báo cáo hóa học: " Conformational epitopes of myelin oligodendrocyte glycoprotein are targets of potentially pathogenic antibody responses in multiple sclerosis" pot

RESEARCH Open Access
Conformational epitopes of myelin
oligodendrocyte glycoprotein are targets of
potentially pathogenic antibody responses in
multiple sclerosis
Til Menge
1,2*
, Patrice H Lalive
1,3
, H-Christian von Büdingen
1
and Claude P Genain
1
Abstract
Background: Myelin/oligodendrocyte glycoprotein (MOG) is a putative autoantigen in multiple sclerosis (MS).
Establishing the pathological relevance and validity of anti-MOG antibodies as biomarkers has yielded conflicting
reports mainly due to different MOG isoforms used in different studies. Because epitope specificity may be a key
factor determining anti-MOG reactivity we aimed at identifying a p riori immunodominant MOG epitopes by
monoclonal antibodies (mAbs) and at assessing clinical relevance of these epitopes in MS.
Methods: Sera of 325 MS patients, 69 patients with clinically isolated syndrome and 164 healthy controls were
assayed by quantitative, high-throughput ELISA for reactivity to 3 different MOG isoforms, and quantitative titers
correlated with clinical characteristics. mAbs defined unique immunodominant epitopes distinct to each of the
isoforms.
Results: In the majority of human samples anti-MOG levels were skewed towards low titers. However, in 8.2% of
samples high-titer anti-MOG antibodies were identified. In contrast to anti-MOG reactivity observed in a mouse model
of MS, in patients with MS these never reacted with ubiquitously exposed epitopes. Moreover, in patients with
relapsing-remitting MS high-titer anti-MOG IgG correlated with disability (EDSS; Spearman r = 0.574; p = 0.025).
Conclusions: Thus high-titer reactivity likely represents high-affinity antibodies against pathologically relevant MOG
epitopes, that are only present in a small proportion of patients with MS. Our study provides valuable information
about requirements of anti-MOG reactivity for being regarded as a prognostic biomarker in a subtype of MS.
Keywords: Antibodies, Autoimmunity, Multiple sclerosis, Myelin, Biomarkers

Introduction
Autoantibodies directed against myelin antigens have
been a long-standing focus of interest in multiple sclero-
sis (MS) research, especially those binding to myelin oli-
godendrocyte glycoprotein (MOG). MOG is
predominantly expressed in the CNS, and is exposed on
the outermost lamellae of the myelin sheath thus readily
available for a humoral immune attack [1]. MOG
induces demyelinating experimental allergic encephalo-
myelitis (EAE), the animal model of MS, in a variety of
species both by active immunization and by passively
transferred anti-MOG antibodies (reviewed by [1,2]).
Only those anti-MOG antibodies directed against con-
formational epitopes, as opposed to linear epitopes,
appear to be pathogenic in EAE [3-5]. Recently, it was
shown that the murine mono clonal antibody (mAb)
8.18.c5 specific for rat MOG, that confers demyelina-
tion, maps to a discontinuous epitope of the surface
exposed FG loop of rat MOG, that is also exposed on
murine and human MOG [6].
To date, the measurement of serum anti-MOG anti-
bodies using various techniques and different MOG pre-
parations has resulted in inconsistent results and limited
reproducibility (reviewed by [7,8]). This study was thus
* Correspondence:
1
Neuroimmunology Laboratories, Department of Neurology, University of
California San Francisco, CA, USA
Full list of author information is available at the end of the article
Menge et al. Journal of Neuroinflammation 2011, 8:161

/>JOURNAL OF
NEUROINFLAMMATION
© 2011 Menge et al; licensee BioMed C entral Ltd. This is an Open Access article di stributed under the terms of the Creative Commons
Attribution License ( which permits unrestricted use, distr ibution, and reproduct ion in
any m edium, provided the original work i s properly cited.
designed to assess the M OG epitope usage in humans
employing a novel quantitative high-throughput ELISA.
The serum anti-MOG antibody responses of 325
patients with MS, 69 patients with a first demyelinating
event (clinically isolated syndrome, CIS) and 164 healthy
controls (HC) were assayed. Three isoforms of recombi-
nant MOG were generated and the differential exposure
of immunodominant epitopes characterized by a panel
of monoclonal anti-MOG antibodies. Restricted patterns
of anti-MOG reactivity could be observed in samples
with sustained anti-MOG reactivity at high serum dilu-
tions, defining high-titer reactivity. In this cohort we
find that anti-MOG antibody levels strongly correlate
with disease severity.
Materials and methods
Antigens and Antibodies
Three recombinant human MOG isoforms were used
for the study. The first, spanning the extracellular
domain, amino acids 1-125, (rhMOG
125
) was expressed
and purified under physiological conditions as described
previously [9]. Secondly, a seven amino acids shorter
rhMOG protein, spanning the amino acids 1-118
(rhMOG

