthase. J Biol Chem 265, 19479–19485.
10 Wacker H, Harvey RA, Winestock CH & Plaut GW
(1964) 4-(1¢-d-ribitylamino)-5-amino-2,6-dihydroxypyr-
imidine, the second product of the riboflavin synthetase
reaction. J Biol Chem 239, 3493–3497.
11 Kaiser J, Schramek N, Eberhardt S, Puttmer S, Schus-
ter M & Bacher A (2002) Biosynthesis of vitamin B2.
Eur J Biochem 269, 5264–5270.
12 Ritz H, Schramek N, Bracher A, Herz S, Eisenreich W,
Richter G & Bacher A (2001) Biosynthesis of riboflavin:
studies on the mechanism of GTP cyclohydrolase II.
J Biol Chem 276, 22273–22277.
13 Schramek N, Bracher A & Bacher A (2001) Biosynthe-
sis of riboflavin. Single turnover kinetic analysis of
GTP cyclohydrolase II. J Biol Chem 276, 44157–44162.
14 Hu
¨
mbelin M, Griesser V, Keller T, Schurter W, Haiker
M, Hohmann HP, Ritz H, Richter G, Bacher A & Van
Loon APGM (1999) GTP cyclohydrolase II and 3,4-di-
hydroxy-2-butanone 4-phosphate synthase are rate-
limiting enzymes in riboflavin synthesis of an industrial
Bacillus subtilis strain used for riboflavin production.
J Ind Microbiol Biotechnol 22 , 1–7.
15 Richter G, Ritz H, Katzenmeier G, Volk R, Kohnle A,
Lottspeich F, Allendorf D & Bacher A (1993) Biosyn-

thesis of riboflavin: cloning, sequencing, mapping, and
expression of the gene coding for GTP cyclohydrolase
II in Escherichia coli. J Bacteriol 175, 4045–4051.
16 Bracher A, Fischer M, Eisenreich W, Ritz H, Schramek
N, Boyle P, Gentili P, Huber R, Nar H, Auerbach G
et al. (1999) Histidine 179 mutants of GTP cyclohydro-
Biosynthesis of riboflavin – generation of an improved cyclohydrolase II M. Lehmann et al.
4128 FEBS Journal 276 (2009) 4119–4129 ª 2009 The Authors Journal compilation ª 2009 FEBS
lase I catalyze the formation of 2-amino-5-formyl-
amino-6-ribofuranosylamino-4(3H)-pyrimidinone
triphosphate. J Biol Chem 274, 16727–16735.
17 Nar H (2004) GTP cyclohydrolase I. In Handbook of
Metalloproteins (Messerschmidt A, Bode W, Cygler M,
eds), Vol. 3, pp. 235–245. John Wiley & Sons, Chichester.
18 Grochowski LL, Xu H, Leung K & White RH (2007)
Characterization of an Fe(2+)-dependent archaeal-spe-
cific GTP cyclohydrolase, MptA, from Methanocaldo-
coccus jannaschii. Biochemistry (Mosc) 46, 6658–6667.
19 Ren J, Kotaka M, Lockyer M, Lamb HK, Hawkins AR
& Stammers DK (2005) GTP cyclohydrolase II structure
and mechanism. J Biol Chem 280, 36912–36919.
20 Graham DE, Xu H & White RH (2002) A member of a
new class of GTP cyclohydrolases produces formylami-
nopyrimidine nucleotide monophosphates. Biochemistry
(Mosc) 41, 15074–15084.
21 Morrison SD, Roberts SA, Zegeer AM, Montfort WR
& Bandarian V (2008) A new use for a familiar fold:
the X-ray crystal structure of GTP-bound GTP cyclo-
hydrolase III from Methanocaldococcus jannaschii
reveals a two metal ion catalytic mechanism. Biochem-

istry 47, 230–242.
22 Ren J, Kotaka M, Lockyer M, Lamb HK, Hawkins
AR & Stammers DK (2005) GTP cyclohydrolase II
structure and mechanism. J Biol Chem 280, 36912–
36919.
23 Picollelli MA, Viitanen PV & Jordan DB (2000)
Spectrophotometric determination of 3, 4-dihydroxy-2-
butanone-4-phosphate synthase activity. Anal Biochem
287, 347–349.
24 Kuzmic P (1996) Program DYNAFIT for the analysis
of enzyme kinetic data: application to HIV proteinase.
Anal Biochem 237, 260–273.
M. Lehmann et al. Biosynthesis of riboflavin – generation of an improved cyclohydrolase II
FEBS Journal 276 (2009) 4119–4129 ª 2009 The Authors Journal compilation ª 2009 FEBS 4129