Báo cáo khoa học: Expression in yeast of a novel phospholipase A1 cDNA from Arabidopsis thaliana docx

Expression in yeast of a novel phospholipase A1 cDNA
from
Arabidopsis thaliana
Alexandre Noiriel
1
, Pierre Benveniste
1
, Antoni Banas
2
, Sten Stymne
2
and Pierrette Bouvier-Nave
´
1
1
Institut de Biologie Mole
´
culaire des Plantes du CNRS, De
´
partement Isopre
´
noı
¨
des, Institut de Botanique, Strasbourg, France;
2
Department of Crop Science, Swedish University of Agricultural Sciences, Alnarp, Sweden
During a search for cDNAs encoding plant sterol acyl-
transferases, we i solated four full-length cDNAs from Ara-
bidopsis thaliana that encode proteins with substantial
identity with animal lecithin : c holesterol a cyltransferases
(LCATs). The expression of one of these c DNAs, AtLCAT3

(At3g03310), i n various yeast strains resulted in the doubling
of the t riacylglycerol content. Furtherm ore, a c omplete lipid
analysis of the transformed wild-type yeast showed that its
phospholipid content was lower than that of the control
(void p lasmid-transformed) yeast whereas lysophospho-
lipids a nd free fatty a cids increased. When microsomes from
the AtLCAT3-transformed yeast were incubated with
di-[1-
14
C]oleyl phosphatidylcholine, both t he lysophospho-
lipid and free fatty acid fractions were highly and similarly
labelled, whereas the same incubation with microsomes from
the control yeast produced a negligible labelling of these
fractions. Moreover when microsomes f rom AtLCAT3-
transformed yeast were incubated with either sn-1 - or sn -2-
[1-
14
C]acyl phosphatidylcholine, the distribution of the
labelling between the f ree fatty acid and the lysophospha-
tidylcholine fractions strongly suggested a phospholipase A1
activity for AtLCAT3. The sn-1 specificity of this phos-
pholipase was confirmed by gas chromatography analysis of
the hydrolysis of 1-myristoyl, 2-oleyl phosphatidylcholine.
Phosphatidylethanolamine and phosphatidic acid were
shown to be a lso hydrolysed b y AtLCAT3, although l ess
efficiently t han phosphatidylcholine. Lysophospatidylcho-
line was a weak substrate whereas tr ipalmitoylglycerol and
cholesteryl o leate were not hydrolysed at all. This novel
A. tha liana phospholipase A1 shows optimal activity at
pH 6–6 .5 and 60–65 °C and appears to be unaffected by

Ca
2+
. Its se quence is unrelated to all other known phos-
pholipases. Further studies are in progress to elucidate its
physiological role.
Keywords: Arabidopsis thaliana; e xpression in yeast; phos-
pholipase A1; triacylglycerol i ncrease.
Phospholipases A1 (PLA1) and A2 (PLA2) hydrolyse,
respectively, the sn -1 and sn-2 acylester bond o f phospho-
lipids, generating free fatty acids (FAs) and lysophospho-
lipids. Phospholipases B sequencially remove two FA from
phospholipids and thus have both phospholipase A and
lysophospholipase a ctivities [1]. These three types of phos-
pholipase activities ( A1, A2 a nd B) have been described in
microsomal preparations from triacylglycerol (TAG)-accu-
mulating tissues of vario us plants [2]. A PLA1 activity has
been identified in the tonoplast from Acer pseudoplatanus
cells [3] and an Arabidopsis thaliana cDNA encoding a PLA1
was shown to be expressed in the chloroplast [4]. But most of
the plant PLA papers describe s oluble PLA(2) activities [1].
Participation o f PLAs in p lant signal transduction is
mentioned for auxin stimulation of growth [5–7] and in
response t o bacterial an d fungal elicitors [8–10], wounding
[11] or viral infection [10,12]. This involvement of plant
PLAs in sign al transduction has j ust been reviewed [13].
PLAs are also directly implicated in phospholipid retailor-
ing or degradation during TAG synthesis [2,14] or senes-
cence [15]. The participation o f PLAs in these vario us
aspects of plant development and response to stress is likely
to occur in coordination with phospholipases C a nd D [16].

Several plant cDNAs encoding PLAs have been cloned
and characterized. They can be classified into three distinct
groups according to their sequence. The first group includes
the small (12–14 kDa) secretory PLA2s [7,17] which contain
12 conserved Cys residues and conserved regions that are
likely to represent the active site and Ca
2+
-binding loop
found in animal secretory PLA2s [18].
Correspondence to P. Bouvier-Nave
´
, Institut de Biologie Mole
´
culaire
des Plantes CNRS, De
´
partement Isopre
´
noı
¨
des, Institut de Botanique,
28 rue Goethe, 67083 Strasbourg Cedex, France.
Fax: +33 3 90 24 19 21, Tel.: +33 3 90 24 18 46,
E-mail: ,
URL: />Abbreviations: DGAT, diacylglycerol:acylCoA acyltransferase; FA,
fatty acid; FS, free sterol; FAME, fatty acid methyl ester; G3PAT,
glycerol-3-phosphate acyltransferase; LCAT, lecithin : cholesterol
acyltransferase; LPAAT, lysophosphatidic acid acyltransferase; LPC,
lysophosphatidylcholine; LPE, lysophosphatidylethanolamine; PC,
phosphatidylcholine; PDAT, phospholipid:diacylglycerol acyltrans-

ferase; PE, phosphatidylethanolamine; PLA1, phospholipase A1;
PS, phosphatidylserine; SE, steryl ester; TAG, triacylglycerol.
Enzymes: DGAT, diacylglycerol:acylCoA acyltransferase (EC
2.3.1.20); LCAT, lecithin:cholesterol acyltransferase (EC 2.3.1.43);
PDAT, phospholipid:diacylglycerol acyltransferase (EC 2.3.1.158);
PLA1, phospholipase A1 or phosphatidylcholine 1-acylhydrolase
(EC 3.1.1.32).
Note: Part of this s tudy was presented at the 16th International Plant
Lipid Symposium, Budapest, Hungary, 1–4 June 2004 (abstract
book pp. 33 and 105; />(Received 16 April 2004, revised 27 July 2004, accepted 2 August 2004)
Eur. J. Biochem. 271, 3752–3764 (2004) Ó FEBS 2004 doi:10.1111/j.1432-1033.2004.04317.x
A second group of plant PLAs is formed by soluble,
patatin-like (phospho)lipases A(2): an allergen from the latex
of Hevea brasiliensis [19], three tobacco leaf soluble proteins
induced by virus infection [12], a cowpea galact olipid
acylhydrolase stimulated by drought stress [20] and four
A. tha liana PLAs [6]. Patatin is the major storage protein of
the potato t uber. When cloned and expressed via a baculo-
virus vector in S f9 insect cells, it was sh own to be an aspecific
lipid acyl hyd rolase that h ydrolyses monoacylglycerols,
phosphatidylcholine (PC), monogalactosyldiacylglycerols,
di- and triacylglycerols with decreasing efficiency [21]. When
assayed with PC, purified patatin exhibited a PLA2 activity
[22]. Recent studies reve aled that patatin h as a Ser–Asp
catalytic dyad and a folding topology related to that of the
catalytic domain o f animal cytosolic PLA2s. Mutagenesis
confirmed the critical role of Ser77 a nd Asp215 in enzymatic
activity and of His109 in enzyme stability [23,24]. Moreover
Rydel et al. [24] described the crystal structure of patatin.
Called either PLA(2)s or lipid acylhydrolases, patatin and

related proteins are 40–50-kDa proteins sharing 40–60%
identity (mostly in the N-terminal half) a nd possessing t he
conserved Gly-X-Ser-X-Gly motif, around the catalytic Ser,
found in all the Ser hydrolases [25,26].
A t hird group of plant PLAs has been recently described
as lipase-like PLA1. Starting from an A. thaliana mutant,
defective in anther dehiscence 1 (dad1), the wild-type DAD1
gene was i solated, shown to c omplement the mutant and to
encode a c hloroplastic protein of 45 kD a w ith PLA1
activity [4]. Together with 11 homologous genes from the
Arabidopsis gene sequence databases, DAD1 presents
apparent similarities with some fungal lipases and p artic-
ularly the characteristic Ôcatalytic triadÕ composed of a S er,
an Asp and a His residue and the Gly-X-Ser-X-Gly
consensus motif around the catalytic Ser, both features that
are widely conserved i n fungal and animal lipases and more
generally in Ser hydrolases [ 25,26]. Apart from the Gly- X-
Ser-X-Gly motif common to g roups 2 and 3, these three
groups of plant PLAs are unrelated.
Here we wish to introduce a fourth group of plant PLAs,
the lecithin : cholesterol acyltransferase (LCAT)-like PLA1,
that we discovered in the course of a search f or sterol
acyltransferases. LCAT is the animal serum enzyme that
catalyses e sterification of lipopr otein-associated cholesterol
by the sn-2 acyl group of PC. In vit r o studies showed that
LCAT, when incubated with PC in the absence of
cholesterol, also possess PLA2 activity [27]. The cloning
and characteriz ation of hu man LCAT [2 8] and it s thorough
study by site-directed mutagenesis and molecular modelling
[29] showed that LCA T shares the Ser/Asp(Glu)/His

catalytic t riad and t he Gly-X-Ser-X-Gly m otif with Ser
hydrolases. We isolated f our A. thaliana cDNAs, t he
deduced amino acid sequences of which s hare 25–35%
identity with human LCAT, i ncluding the catalytic triad.
After e xpression in yeast, one of these cDNAs was clearly
shown to encode a PLA1.
Experimental procedures
Chemicals
All of t he lipids and Triton X -100 w ere 9 8–99% pure
products from Sigma. [4-
14
C]Cholesterol (49 mCiÆmmol
)1
),
[1a,2a(n)-
3
H] cholesteryl oleate (29 Ci Æmmol
)1
), [1-
14
C]oleic
acid (50 mCiÆmmol
)1
), [1-
14
C]oleylCoA (55 m CiÆmmol
)1
),
1-palmitoyl-2-[1-
14