118
) was c reated by usage of a different 3’-end
primer: 5’-ATCCAT GAGATCTAGGATCTTCTACTTT
CAATTCCATTGCTGCC-3’ , and wa s expressed and
purified as above. Finally, recombinant rat MOG, amino
acids 1-125 (ratMOG
125
) was produced in E. coli and
purified as described previously [10]. Purity was con-
firmed to be > 95% by SDS-PAGE (additional file 1) and
correct folding ascertained by circular dichroism (addi-
tional file 1) [11,12].
The murine monoclonal IgG 8.18C5 against native rat
MOG was a gift of Dr. Chris Linington [13]. The mar-
moset Fab-fragments (Fabs) designated M26, M3-24,
and M3-8 derived from a ratMOG
125
-immune animal
were generated in our laboratory as described previously
[10].
Patients
325 MS patients meeting the diagnostic cr iteri a for clini-
cally definite MS [14,15], and 69 patients with a first
demyelinating were recruited for this study [15]. 36% of
the MS patients were treated with either interferon beta
or glatiramer acetate at the time of sampling. Patients
treated with glucocorticoids within three months or on
immunosuppressive therapy within six months of phle-
botomy were excluded. 164 volunteers served as healthy
controls (HC). Informed consent was obtained from all

subjects, and the study was conducted in accordance
with Institutional Review Board approval. The clinical
characterist ics of the patients and HC are summarized in
the table contained in additional file 2. Blood was drawn
by venipuncture and clotted serum stored at -40°C.
High-throughput ELISA
Optimal protein concentrations for coating were deter-
mined in preliminary experiments; 0.5 μgofrhMOG
125
and rhMOG
118
and 1.0 μg of ratMOG
125
were coated in
PBS overnight on a single 384-well microtiter assay
plate (Maxisorb, Nunc, Rochester, NY). Control wells
were coated with 1.0 μg BSA. To quantify the antibody
reactivity, an IgG standard curve was created by coating
human IgG (I4506, Sigma, St. Louis, MO) in two-fold
dilutions. After washing, plates were blocked for 2 hours
with 1% BSA in PBS supplemented with 0.05% Tween
20. Then, human sera were added at three dilutions
starting at 1/200, and incubated for 90 min. A positive
control known to be reactive to all three rMOG iso-
forms, and a negative cont rol omitting serum were
included. Bound antibodies were detected by an alkaline
phosphatase-labeled anti-human IgG (A9544, Sigma)
and the optical density (OD) read at 405 nm wavelength
in a microplate reader (SpectraMax, Molecular Devices,
Sunnyvale, CA) after 30 minute incubation with para-

nitrophenyl phosphate (Moss, Pasadena, MD). All sam-
ples were tested coded in a blinded fashion in dupli-
cates, standard curves in quadruplicates ; incubation was
at room temperature (RT), e xcept coating which was at
4°C. Sample handling and ELISA procedures were per-
formed by a robotic workstation (Biomek FX, Beckman
Coulter, Fullerton, CA). MOG-ELISA for the monoclo-
nal reagents (8.18c5 and Fab fragments) were performed
in 96-well Maxisorb plates according to the protocol as
outlined above. 8.18c5 was detected by an anti-mouse
IgG (A9044, Sigma) and the Fabs by Protein L (Pierce).
Both were peroxidase labeled and developed by 3,3’,5,5’-
tetramethylbenzidine (Pierce) and the OD read at 4 50
nm wavelength.
Denaturing anti-MOG ELISA
To further demonstrate, that c onformational MOG-epi-
topes are conserved in regular ELISA assays as described
above, we compared binding of anti-MOG antibodies to
recombinant MOG antigens coated under native (pre-
vious section) and denaturing conditions. The rMOG
isoforms were coated as o utlined above in 96-well
plates. After washing coated MOG was denatured by
incubation with 8 M urea supplemented with 10 mM
dithiothreitol (DTT) for 4 hours at RT followed by addi-
tion of 25 mM 2-iodoacetamide (IDAA) for fixation.
After overnight incubation at RT and extensive washing
wells were blocked as above, subjected to either 8.18c5
or anti-His mAb (Invitrogen, Carlsbad, CA), and binding
was detected as above.
Data processing and statistical analysis