C]oleyl phosphatidylcholine (56 mCi Æ
mmol
)1
), 1,2-[1-
14
C]oleyl phosphatidylcholine ( 107 mCiÆ
mmol
)1
) and tri-[1-
14
C]palmitoylglycerol (55 mCiÆmmol
)1
)
were from NEN or Amersham.
1-[1-
14
C]Palmitoyl-2-oleyl phosphatidylcholine ( 2.2 mCiÆ
mmol
)1
), 1-[1-
14
C]oleoyl-2-oleyl phosphatidylcholine
(2.2 mCi Æmmol
)1
) and 1-oleoyl-2-[1-
14
C]oleyl phosphatidyl-
choline (4.5 m CiÆmmol
)1
) were synthetized as described

previously [2].
Strains, media and culture conditions
Escherichia coli strain used, XL1 blue recA
–
[recA1, lac
–
,
endA1, gyrA96, thi, hsdR17, SupE44, relA1 (F’proAB,
lac1q, lacZ, DM15, Tn10)].
For Saccharomyces cerevisiae , two strains o f com-
mon genetic background (can1-100, his3-11,15, leu2-3,112,
trp1-1, ura3-1): are1are2 (SCY059, MATa, ade2-1,
met14D14HpaI-SalI, are1DNA::HIS3, are2D::LEU2)and
the corresponding wild-typ e ( SCY062, MATa) were a kind
gift of S. L. Sturley (Columbia University College of
Physicians and Surgeo ns, New York). Two strains were
from Euroscarf, Frankfurt: dga1 (BY4742, MATa, his3D1,
leu2D0, lys2D0, ura3D0, YOR245c::kanMX4)andlro1
(FY, Mat a, ura3-52, HIS3, leu2 D1, LYS2, trp1D63,
YNR008w(8, 1768)::kanMX2).
Yeast strains transformed with plasmid pYeDP60,
harbouring either no insert or the plant cDNA under
study, were simultaneously grown for 3 days at 30 °Cin
minimum medium c ontaining su itable supplements, then
transferred into complete m edium and gr own overnight
at 30 °C as previously described [30]. The cells were then
centrifuged and either freeze-dried for neutral lipid
analysis or disrupted for complete lipid analysis or
subfractionation.
Plasmid for yeast transformation

The plasmid p YeDP60 [31] was used to transform yeast
strains as in [30].
Cloning of LCAT-like cDNAs
For A. thaliana LCAT1 ( AtLCAT1), as a n E ST clone
AV4422635 (Kazusa DNA Research Insitute, Chiba,
Japan) became available, this latter was sequenced and
shown to correspond to a cDNA encompassing the ORF
of a gene (At1g27480) called AtLCAT1. Its sequen ce was
shown t o e ncode a polypeptide of 432 amino acids. This
sequence has been assigned the G enBank accession number
AY443040.
For Med icago truncatula LCA T1 (MtLCAT1),the
cDNA EST clone BE32 2181 (Samuel Roberts Noble
Foundation Medicago truncatula insect herbivory library,
USA) presented strong homology with AtLCAT1.After
complete sequencing, it was s hown t o c orrespond to a
cDNA of 1604 bp encoding a polypeptide of 450 amino
acids with 57% identity with AtLCAT1.
For Lycopersicum esculentum LCAT1 (LeLCAT1),the
EST clone BG127829 ( Clemson University Genomics
Ó FEBS 2004 A. thaliana cDNA encoding a novel phospholipase A1 (Eur. J. Biochem. 271) 3753
Institute, USA) was sequenced and t he resulting polypeptide
was shown to have 55% identity with AtLCAT1.
For Arabid opsis t haliana LCAT3 (AtLCAT3),theEST
cDNA clone BE525177 (ABRC, Ohio State University,
USA) was shown b y s equencing a nd comparison with the
sequence o f the gene At3g03310 to encode a truncated
AtLCAT3 polypeptide lacking 43 amino acids. A complete
ORF was reconstituted b y P CR using a d irect primer 353
(152 nucleotides) b ringing the lacking moiety of the cDNA

and a reverse primer 354 complementary to the 3¢ end of the
ORF (Table 1) and BE525177 as template. Final concen-
trations of primers w ere 400 n
M
, t emplate (20 ng) , High
Fidelity PCR Master DNA polymerase (Boehringer;
25 lL), total volume 50 lL. The PCR was performed using
29 cycles (30 s 94°,30s50°,2min72°). This resulted in the
amplification of a 1 344 b p fragment w hich after d igestion
with BamHI and KpnI was subcloned into pBlueScript SK
yielding the plasmid AtLCAT3-pSK. After checking for the
absence of mutations, the insert was subcloned into the
yeast s huttle vector pYeDP60, yielding the plasmid
AtLCAT3-pYeD P60. AtLCAT3 was deposited in
GenBank and assigned the accession number AF421148.
The FLAG-tagged A. thaliana LCAT3 (FLAG-
AtLCAT3) was made by PCR so that the C-terminal
FLAG epitope (*KDDDDKYD) was fused to the LCAT3
protein. To this purpose the reverse primer 359 containing
the FLAG sequence was opp osed to the direct primer 358
(Table 1) in the presence of AtLCAT3 (20 ng) as template.
The PCR product was checked for the absence of mutations
and subcloned into pYeDP60 as shown above.
To clone Nicotiana tabacum L CAT3 (NtLCAT3),an
orthologue of AtLCAT3 in tobacco, we took advantage of
the presence in databases of an mRNA sequence of tobacco
(clone q8 487, accession number L31415) described a s a
plant activating s equence e ncoding a positively charged
peptide functioning putatively as a transcriptional activation
domain [32]. T his peptide showed more than 90% identity

with a domain of AtLCAT3, therefore this peptide could
belong to an orthologue of AtLCAT3. In order to isolate
q8487, we designed two primers 362 a nd 363 (Table 1)
corresponding to the 5¢-and3¢-ends of q8487 and we
opposed them in PCR assays containing a tobacco cDNA
library (1 lL ¼ 10
3
pfu), p rimers (400 n
M
)andHigh
Fidelity PCR Master DNA polymerase ( Boehringer;
25 lL) in a total volume of 50 lL. The PCR was performed
using29cycles(30s94°,30s50°,2min72°). This resulted
in the amplification of a 300-bp fragment. The PCR product
was subcloned into p GEMT plasmid to allow the sequence
to be checked.
A cDNA lib rary (250 000 pfu) from a 3-week-old
N. t abacum cv. X anthi line LAB 1-4 c alli derived from
leaf protoplasts [33] was screened with the 300-bp q8487
sequence. Thirteen positive spots were found and the
corresponding kZAP phages were recove red, checked to
give an amplification product in PCR experiments with
primers 362 and 363, and screened a second time with q8487
allowing isolation of positive clones. Two of the clones (211
and 314) were selected and sequenced, 314 was shown to be
a full-length cDNA of 1691 bp encoding a polypeptide of
451 amino acids sharing 68% identity with AtLC AT3.
Therefore it was considered as an orthologue of AtLCAT3
and named NtLCAT3 (GenBank accession number
AF468223).

For Mesembryanthemum crystallinum LCAT3
(McLCAT3) a search in TIGR databases allowed us to
find several orthologues of AtLCAT3 in the ice plant
(Me sembryanthemum crystallinum). These clones originated
from an ic e plant k Uni-Zap XR expression library prepared
48 h after NaCl treatment (J. C. Cushman, Department of
Biochemistry, University of Nevada, Reno, NV). One of
Table 1. Synthetic oligonucleotide primer sequences (5¢fi
fi
3¢) used for gene cloning an d site- directed m utagen esis. Bold characters correspond to
restriction sites. Codons for th e changed amino acids are u nderlined. Nucleotides represented in bold characters i ndicate the p oint mutations
produced. For each mutation two oligonucleotides were synthesized: the one shown below and that w ith the complementary sequence.
Number
Gene cloning
ATATATGGATCCATGTCTCTATTACTGG AAGAGATC 337
TATATAGGTACCTTATGCATCAACAGAGACACTTAC 338
ATATATGGATCCATGGGCTGGATTCCGTGTCCGTGCTGGGGAACC 353
AACGACGATGAAAACGCCGGCGAGGTGGCGGATCGTGATCCGGTG
CTTCTAGTATCTGGAATTGGAGGCTCTATTCTGCATTCTAAGAAGA
AGAATTCAAAGTCTGAAATTCGGGTTTG
TATATAGGTACCTTAACCAGAATCAACTACTTTGTG 354
ATATATGGATCCATGGGCTGGATTCCGTGTC 358
TATATAGGTACCTTACTTGTCATCGTCGTCCTTGTAGTCACCAGA 359
ATCAACTACTTTGTGAG
TCCATGATATGATTGATATGC 362
GTGGCAATGGTAATCCAC 363
Site-directed mutagenesis
GCGTAGGAGTTTCGGGTAGC
CTCCGCGGGCTTCTCCGTGATGAAAG H409L
GGAGTGTCCTTCTATAACATA

TTTGGAGTGTCACTTAATACACC Y346F
GTCACTATCATCTCCCAT
GCAATGGGAGGACTTATGGTTTC S177A
CATATGTAGATGGAGCTGGAACTGTCCCTG D384A
GGAGTGTCACTTAAT
GCACCCTTTGATGTTTG T352A
3754 A. Noiriel et al. (Eur. J. Biochem. 271) Ó FEBS 2004
these clones (BE131533) was sequenced and shown to be a
cDNA of 1724 bp with a deletion of 60 bp inside the ORF.
A complete cDNA of 1793 b p could b e reconstituted owin g
to two other EST cDNAs BE034988 a nd BE131478 whose
sequences encompassed and complemented BE131533. This
cDNA encoded a protei n of 460 amino a cids having 63%
identity with AtLCAT3.
For G lycine m ax LCAT3 (GmLCAT3), Glycine max
orthologues of AtLCAT3 were found in TIGR databases.
Superposition of these clones (G. max gene index TC
reports: T C200937 and TC197463) allowed reconstitution
of a putative cDNA of 1551 bp encoding a polypep tide
having 63% identity with AtLCAT3.
To get Arabidopsis thaliana LCAT4 (AtLCAT4),the
EST clone A V549462 (Kazusa DN A Research I nsitute,
Chiba, Japan ) was the starting point. After sequencing it
was shown that AV549462 was a cDNA of 1802 bp
encoding a polypeptide of 536 amino acids. In order to
determine the function of this cDNA, the ORF was
amplified by PCR using primers 3 37 and 338 (Table 1 ) at
a concentration of 400 n
M
, AV549462 (20 ng) as template,

and High Fidelity PCR Master DNA polymerase (Boeh-
ringer; 25 lL). The PCR was perfo rmed using 29 cycles
(30 s 9 4°,30s50°,2min72°). This resulted in the
amplification of a product of 1608 bp which was cloned
into pYeDP60 previously opened by BamHI and KpnI. The
ORF was called AtLCAT4 and was registered in GenBank
under a ccession num ber A F421149. AtLCAT4 was derived
from At4g19860.
For Lycopersicum esculentum L CAT4 (LeLCAT4),after
sequencing t he EST clone BG125533 ( Clemson University
Genomics Institute, USA), a cDNA of 1853 bp (Gen Bank
accession number A F465780) presenting strong homology
with AtLCAT4 was identified. This cDNA encoded a
polypeptide of 535 amino acids having 66% identity with
AtLCAT4.
For Medicago truncatula LCAT4 ( MtLCAT4),twenty-
eight EST cDNA clones s howing strong homology with
AtLCAT4 and coming f rom the same gene have been
reported in TIGR databases. A nucleotide sequence
(TC86247) originating from the superimposition of these
clones h as also been given. After c onceptual translation, a
polypeptide sequence o f 539 amino a cids showing 64%
identity with AtLCAT4 has been deduced.
For Glycine max LCAT4 (GmLCAT4),twenty-
seven EST cDNA clones showing strong ho mology with
AtLCAT4 and coming f rom the same gene have been
reported in TIGR databases. A nucleotide sequence
(TC192038) originating from the superimposition of these
clones has also been given. A polypeptide sequence of
536 a mino acids having 65% identity with AtLCAT4 and

79% identity with MtLCAT4 has been deduced after
conceptual translation.
Site-directed mutagenesis on
FLAG
-tagged
AtLCAT3
The m utated alleles of FLAG-AtLCAT3 were obtained b y
introducing point mutations in the DNA sequence as
follows: two separate PCR reactions were performed with
 20 ng of the pBluescript vector containing the ORF of
AtLCAT3. The first reaction was carried out with the d irect
primer 358 (Table 1) and a reverse primer introducing the
chosen mutation. The s econd PCR was performed w ith a
sense primer, co mplementary to t he antisense primer
introducing t he mutation, and primer 359 (Table 1). After
phenol/chloroform extraction, precipitation of the amplified
fragments with 3
M
NaCl and purification from agarose
(Nucleospin Extract purification kit), t he two fragments
were hybridized due to the overlapping regions from the
direct primer and the one introducing t he mutation. The
hybridization was carried out in a final volume of 20 lLin
the presence of PCR buffer ( 2 lL) (2 min at 100°C, 20 min
at 42°C, and 1 0 min at room temperature). Finally, a PCR
on 1 lL of the hybridization m ix using primers 358 and 359
allowed the synthesis of the mutated ORF of FLAG-
AtLCAT3. Amplifications of DNA fragments were per-
formed using High Fidelity PCR Master DNA polyme rase
(Boehringer) in a final v olume o f 5 0 lL. Amplification was

5minat92°C, followed by 29 cycles of 30 s at 95 °C, 30 s
at 52 °C, 2 min at 72 °C,andthena10minelongation
at 72 °C.
Nucleotide sequence d etermination was performed as
described previously [30].
Transformation of yeast
Transformation was performed according to [30] with some
modifications. After the heat shock at 4 2 °C the cells were
centrifuged, resuspended in 2% (w/v) glucose (100 lL) and
plated on minimum medium containing suitable supple-
ments (50 lgÆmL
)1
each).
Lipid analysis
Steryl esters (SEs), free sterols (FSs) and TAGs (for
colorimetric quantification) were extracted from freeze-dried
yeast cells and analyse d as d escribed previously [30]. T he
complete lipid analysis of control and transformed yeast was
performed as described previously [34] except that the
chloroform extracts of the fresh cell pellets were shared for
separate TLCs of neutral lipids in hexane/diethylether/acetic
acid (70 : 30 : 1 , v /v/v) a nd polar lipids i n c hloroform/
methanol/acetic acid/water (85 : 15 : 10 : 3.5, v/v/v/v).
Subcellular fractionation
Yeasts were grown for 3 d ays in 100 mL glucose minimum
medium followed b y 16 h in 200 mL galacto se complete
medium (see above). The harvested cells were then disrupted
in 0.1
M
Tris/HCl pH 7.5 c ontaining 0.6

M
sorbitol, 1 m
M
EDTA and 0.5% (w/v) BSA, in the p resence of glass beads
(0.45–0.50 mm diameter) by vigorous hand shaking accord-
ing to Pompon et al. [35]. The homogenate was centrifuged
for 10 m in at 12 000 g and the supernatant for 60 min at
100 000 g. The microsomal pellet was resuspended (2–5 mg
proteinÆmL
)1
)in0.1
M
Tris/HCl pH 7. Microsomal sus-
pensions and supernatant samples were kept at )80 °Cfor
several months without significant loss of activity.
Proteins were quantified as before [30]. Western blots o f
microsomes (50 lg p rotein) and supernatant (5 lL) from
FLAG-AtLCAT3-transformed yeast were achieved after
SDS/PAGE, e lectrotransfer to a n ylon membrane (Immo-
bilon-P; Millipore) and immunoblotting with the a nti-
FLAG M2 mAb from Sigma.
Ó FEBS 2004 A. thaliana cDNA encoding a novel phospholipase A1 (Eur. J. Biochem. 271) 3755
Enzymatic assays
Sterol acyltransferase. Sterol acyltransf erase a ssays were
carried out with [4-
14
C]cholesterol according t o [36].
Lecithin cholesterol acyltransferase. LCAT assays inclu-
ded either [ 4-
14

C]cholesterol or di-[1-
14
C]oleylPC under
various conditions [36–38].
Phospholipid diacylglycerol acyltransferase (PDAT).
Assays were performed according to [34].
PLA1 assay. PLA1 activity was fi rst observed when
performing LCAT or PDAT assays. The conditions were
then adjusted so that the phospholipase a c tivity was
proportional t o protein concentration and time and opti-
mized with respect to the s ubstrate and detergent c oncen-
trations, while the reaction yield was k ept below 20%: the
microsomal preparation (0.125 m g proteinÆmL
)1
)wasincu-
bated with [1-
14
C]acyl-labelled PC (250 l
M
and usually
15 nCi) and Triton X -100 (0.15%) in 0.1
M
Tris/HCl pH 7
(final volume, 100 lL) usually for 30 min at 30 °C. The
reaction was stopped by adding a mixture of methylene
chloride (400 lL) and m ethanol (100 lL) containing oleic
or palmitic acid, soybean PC and e gg lysoPC (50 lgeach)
as car riers. After further addition of 0.03 N H Cl (100 lL)
and m ethylene chloride (600 lL), the organic phase was
withdrawn and the water phase was extracted twice m ore

with methylene chloride. The lipidic extract was separ-
ated by TLC in chloroform/methanol/water/acetic acid
(65 : 25 : 4 : 1; v/v/v/v) a nd the radioactive bands of free
FA (R
f
¼ 0.9), PC (R
f
¼ 0.4) and lysoPC (R
f
¼ 0.2 ) were
detected with an automatic TLC-linear analyser (Berthold),
and scraped from the plate for liquid scintillation counting.
A large-scale PLA1 assay was set u p f or GLC and
GLC/MS. The incubation mixture (1 m L) had the same
composition as described above except t hat unlabelled
1-myristoyl, 2-oleylPC or various dioleylphospholipids
was used. After purification, the free FA and lysoPC
fractions were converted to their fatty acid methyl ester
(FAME) deriva tive s. Fat ty acids w ere m ethylated by
10% boron trifluoride/m ethanol (Fluka), according t o
Morrison and Smith [39] whereas LPC was transmethy-
lated by 0 .5
M
sodium methoxide/methanol (Supelco).
Special care was taken to avoid loss of myristoyl
methylester as advised by Christie [40]. T he resulting
FAMEs were extracted in hexane then identified and
quantified by GLC on a DB-1 capillary column,
according to their relative retention time and peak area
to the internal standard heptadecanoic acid m ethylester.