The ODs were corrected for the individual background
binding and the amount of specific IgG bound to the
Menge et al. Journal of Neuroinflammation 2011, 8:161
/>Page 2 of 9
well interpolated from the on-plate standard curve.
Additionally, results were expressed as the signal-to-
background binding ratio (BR), calculated as the ratio of
OD signal/background where applica ble, as were results
for 8.18c5 and the Fabs.
For the assessment of high-titer reactivity, samples
above to 95
th
percentile of IgG concentrations were
tested in a separate experiment in serial dilutions,
those with BRs ≥ 2 at 1/3,200 dilution (i.e. signals
against MOG that were at least two-fold above the
BSA signal) we re identified and their mean BR at 1/
800 dilution defined as the cut-off for high-titer reac-
tivity. This procedure was done for all three MOG iso-
forms.Thisprocedureisoneoftherigorousmethods
accepted for defining subtype cut-offs with stringent
criteria.
Statistical analysis was conducted using Prism 4.0
(GraphPad, San Diego, CA). Categorical variables were
compared using the c
2
-test, continuous variables using
ANOVA and ordinal as well as not normally distributed
continuous variables by Kruskal-Wallis testing. The Stu-
dent-Newman-Keuls method and Dunn’ stestwereused

to determine differences in between groups.
Results
Demonstration of conformationally coated MOG in ELISA
Prior to assessing the putative immunodominant MOG
epitopes it was shown that coating of MOG to the
ELISA plate by electrostatic forces did not denature the
protein. Making use of the mAb 8.18c5 that is known to
exclusively bind to conformational, but not linear MOG
epitopes [5,6], recombinant MOG was denatured by
urea and DTT after coating, and the linearized polypep-
tide fixated by the alkylating sulfhydryl reagent IDAA
that binds covalently with cysteine and thus prevents
renaturing of MOG. While 8.18c5 reactivity is lost after
denaturing/fixating, anti-His mAb reactivity is sustained
indicating the MOG polypeptide remains coated in the
wells (exemplified for rhMOG
118
; Figure 1).
Thus, coating does not denature MOG to an extent
that pathogenic conformational epitopes are destroyed
or become unexposed. This however, do es not prevent
antibodies reactive to linear epitopes to bind to coated
MOG as exemplified for human sample #1139 (Figure
1) and as shown previously [3,9]. Because at least half of
the reactivity of serum #1139 is lost after denaturing of
rhMOG
118
the samples contains both antibodies against
linear epitopes and those exclusively reactive to confor-
mational epitopes (Figure 1).

Definition of distinct epitopes exposed on the different
MOG isoforms
Despite 90% sequence homology between rhMOG
125
and ratMOG
125
, and a mere 7 amino acid difference in
length between rhMOG
118
and rhMOG
125
, each of the
antigenic isoforms used in this ELISA displayed unique
immunodominant epitopes of MOG or combinations
thereof, as demonstrated by the mAb 8.18c5 and the
monoclonal Fabs M26, M3-24 and M3-8:
- 8.18c5 and M26 bound equally well to all isoforms,
defining epitopes commo nly exposed on all three
MOG isoforms (Figure 2A+B).
- A second epitope, defined by the marmoset Fab
M3-24, is unique to rhMOG
125
and ratMOG
125
, and
is not exposed on rhMOG
118
; hence this epitope is
species-indepe ndent, but dependent on the length of
the protein (Figure 2C).

- Thirdly, the Fab M3-8 recognizes an epitope
uniquely exposed on ratMOG
125
, but on neithe r of
the human proteins; hence this epitope is species-
dependent, (Figure 2D).
It has been previously s hown that these Fabs do not in hi-
bit each other’s binding or binding of 8.18c5, nor do they
recognize linear MOG-derived peptides, which corrobo-
rates our interpretation that the dif ferent MOG isoforms
expose distinct, conformation dependent, immunodomi-
nant epitopes [10]. Thus, the use of these three different
recombinant isoforms affords to measure antibodies against
specific c onformational epitopes o f MOG in serum.
Anti-MOG reactivity in healthy controls and cohorts of
patients with MS
The quantitative results for antibodies against the 3 di f-
ferent MOG isoforms in 325 patients with MS, 69 CIS
Figure 1 Denaturing ELISA.ComparisonofrhMOG
118
coated
under physiological conditions in PBS (black bars), after partial
denaturing of rhMOG
118
by incubation with 8 M urea (light grey
bars) and after irreversibly completely denaturing by incubation
with 8 M urea, 10 mM DTT, 25 mM IDAA (dark grey bars). Results
are expressed as binding ratios as described in the methods section.
Anti-His denotes a mAb specific for 6-mer histidine peptide tag;
#1139 is a human serum serving as positive control in the