The GLC temperature program was from 60 °Cto
120 °C, 20 °CÆmin
)1
, from 120 °C t o 200 °C, 2 °CÆmin
)1
and f rom 2 00 °Cto280°C, 20 °CÆmin
)1
. I dentification
of FAMEs was confirmed by their mass spectra.
AcylCoA synthase. The AcylCoA synthase assay was
carried out according to [41].
Glycerol-3-phosphate acyltransferase. The glycerol-3-
phosphate acyltransferase (G3PAT) assay was carried out
as described previously [42] but 0.1
M
Tris/HCl, pH 7 , was
used instead of 0.25
M
HEPES, pH 8.
Lysophosphatidic acid acyltransferase. The lysophospha-
tidic acid acyltransferase (LPAAT) assay was d erive d
from Bourgis et al. [43] with the following modifications:
the [1-
14
C]oleylCoA concentration was 100 l
M
instead of
10 l
M
, the lysophosp hatidic acid concen tration was 100 l

M
and not 55 l
M
, the Tris/HCl was pH 7 instead of 8 and
phosphatidic acid (20 l
M
) was added.
For all of assays mentioned a bove, the extraction and
TLC procedures were as described for PLA1.
HMGCoA reductase assay. This activity was tested and
analysed as described previously [44].
Results
Cloning of plant homologues of the
Homo sapiens
lecithin cholesterol acyltransferase
During a search for plant genes encoding enzymes involved
in sterol esterification by FA, we noticed A. thaliana EST
clones presenting homology with HsLCAT, the human gene
encoding LCAT. This enzyme catalyses the t ransfer of a FA
from PC to cholesterol in the blood. Our search led to the
identification of four genes w hich were named AtLCA T1,
AtLCAT2, AtLCAT3 and AtLCAT4 (At1g27480,
At1g04010, At3g03310, At4g19860, respectively). In addi-
tion two genes presenting homology with the recently
discovered gene of phosphatidylcholine diacylglycerol acyl-
transferase from Saccharomyces cerevisiae (ScPDAT)
[34,45] were found and n amed AtPDAT1 and AtPDAT2
(At5g13640, At3g44830), t he first of which has been recently
cloned and shown to encode indeed a PDAT [46,47]. These
EST cDNA clones allowed the isolation and se quencing of

cDNAs corresponding to AtLCAT1, 2, 3 and 4.Allthese
cDNAs encompassed the coding region.
A more extensive search of orthologues of the
A. thaliana LCAT genes in various plants has been possible
through use of TIG R (The Institute for Genomic
Research, ) d atabases (Lactuca sativa
LCAT1, Glycine max LCAT3 and LCAT4, Medicago
truncatula LCAT2 an d LCAT4 ) a nd thanks to cloning
work performed in our laboratory (Medicago truncatula
LCAT1, Nicotiana tabacum and Mesembryanthemum
crystallinum LCAT3, Lycopersicum esculentum LCAT4).
A phylogenetic tree was constructed for several p lant,
animal, fungal and b acterial LCAT-like proteins w hich
was rooted with the bacterial Bacillus licheniformis
esterase as outgroup (Fig. 1).
According to this tree the so-named plant LCATs are
clearly divided into five subfamilies. The L CAT1 subfamily
is the closest to mammalian and avian authentic LCATs. It
is worthy of interest that very close t o the mammalian
LCATs, one can find proteins such as Bos taurus
phospholipid ceramide acyltransferas e (PLCAT) or Homo
sapiens LCAT-like l ysophospholipase (LLPL) which h ave
both b een shown recently t o possess phospholipase A2
activity and to catalyse in vitro the transfer o f a FA group
from position 2 of a phospholipid to ceramide [48]. The
LCAT3 and LCAT4 form two cle arly distinc t subfamilies
which are more distant f rom the mammalian L CATs than
the LCAT1 subfamily, but which are closer to the
B. licheniformis ester ase. T he plant L CAT2 subfamily
3756 A. Noiriel et al. (Eur. J. Biochem. 271) Ó FEBS 2004

appears a lso more d istant from the mammalian and avian
LCATs than the plant LCAT1 but close t o the plant PDAT
subfamily which groups with the yeast PDATs.
The deduced protein sequences of all of these LCAT-like
genes were aligned and several highly conserved regions
were shown (Fig. 2). They include the regions around the
three essential amino acids of HsLCAT which form the
catalytic triad common with all the Ser hydrolases.
In order to determine the functions of the products of the
AtLCAT genes their expression in yeast was undertaken.
The cDNA coding regions of AtLCAT1 , 3 and 4 were
inserted into the yeast expression vector pYeDP 60. So far,
the expression studies of AtLCAT1 and 4 in yeast has not
allowed their function to be determined. The functional
expression of AtLCAT2 was performed independently in
A. tha liana. The encoded protein was shown to be a
phospholipid sterol acyltransferase [ 48a,48b]. We report
hereafter the characterization of the AtLCAT3-encoded
protein.
Expression of
AtLCAT3
in various yeast strains
Because AtLCAT3 was potentially encoding a sterol
acyltransferase, it was first expressed in the yeast mutant
are1are2 defective in sterol acyltransferase genes. In this
mutant, sterol ester biosynthesis is absent [49] and micro-
somes from this strain lack s terol acyltransferase activity
[50].
The neutral lipid content of the transformed yeast was
compared to the control (void plasmid-transformed) yeast.

Surprisingly the expression of AtLCAT3 resulted in the
doubling o f the yeast TAG (Fig. 3) a nd FS contents
whereas t he SE content r emained unchanged (data not
shown).
Incubation of di-[1-
14
C]oleyl PC with microsomes from
AtLCAT3- or void plasmid-transformed are1are2,inthe
presence of cholesterol or dioleylglycerol, did not show any
measurable acyltransferase activity but resulted in a high
hydrolysis of PC into lysoPC (LPC) a nd FAs for micro-
somes f rom the transformed yeast, whereas the c ontrol
microsomes produced only a low hydrolysis of PC.
Considering the increase in TAG content of are1are2
when transformed with AtLCAT3, we wondered whether
AtLCAT3 might be involved in plant TAG synthesis.
Because TAG synthesis in y east is performed by several
enzymes, mainly by diacylglycerol : acylCoA acyltrans-
ferase (DGAT), partly by PDAT a nd a litt le by ARE1
and ARE2 [ 51–53], we transformed t he corresponding
mutants dga1 and lro1 and the wild-type strain with
AtLCAT3. Whereas AtLCAT3 -transformed wild-type and
lro1 strainsaswellasare1are2 had a doubled TAG content
compared to that of the c orresponding control strain,
transformation of the dga1 mutant did n ot produce any
change (Fig. 3). These results clearly show that the y east
DGAT is involved i n the observed T AG increase and
consequently that AtLCAT3 is not directly implicated.
Next, m icrosomes from t hese three transformed (and
control) strains were prepared and tested with di-[1-

14
C]
oleyl PC: for e ach AtLCAT3-transformed s train inclu ding
dga1, the PC acylhydrolase activity was much higher
(10–100 times a ccording to the assay conditions) than that
of the control microsomes.
Fig. 1. Phylogenetic t ree showing LCAT-like proteins. The phylogenic
tree was c onstructed for several plant, animal, f ungal a nd bac terial
LCAT-like proteins. BlESTER (B. licheniformis esterase U35855);
AtLCAT4 (Arabidopsis thaliana AF421149, comes from At4g19860);
LeLCAT4 (Lycopersicum esculentum AF465780); GmLCAT4 (Glycine
max TC192038); MtLCAT4 (Medicago truncatula TC8624 7);
McLCAT3 (Mesembryanthemum crystallinum EST, BE131533);
GmLCAT3 (G. max EST, TC200937); AtLCAT3 (A. thaliana phos-
pholipase A1, AF42 1148, comes from At3g03310); NtLCAT3
(Nicotiana t abacum phospholipase A1, AF468223); C eLCAT
(Caenorhabditis elegans NP_492033); BtPLCAT (Bos taurus phos-
pholipid ceramide acyltransferase NP_776985); HsLLPL (Homo
sapiens LCAT-lik e lysophospholipase NP _036452); GgLCAT (Gallus
gallus lecithin cholesterol acyltransferase P53760); MmLCAT (Mus
musculus NP_032516); HsLCAT (H. sa piens NP_000220); O cLCAT
(Oryctophagum c ommunis P53761); AgLCAT (Anopheles g ambiae
XP_319740); DmLCAT (Drosophila melanogaster AF145599);
AtLCAT1 (A. thaliana AY443040, comes from At1g27480);
LsLCAT1 (Lactuca sativa EST BQ864610); MtLCAT1 (M. truncatula
AF533771); AtLCAT2 (A. thaliana N P_171897, comes from
At1g04010); MtLCAT2 ( M. truncatula AF493159); AtPDAT2
(A. thaliana NP_190069, c o mes f rom At3g44830); AtPDAT1
(A. thaliana AY160110, comes from At5g13640); MtPDAT1
(M. truncatula AY210981); ScPDAT (Saccharomyces cerevisiae

phospholipid diacylglycerol acyltransferase P40345); SpPDAT
(Schizoaccharomyces pombe phospholipid diacylglycerol acyltrans-
ferase O94680). Accession numbers beginning by AF and AY corres-
pond to products which have been cloned and/or characterized in our
laboratory. The phylogenetic tree has been rooted with BlESTER as the
outgroup. Num be rs a t the nodes of the phylogenetic tree arebootstraps,
indicating the frequencies of occurre nce of partitions found in the tree.
Ó FEBS 2004 A. thaliana cDNA encoding a novel phospholipase A1 (Eur. J. Biochem. 271) 3757
Expression of
AtLCAT3
in wild-type yeast: lipid analysis
For a complete study of the effects of AtLCAT3 tra nsfor-
mation on the yeast lipid conte nt, the neutral and polar lipid
contents of AtLCAT3-transformed wild-type y east were
compared to those of t he control yeast by mean of GLC
analysis of the FAMEs generated from these fractions
(Fig. 4 ). The PC, phosphatidylethanolamine ( PE) and
phosphatidylserine (PS) contents of the AtLCAT3-trans-
formed yeast were found to be half those of the control yeast
while LPC, lysophosphatidylethanolamine (LPE) and free
FA were strongly increased. The increase in TAG that we
first measured by colorimetry (Fig. 3) was c learly con-
firmed, although to a lesser e xtent, by this GLC analysis.
Finally the total FA content was slightly (by 16%) but
significantly increased i n the AtLC AT3-transformed yeast
and t he amount of overproduced total FA (24 nmÆmg dry
weight
)1
) corresponds roughly to the overproduced TAG
(19.5 n mÆmg dry w eight

)1
) (Fig. 4). In t he same analysis,
steryl esters, diacylglycerol, phosphatidylinositol, cardio-
lipin and lysophosphatidic acid were shown not to be
changed significantly (data not shown).
Expression of
AtLCAT3
in wild-type yeast: enzyme
characterization
As mentioned above, incubation of d i-[1-
14
C]oleyl PC with
microsomes from various AtLCAT3 -transformed yeast
strains yielded h igh labelling o f the free FA and LPC
fractions whereas the control microsomes produced a much
weaker hydrolysis of PC. A fter optimization of t his PC
acylhydrolase assay with microsomes f rom AtLCAT3-
transformed and control wild-type yeast (see Experimental
procedures), the yields of PC hydrolysis amounted to
around 15% and 0.5%, respectively (Table 2), correspond-
ing to PC acylhydrolase specific activities of around 600 and
20 nmoles Æmg protein
)1
Æh
)1
, respectively.
When this di-[1-
14
C]oleyl PC was incubated with m icro-
somes from AtLCAT3-transformed yeast, the free FA and

LPC fractions were labelled equally (Table 3). To study the
positional specificity of AtLCAT3 toward s the two a cyl
groups of PC, th ese microsomes were incubated with sn-1-
or sn-2-specifically labelled dioleylPC or 1-palmitoyl, 2-oleyl
Fig. 2. Alignment of the deduced aminoacid sequences of LCAT-like cDNAs. Five highly conserved regions are shown. T he conserved amino acids
are boxed. The Ser177, Asp384 and His409 residues of AtLCAT3 corresponding to the catalytic triad of HsLCAT are indicated by a triangle, as
well as two other residues (Tyr346 and Thr352) of AtLCAT3 which have been mutated.
Fig. 3. TAG conten t of var ious control and AtLCAT3-transformed
yeast strains. TAGs were extracted from f reez e-dried cells (at least two
clones per strain), purified by TLC and quantified threefold by t he
colorimetric assay d escribed in the exp erimental section. Deviation
from the mean was less than 12.5%. White bars, void- plasmid-trans-
formed strains; black bars, AtLCAT3-transformed strains.
3758 A. Noiriel et al. (Eur. J. Biochem. 271) Ó FEBS 2004
PC (Table 3). The distribution of radioactivity between the
free FA and the LPC fractions indicates for AtLCAT3 a
selectivity for the sn-1 position of a bout 90% with dioleylPC
and 85% with 1-palmitoyl, 2-oleyl PC. The sn-1 specificity
of AtLCAT3 was also st udied by GLC analysis o f the FA
and LPC released during t he incubation of 1-myristoyl,
2-oleyl PC ( Fig. 5): myristic acid a ccumulated almost
exclusively i n the free FA fraction and oleic acid in the
LPC fraction. Therefore w ith 1-myristoyl, 2-oleyl PC, the
selectivity of AtLCAT3 for the sn-1 position is almost 100%.
Dioleyl phosphatidylethano lamine a nd dioleyl phos-
phatidic acid as well as 1-oleyl LPC were compared to
dioleyl PC as s ubstrates. GLC determination of the released
oleic a cid showed that phosphatidylethan olamine, phos-
phatidic acid and LPC hydrolysis amounted to 50, 40 a nd
8%, respectively, that of PC (Fig. 6). On the other hand,

incubations of tri-[1-
14
C]palmitoyl g lycerol o r [ 2,3-
3
H]
cholesteryl oleate d id not produce a ny labelled p almitic
acid or cholesterol, respectively, excluding fo r AtLCAT3 a
TAG lipase or steryl ester hydrolase activity (Table 2).
Finally, using the optimized as say conditions for the
phospholipid acylhydrolase activity of AtLCAT3, we
looked again for a potential acyltransferase activity for this
protein. Sterols and dioleylglycerol were added to the
incubation mixture b ut this did not disclose any LCAT or
PDAT activity. A s AtLCAT3 (a) does not show any
acyltransferase activity, (b) does not show any acylhydrolase
activity towards TAG or cholesteryl ester, and (c) h ydro-
lyses PC specifically at the sn-1 position and hydrolyses
other phospholipids, it is most probably a PLA1.
Its pH optimum was carefully determined with either
1,2-di-[1-
14
C]oleyl PC or 1-palmitoyl, 2-[1-
14
C]oleyl PC: the
activity curve has a maximum at p H 6–6.5. Its optima l
incubation temperature was surprisingly shown to b e
60–65 °C and its activity was unaffected by 0.1, 1 or
10 m
M
Ca

2+
, under our assay conditions.
The distribution of AtLCAT3 between the microsomal
and 100 000 g supernatant subfractions fr om the trans-
formed yeast was determined by comparing t heir total
activities. They were in a ratio of 84 : 16 indicating that
most of this protein is associated with the microsomal
Table 2. Hydrolase a ctivity t owards various lipids of m icrosomes from
control and AtLCAT3-transformed wild-type yeast. Microsomal prep -
arations from AtLCAT3-transformed and control wild-type yeast
(0.125 mgÆmL
)1
) were incub ated with variou s lipids (250 l
M
)inthe
presence of 0.15% (v/v)Triton X-100 for 30 min. Lipids were extracted
and separated by TLC. The radioactivity of the products was meas-
ured by liquid scintillation. Values are the mean of duplicates a nd
experiments were repeated at least twice.
Substrates
Percentage of substrate
hydrolysis with microsomes
from
Void plasmid-
transformed
WT yeast
AtLCAT3-
transformed
WT yeast
Tri-[1-14C]palmitoylglycerol

a
0.0 0.0
[1a,2a(n)3H]Cholesteryl oleate
a
0.0 0.0
[1–14C]Acyl PC
b
0.5 15.0
a
Tripamitoylglycerol and cholesteryl oleate were assayed in the
presence of either 0.03 or 0.15% Triton X-100.
b
The values for
labelled PC are a mean of the incubations presented in Table 3 and
the corresponding controls.
Table 3. Positional specificity of the phospholipid acylhydrolase activity
of AtLCAT3: hydrolysis of spe cifically labelled PCs. Micr osomal
preparations from AtLCAT3-transformed wild-type yeast
(0.125 mgÆmL
)1
) were incubated with various PCs (250 l
M
)inthe
presence o f 0.15% (v/v) Triton X-100 for 15 min. For further details
see Table 3 legend.
Substrates
Relative labelling (%) in
Free fatty
acid fraction
LPC

fraction
1,2-Di[1-
14
C]oleyl PC 52 48
1-[1-
14
C]Oleyl,2-oleyl PC 91 9
1-Oleyl,2-[1-
14
C]oleyl PC 11 89
1-[1-
14
C]Palmitoyl,2-oleyl PC 86 14
1-Palmitoyl,2-[1-
14
C]oleyl PC 16 84
Fig. 4. Complete lipid analysis of c ontrol and AtLCAT3-transformed
wild-type yeast. F AMEs from ind ividual and total lipids were analysed
by GLC. The cultures and analyses were carried out in triplicate.
Standard deviation was less than 2% in analyses of total fatty acids
(TFA) content and less than 15% in analyses of individual lipid classes.
FA, free fatty acids.
Ó FEBS 2004 A. thaliana cDNA encoding a novel phospholipase A1 (Eur. J. Biochem. 271) 3759
membranes, in agreement with a Western blot analysis using
microsomes and supernatant from the FLAG-AtLCAT3-
transformed yeast (data not shown).
Finally the involvement of Ser177, Asp384 and His409 in
the c atalysis, by analogy with the conserved catalytic triad
of HsLCAT (Fig. 2), was checked by directed mutagenesis.
Indeed the point mutations S177A, D384A or H409L

resulted in the disappearance of PLA1 act ivity and of the
associated TAG production, although the mutated p roteins
were produced in similar amounts as AtLCAT3, as
estimated by Western blots of these FLAG-tagged proteins
in the respective microsomes. For comparison, Y346F and
T352A mutations resulted in a decrease but not the
suppression of PLA1 activity and T AG production
(Fig. 7 ) although these amino a cids are also i nvariant
(Fig. 2 ).
Expression of
AtLCAT3
in wild-type yeast: consequences
on yeast lipid metabolism
In an attempt to relate phospholipid hydrolysis and T AG
synthesis, [1-
14
C]oleicacidwasincubatedwith12000g
supernatants from A tLCAT3-transformed and control
wild-type yeast, under acylCoA synthase assay conditions
(see Experimental procedures). In fact the labelling of TAGs
in the cell-free extract of the transformed yeast was half that
of the control yeast, whereas labelling of PC and other
Fig. 6. Substrate specificity of AtLCAT3 towards various phospho-
lipids. Af ter incubation of dioleylPC (DOPC), dioleylphosphatidyl-
ethanolamine (DOPE), dioleylphosphatidic acid (DOPA) an d
oleyllysoPC (OLPC) for 30 min with AtLCAT3-transformed wild-type
yeast microsomes, the free FA fraction w as analysed by GLC of the
FAMEs. The values found for the corresponding zero time and t he
blank incubated wi thout exogenous substrate were deduced. Results
arefromduplicateexperiments.

Fig. 7. Expression of several FLAG-tagged alleles of At LCAT3 in wild-
type yeast. Control, void plasmid-transformed yeast; F -Asp384Ala,
F-Tyr346Phe, F-His409Leu, F-Ser177Ala, F-Thr352Ala, yeast strains
transformed with FLAG-tagged and m utated alleles of AtLCAT3.
AtLCAT3 and F-AtLCAT3, non tagged and FL AG-tagged
AtLCAT3-transforme d yeast. (A) Western analysis. Microsomes
(50 lg protein) w ere resolved by S DS/PAGE and proteins were
immunoblotted with a n anti-FLAG serum. The mass of 46 kDa cor-
responds to the expected mass for AtLCAT3. (B) Microsomal PLA1
activity and (C) TAG c ontent (colorimetric determination) of these
strains relative to those from AtLCAT3. Analyses were performed in
duplicate on two clones pe r strain. Deviation from the mean was less
than 12.5%.
Fig. 5. Phospholipid acylhydrolase activity of AtLCAT3 towards
1-myristoyl, 2-oleyl PC. After incubation of this PC (250 l
M
)with
AtLCAT3-transformed wild -type yeast mic rosomes (0.125 mgÆmL
)1
)
in 1 mL for the indicated times, the amounts of myristic and oleic acids
in the free FA (FFA) and lysoPC (LPC) fractions were determined by
GLC analysis of their FAMEs. T he values found for the corres-
ponding blanks incub ated without exogenou s substrate were deduced.
Results are from duplicate experiments.
3760 A. Noiriel et al. (Eur. J. Biochem. 271) Ó FEBS 2004
phospholipids was increased by a factor of three-to-four.
The lab elling of phospholipids was similarly increased
when microsomes from these yeasts w ere incubated
with [1-

14
C]oleylCoA in the presence of either glycerol
3-phosphate (G3PAT assay) or lysophosphatidic acid
(LPAAT assay). These results suggest that in AtLCAT3-
transformed yeast, t he FAs a nd lysophospholipid s released
by AtLCAT3 are recycled into the phospholipid pool.
As the FS content was doubled in AtLCAT3-transformed
yeast, the H MGCoA reductase activities of microsomes
from transformed a nd control w ild-type yeast were com-
pared. This early and rate-limiting enzyme of the sterol
biosynthesis pathway w as indeed stimulated by a factor of
2.8, suggesting a coregulation with the phospholipid
biosynthesis to fit the modified phospholipid content and
composition (Fig. 4).
In any case the strong depletion in t he phospholipid
content of AtLCAT3-transformedyeastaswellasthe
increased l evel of lysophospholipids and free FAs do not
seem to be deleterious to this yeast because it grew as well as
the c ontrol yeast in terms o f cell mass. However a
microscopic observation showed that the t ransformed cells
had a smaller average diameter, a thicker cell wall a nd
contained more oil bodies (Fig. 8).
Discussion
This study describes the characterization of the A. thaliana
gene AtLCAT3 (At3g03310) which encodes a protein of
46 kDa sharing 25% i dentity with human LCAT
(HsLCAT) and 23% identity with yeast phospholipid
diacylglycerol acyltransferase (ScPDAT). Its expression in
yeast, followed by various in vitro studies, clearly demon-
strated that AtLCAT3 encodes a PLA1 (Tables 2 and 3,

Figs 3–6). Subcellular fractionation indicated that
AtLCAT3 is mainly associated with the microsomal frac-
tion. This result is puz zling as the amino acid sequenc e o f
AtLCAT3 does not contain any membrane-spanning
domain. However no a ttempts were m ade to wash the
microsomes: the protein m ight be only adsorbed or weakly
bound to the microsomal membranes.
The comparison o f the lipid content of AtLCAT3 -
transformed y east and that of the void plasmid-transformed
yeast showed a decrease (by a factor 2 ) of t he PC, PE and PS
contents and a strong increase of the free FAs, LPC and LPE
levels (Fig. 4 ), in accordance with the phospholipid acyl-
hydrolase activity shown for AtLCAT3. The decrease in PS
suggests that this phospholipid would be another substrate
for AtLCAT3, together with PC and PE, whereas phospha-
tidylinositol, the level of which was not significantly altered,
would not be substrate. Interestingly, the FA composition of
the PC and PE from the AtLCAT3-transformed yeast
diverge significantly from those of the control yeast (Fig. 4),
suggesting for AtLCAT3 a preference for unsatured FAs. If
such a selectivity for unsatured FAs at the sn-1 position was
confirmed in vitro for A tLCAT3, it could indicate a role in
phospholipid remodelling for this novel PLA1.
Moreover, the lipid analyses showed an increase of the
total FA c ontent in the AtLCAT3-transformed yeast
together w ith an increase of the T AG content of the yeast
(Fig. 4 ). This last result confirms the role of yeast TAGs in
FA storage [54]. I t is noteworthy that the reverse situation
was described in a yeast mu tant where t he three genes
encoding phospholipases B had been deleted: the total

cellular phospholipid content was increased by 40%
whereas the TAG level was reduced by 50% [55].
We performed point mutations on the three conserved
amino acids known to be essential for LCATs (catalytic
triad common to all Ser hydrolases) and c onfirmed that
AtLCAT3 also requires these three amino acids to be active.
Fig. 8. Light micrographs of yeast cells after staining with Red Sudan IV. Void plasmid-transformed yeast (left) and AtLCAT3-transformed yeast
(right) in stationary phase were collected, washed with water, immersed for 30 min in the ethanolic staining so lution and rinsed with water. The
arrows indicate oil bodies. The scale b ar corresponds to 40 lm.
Ó FEBS 2004 A. thaliana cDNA encoding a novel phospholipase A1 (Eur. J. Biochem. 271) 3761
Hence hydrolysis a t i ts active site certainly follows the
well-known mechanism of Ser hydrolases [25,26,29]. This
directed mutagenesis study included two other conserved
amino acids which turned out not to be essential. Taken
together, these results underline the close relationship
between the l evel of PLA1 activity and the amount o f
accumulated TAGs ( Fig. 7). They might therefore c onsti-
tute clues to engineer yeast strains for high er productio n of
TAGs.
Finally the decrease in phospholipids, increase in free
FAs and TAGs were accompanied by an increase in the FS
content of this transformed yeast, probab ly to compensate
for the change in the phospholipid content a nd/or compo-
sition. Accordingly the HMGCoA reductase activity was
shown to be more t han doubled in microsomes from the
AtLCAT3-transformed yeast, suggesting a regulation of the
sterol metabolism in response to the phospholipid pertur-
bation.
Another gene from A. t haliana was recently shown to
encode a PLA1 [4]. Starting from the mutant dad1 defective

in anther dehiscence, pollen maturation and flower opening,
these authors isolated the corresponding DAD1 gene, studied
the function of the DAD1 protein by expression in E. coli,
showed its targeting to the chloroplast and its restricted
expression in stamen filaments. T hey su ggest that DAD1
might catalyse the initial step of j asmonic acid biosynthesis
in the filaments thus regulating the water transport in
stamens a nd petals [4]. As the amino acid sequence of
AtLCAT3 is not related at all to that of DAD1, it constitutes
a new family of plant PLA1, together with its orthologues
McLCAT3, GmLCAT3 and NtLCAT3 ( Fig. 1).
The present work has allowed the characterization of
AtLCAT3 by heterologous expression in yeast. Its current
expression in planta should allow d isclosure of the physio-
logical r ole of the encoded protein. As most of the plant
glycerolipid acylhydrolases cloned a nd characterized so far
(small PLA2s, patatin-like g lycerolipid acylhydrolases and
the PLA1 DAD1) are involved i n s ignal transduction, the
spatio-temporal expression pattern of AtLCAT3 under
normal and stress conditions will be studied.
Acknowledgements
We are especially indebted to the following scientists who kindly sent
us EST clones: Dr Erika Asamizu and N obumi K usuhara (Kazusa
DNA Research Institute, Chiba, Japan), Dr Joe A. Clouse (The
Samuel Roberts Noble Fou ndation, Inc., Ardmore, USA), Dr
Doreen Ware (ABRC, The Ohio State University, Co lumbus, USA),
Dr John C. Cushman (Departmen t of Biochemistry, University of
Nevada, Reno, U SA), Dr M aryvonne Rosseneu (Department o f
Biochemistry and Molecular Biology, University of Ghent, Belgium).
We thank also Dr Steven L. Sturley (Columbia University College of

Physicians and Surgeons, N ew York, USA) for yeast strains, Annie
Hoeft for assistance in GC-MS and Hubert Schaller for h elpful
discussions. Funding from the S wedish University of Agricultural
Science strategic research grants ÔThe Biological Factory/AgriFun-
GenÕ and Stiftelsen Svensk Oljeva
¨
xtforskning (SSO) are gratefully
acknowledged.
References
1. Wang, X. (2001) Plant phospholipases. Annu. Rev. Plant Physiol.
Plant Mol. B iol. 52, 211–231.
2. Stahl, U., Banas, A. & Stymne, S. (1995) Plant microsomal
phospholipid acyl hydrolases have selectivities for uncommon
fatty acids. Plant Physiol. 107, 953–962.
3. Tavernier, E. & Pugin, A. (1995) Phospholipase activities asso-
ciated with the ton oplast from Acer pseudoplatanus cells: iden-
tification of a phospholipase A1 activity. Biochim. Biophys. Acta
15, 118–122.
4. Ishiguro, S., K awai-Oda, A., Ueda, J., Nishida, I. & Okada, K.
(2001) The defective in anther dehiscence gene encodes a novel
phospholipase A1 cat alyzing the initial step of jasmonic acid
biosynthesis, which synchronizes pollen maturation, anther
dehiscence, and flower opening in Arabidopsis. Plant Cell 13,
191–209.
5. Paul, R .U., Ho lk, A . & Scherer, G.F.E. (1998) Fatty acids and
lysophospholipids as potential second messengers in auxin ac-
tion. Rapid ac tivation of pho spholipase A2 a ctivity by a uxin in
suspension-cultured parsley and soybean cells. Plant J. 16, 601–
611.
6. Holk, A., R ietz, S., Zahn, M., Quader, H. & Scherer,

G.F.E. (2002) Molecular identification of cytosolic, patatin-
related phospholipases A from Arabidopsis with potential
functions in p lan t signal transduction. Plant Physiol. 13 0,90–
101.
7. Lee, H.Y., B ahn, S.C., Kang, Y M., Lee, K.H., Kim, H.J., Noh,
E.K., Palta, J.P., Shin, J.S. & R yu, S .B. (2003) Secretory l ow
molecular weight phospholipase A2 plays important roles in cell
elongation and shoot gravitrop ism in A rabidopsis. Plant Cell 15,
1990–2002.
8. Chandra, S., H einstein, P.F. & Low, P.S. (1996) Activation o f
phospholipase A by plant defense elicitors. Plant Physiol. 110,
979–986.
9. Viehweger, K., Dordschbal, B. & Roos, W. (2002) Elicit or-acti-
vated phospholipase A(2) generates lysophosphatidylcholines
that mobilize the vacuolar H
+
pool for pH signaling via the
activation of Na
+
-dependent proton fluxe s. Plant Cell 14, 1509–
1525.
10. Dhondt,S.,Gouzerh,G.,Muller,A.,Legrand,M.&Heitz,T.
(2002) Spatio-temporal expre ssion of patatin-like lipid acyl
hydrolases and accumulation of jasmonates in elicitor-treated
tobacco leaves are not affected by endogenous levels of salicylic
acid. Plant J. 32, 749–762.
11. Narvaez-Vasquez, J., Florin-Christensen, J. & Ryan, C.A. (1999)
Positional specificity of a phospholipase A a ct ivity induced by
wounding, systemin, and oligosaccharide elicitors in tomato
leaves. Plant C ell 11, 2249–2260.

12. Dhondt, S., Geoffroy, P., Stelmach, B.A., Legrand, M. & Heitz,
T. (2000) Soluble phospholipase A2 activity is induced before
oxylipin accumulation in tobacco mosaic virus -infected tobacco
leaves and is contributed by p atatin-like enzymes. Plant J. 23,
431–440.
13. Ryu, S.B. (2004) Phospholipid-derived signaling mediated by
phospholipase A in plants. Trends Plant Sci. 9, 229–235.
14. Shanklin, J. & Cahoon, E.B. (1998) Desaturation and related
modifications of fatty acids. Annu. Rev. Plant Physiol. Plant Mol.
Biol. 49, 611–641.
15. Ohlrogge, J. & Browse, J. (1995) Lipid biosynthesis. Plant Cell 7,
957–970.
16. Chapman, K.D . (1998) P hospholipase activity during plant
growth and developme nt and in r esponse to en vironmental
stress. Trends Plant Sci. 3, 419–426.
17. Stahl, U., Lee, M., Sjo
¨
dahl, S., Archer, D ., Cellini, F., Ek, B.,
Iannacone,R.,MacKenzie,D.,Semeraro,L.,Tramontano,E.&
Stymne, S. (1999) Plant low-molecular-weight phospholipase
A2s (PLA2s) are structurally related to animal secretory PLA2s
and a re present as a family of isoforms in rice (Oryza sativa).
Plant Mol. B iol. 41, 481–490.
3762 A. Noiriel et al. (Eur. J. Biochem. 271) Ó FEBS 2004
18. Dennis, E.A. (1997) The growing phospholipase A2 superfamily
of signal transduction enzymes. Trends Biochem. Sci. 22, 1–2.
19. Sowka, S., W agner, S., Krebitz, M., Arija-Mad-Arif, S., Yusof,
F., K inaciyan, T., Brehler, R., Scheiner, O. & Breiteneder, H.
(1998) cDNA cloning of t he 43-kDa latex allergen Hev b 7 with
sequence similarity to patatins and its expression in th e yeast

Pichia pastoris. Eur. J. Biochem. 25 5 , 213–219.
20. Matos,A.R.,d’Arcy-Lameta,A.,Franca,M.,Petres,S.,Edel-
man, L., Kader, J., Zuily-Fodil, Y. & Pham-Thi, A.T. (2001) A
novel patatin-like g en e stimulated b y drought stress enco des a
galactolipid acyl hydrolase. FEBS Lett. 491, 188–192.
21. Andrews, D.L., B eames, B., Su mmers, M.D. & Park, W.D.
(1988) Characterization of the lipid acyl hydrolase activity of the
major po tato (Solanum tuberosum) tuber p rotein, patatin, by
cloning and abundant expression in a b aculovirus v ector. Bio-
chem. J. 252, 199–206.
22. Senda,K.,Yoshioka,H.,Doke,N.&Kawakita,K.(1996)A
cytosolic phospholipase A2 f rom p o tato tissues ap pears to be
patatin. Plant Cell Physiol. 37, 347–353.
23. Hirschberg, H.J., S im ons, J.W., Dekker, N. & Egmond , M.R.
(2001) Cloning, expression, purification and characterization of
patatin, a novel phospholipase A. Eur. J. Biochem. 268, 5037–
5044.
24. Rydel, T.J., Williams, J .M., Krieger, E., Moshiri, F., Stal lings,
W.C., Brown, S.M., Pershing, J.C., Purcell, J.P. & Alibhai, M.F.
(2003) The crystal structure, mutagenesis, and activity studies
reveal that patatin is a lipid acyl hydrolase with a Ser-Asp cata-
lytic dyad. B i och em ist ry 42, 6696–6708.
25. Brady, L., Brzozowski, A.M., Derewenda, Z.S., Dodson, E.,
Dodson, G., Tolley. S., Turkenburg, J.P., Christiansen, L., Huge-
Jensen,B.,Norskov,L.,Thim,L.&Menge,U.(1990)Aserine
protease triad forms the catalytic centre of a triacylglycerol lipase.
Nature 343, 767–770.
26. Winkler, F.K., D ’Arcy, A. & Hunziker, W. (1990) Structure of
human pancreatic lipase. Nature 343 , 771–774.
27. Kitabatake, K ., Pir an, U., Kamio, Y., Doi, Y. & Nishida, T.

(1979) Purification of human plasma lecithin: cholesterol acyl-
transferase and it s specificity towards the acyl acceptor. B ioc him.
Biophys. Acta 573, 145–154.
28. McLean, J., Fielding, C., Drayna, D., D ieplinger, H., Baer, B.,
Kohr, W., Henzel, W., Lawn, R. (1998) Cloning and expression
of human lecithin -choleste rol acyltransferase cDNA. Proc. N atl
Acad. Sci. USA 83, 2335–2339.
29. Peelman,F.,Vinaimont,N.,Verhee,A.,Vanloo,B.,Verschelde,
J.L., Labeur, C., Segure t-Mace, S., Duverger, N., H utc hinson,
G., V andekerckhove, J., Tavernier, J. & Ros seneu, M . A pro-
posed a rchitectu re for lecithin cholesterol acyl transferase
(LCAT): identification of the catalytic triad and molecular
modeling. Protein Sci. 7, 587–599.
30. Bouvier-Nave
´
,P.,Benveniste,P.,Oelkers,P.,Sturley,S.L.&
Schaller, H. (2000) Expression in yeast a nd tobacco of plant
cDNAs e ncod ing acyl CoA: diacylglycerol acyltransferase. Eur.
J. Biochem. 267, 85–96.
31. Urban, P., Werck-Reichhart, D., Teutsch, H.G., Durst, F.,
Regnier, S., Kazmaier, M. & Pompon, D. (1994) Characteriza-
tion of rec ombinant plant cinnamate 4 -hydroxylase produced
in yeast. Kinetic and spectral properties of the major plant
P450 of the phenylpropanoid pathway. Eur. J. Biochem. 222,
843–850.
32. Estruch, J.J., Crossland, L. & Goff, S.A. (1994) Plant activating
sequences: positively charged peptides a re functional as tran-
scriptional activation domains. Nucleic Acids Res. 22, 3983–3989.
33. Maillot-Vernier, P ., Gondet, L., Sc haller, H., Benveniste, P. &
Belliard, G. (1991) Genetic s tudy and f urther biochemical char-

acterization of a tobacco mutant that overproduce s sterols. Mol.
Gen. Genet. 231, 33–40.
34. Dahlqvist, A., Stahl, U., Lenman, M., Banas, A., Lee, M.,
Sandager, L., Ronne, H. & S tymne, S. (2000) Phospholip id:
diacylglycerol acyltransferase: an enzyme that catalyzes the acyl-
CoA-independent formation of triacylglycerol in yeast and
plants. Proc. Natl Acad. Sci. USA 97, 6487–6492.
35. Pompon, D., Louerat, B., Bronine, A. & Urban, P. (1996) Yeast
expression of an imal and plant P450s in optimized redox
environments. Methods Enzymol. 272, 51–64.
36. Bouvier-Nave
´
, P. & Benveniste, P. (1995) Sterol acyl transferase
and steryl ester hydrolase a ctivit ies in a tobacco mutant which
overproduces sterols. Plant Sci. 110, 11–19.
37. Aron, L ., Jones, S. & Fielding, C.J. (1978) Human p lasma
lecithin-cholesterol acyltransferase. Characterization of cofactor-
dependent phospholipase activity. J. Biol. Chem. 253, 7220–
7226.
38. Buckley, J.T. (1982) Substrate specificity of bacterial glycero-
phospholipid: cholesterol acyltransferase. Biochemistry 21, 6699–
6703.
39. Morrison, W.R. & S mith, L.M. (1964) Fatty acid methyl esters
preparation. J. Lip id Res. 5, 600–608.
40. Christie, W .W. ( 1993) Preparation of e ster derivatives of fatty
acids for chromatographic analysis. In Advances in Lipid
Methodology – II (Christie, W.W., ed.), pp. 69–111. Oily Press,
Dundee.
41. Faergeman,N.J.,Black,P.N.,Zhao,X.D.,Knusen,J.&Di
Russo, C.C. (2001) The acyl-CoA syntheta ses enc oded w ithin

FAA1 and FAA4 in Saccharomyces cerevisiae function as
components of the fatty acid transport s ystem linking import,
activation, and i n tracellular utilization. J. Biol. Chem. 276,
37051–37059.
42. Hayman, M.W., Fawcett, T. & Slabas, A.R. (2002) Kinetic
mechanism and order of substrate binding for sn-glycerol-3-
phosphate acyltransferase from squash (Cucurbita moschata).
FEBS Lett. 514, 281–284.
43. Bourgis, F ., Kad er, J C., Barret, P., Renard, M., Robinson, D.,
Robinson, C., D elseny, M. & Roscoe, T.J. (1 9 99) A p lastidia l
lysophosphatidic acid acyltransferase from oilseed rape. Plant
Physiol. 120, 913–921.
44. Bach, T.J., Rogers, D.H. & Rudney, H. (1986) Detergent-solu-
bilization, purification, and characterization o f membrane-
bound 3-hydroxy-3-methylglutaryl-coenz yme A reductase from
radish seed lin gs. Eur. J. Biochem. 154, 103–111.
45. Oelkers, P., Tinkelenberg, A., Erdeniz, N., Cromley, D., Bill-
heimer, J .T. & Sturley, S.L. (2000) A lecithin cholesterol ac yl-
transferase-like gene mediates diacylglycerol esterification in
yeast. J. Biol. Chem. 275, 15609–15612.
46.Banas,A.,Lenman,M.,Dahlqvist,A.&Stymne,S.(2003)
Cloning and charac terization of a phospholipid: diacylglycerol
acyltransferase from Arabidopsis thaliana.InAdvanced Research
on Plant Lipids (Murata, N., Yamada, M., Nishida, I., Okuyama,
H., Sekiya, J . & Hajime, W., e ds), pp. 179–182. Kluwer Aca-
demic Publications, Dordrecht.
47. Stahl, U., Carlsson, A.S., Lenman, M., Dahlqvist, A., Huang, B.,
Banas,W.,Banas,A.&Stymne,S.(2004)Cloningand
functional characterization of a phospholipid: diacylglycerol
acyltransferase from Ar abidops is. Plant Physiol. 135, 1324 –

1335.
48. Hiraoka, M., Abe, A. & Shayman, J.A. (2002) Cloning and
characterization o f a lysosomal phospholipase A 2, 1-O-acylcer-
amide synthase. J. Biol. Chem. 277, 10090–10099.
48a. Banas, A., Carlsson, A., Huang, B., Noiriel, A., Benveniste, P.,
Schaller, H., Bouvier-Nave
´
, P. & Stym ne, S. (2004) Enzymatic
properties o f an A. thalia na phospholipid: sterol acyltransferase
(pp. 70). 16th International Plant Lipid Symposium, Budapest,
Hungary, 1–4 June 2004. Abstract book at e.
mtesz.hu/pls/
Ó FEBS 2004 A. thaliana cDNA encoding a novel phospholipase A1 (Eur. J. Biochem. 271) 3763
48b . No iriel, A., Benveniste, P., Schaller, H., Bouvier-Nave
´
,P.,Banas,
A.,Carlsson,A.,Huang,B.&Stymne,S.(2004)Functional
study of an A. thaliana LCAT-like cDNA e ncoding a phospho-
lipid: sterol a cyltransferase:sterylesterprofilesofA. thaliana
overexpressers and T-DNA insertion m utants (pp. 105). 16th
International Plant Lipid Sympo sium, Budapest, Hu ngary, 1–4
June 2004. A bstract book at />49. Yang,H.,Bard,M.,Bruner,D.A., Gleeson, A., Deckelbaum,
R.J., Aljinovic, G., P ohl, T .M., Rothstein, R. & Sturley, S.L.
(1996) Sterol esterification in yeast: a two-gene process. Science
272, 1353–1356.
50. Yang, H., Cromley, D., Wang, H., B illheimer, J.T. & Sturley,
S.L. (1 997) Functional expression of a cDNA to human ac yl-
coenzyme A: cholesterol acyltransferase in yea st. Specie s-depen-
dent substrate specific ity and inhibitor sensitivity. J. Biol. Chem.
272, 3980–3985.

51. Sorger, D. & Daum, G. (2002) Synthesis of triacylglycerols by the
acyl-coenzyme A: diacyl-glycerol acyltransferase Dga1p in lipid
particles of the yeast Saccharomyces cerevisiae. J. Bacteriol. 184,
519–524.
52.Sandager,L.,Gustavsson,M.H.,Stahl,U.,Dahlqvist,A.,
Wiberg, E., Banas, A., Lenman, M., Ro nne, H. & St ymne, S.
(2002) Storage lipid synthesis i s non-essential in ye ast. J. Biol.
Chem. 277, 6478–6482.
53. Oelkers, P., Cromley, D., Padamsee, M ., Billheimer, J.T. &
Sturley, S.L. (2002) The DGA1 gene d etermines a sec ond tri-
glyceride synthetic pathway in yeast. J. Biol. Chem. 277, 8877–
8881.
54. Sorger, D. & Daum, G. (2003) Triacylglycerol biosynthesis i n
yeast. Appl. Microbiol. Biotechnol. 61, 289–299.
55.Merkel,O.,Fido,M.,Mayr,J.A.,Pruger,H.,Raab,F.,
Zandonella, G., Kohlwein, S.D. & Paltauf, F. (1999) Char-
acterization and function in vivo of two novel phospholipases B/
lysophospholipases from Saccharomyces cerevisiae. J. Biol.
Chem. 274, 28121–28127.
3764 A. Noiriel et al. (Eur. J. Biochem. 271) Ó FEBS 2004