quantitative ELISA.
Menge et al. Journal of Neuroinflammation 2011, 8:161
/>Page 3 of 9
patients and 164 HC samples obtained by high-through-
put ELISA are summarized in Figure 3. Anti-MOG IgG
concentrations below 5.0 μg/mL were over-re presented,
resulting in a skewed distribution (75
th
percentile < 5.1
μg/mL for all groups; Figure 3). Anti-rhMOG
125
reactiv-
ity was significantly elevated in the CIS patient group
compared to MS and HC (p < 0.05), and anti-rat-
MOG
125
significantlyhigherinMScomparedtoHC(p
< 0.05); however, extensive overlap between groups was
observed and the clinical relevance of this finding
remains unclear (Figure 3).
Importantly, age, gender, disease duration, or treat-
ment could be excluded as confounding factors in any
of the MS subgroups or HC (data not shown).
Identification and fine epitope specificity of subjects with
high-titer anti-MOG IgG
Because of the skewed distribution in favor of low
serum concentration antibodies, we sought to identify
high-titer, higher affinity samples reasoning that these
would be immunologically relevant antibodies reflecting
a true immune response, and investigated their reactivity

patterns. The quantitative assay with multiple serial
dilutions is capable of pr oviding this information in two
ways; first, it allows to measure actual antibody concen-
trations; second, it allows differentiating antibodies that
retain reactivity at high dilutions, which may be indica-
tive of higher affinity and could not otherwise be mea-
sured in a complex mixture of serum IgG. To
specifically identify samples with high-titer reactivity
and to differentiate those from the ones that show reac-
tivity only at lower dilutions, we defined cut-offs for BR
for the 1/800 dilution, derived from samples with anti-
MOG IgG concentrations above the 95
th
percentile and
with sustained antibody reactivity at 1/3,200 dilution
(see Methods; additi onal file 3). Applying these cut-offs,
8.2% of all HC, CIS and MS samples were identified as
high-titer reacti ve; differences between groups were not
statistically significant (table 1).
Detailed analysis of the high-titer sera revealed that
themajorityofthesereactedwithonlyoneofthe
human MOG isoforms, either rhMOG
118
or
rhMOG
125
("monospecific” ), or with both of them
("oligospecific” , table 1). Concomitant reactivity to all
three MOG antigens was only found in one HC sam-
ple (table 1). This patter n was consistent in all groups,

Figure 2 Monoclonal reagents define distinct epi topes on MOG. Serial two-fold dilution series of the mouse monoclonal antibody 8.18c5
(A), and the marmoset-derived Fab fragments M26 (B), M3-24 (C) and M3-8 (D) against rhMOG
118
(-○-), rhMOG
125
(-□-) and ratMOG
125
(-◊-).
Menge et al. Journal of Neuroinflammation 2011, 8:161
/>Page 4 of 9
and there were no differences betwe en early disease
(CIS) and chronic forms of MS (SPMS, PPMS). This
dichotomy of reactivity is corroborated by the obser-
vation that anti-rhMOG
118
IgG concentrations corre-
lated well with the respective anti-rhMOG
125
IgG
concentrations in the oligospecific high-titer samples
(Spearman r = 0.574; p = 0.025), b ut not in the mono-
specific high-titer samples (Spearman r = -0.176; p =
0.4; data not shown).
These results underscore the findings of unique epi-
tope exposure as defined by the mAbs (Figure 2) and
may be indicative of three major immunodominant epi-
topes relevant to the human anti-MOG response: [1]
one epitope exclusively exposed on rhMOG
118
,[2]one

exclusively exposed on rhMOG
125
, and [3] finally one
shared epitope exposed on both rhMOG
118
and
rhMOG
125
. None of these seem to be sufficiently
exposed on ratMOG
125
. Overall, the anti-MOG reactiv-
ity in humans with high-titer antibody responses appears
to be diverse and not exclusively directed against
epitopes that are commonly exposed (as def ined by the
mAb 8.18c5 or the Fab M26).
Clinical correlations of anti-MOG IgG
In neither the entire MS cohort, nor in any of the sub-
types (RR-, SP-, PP-MS individually) were anti-MOG
antibody titers correlated with the degree of disability as
measured by the extended disability s tatus scale (EDSS)
(depicted for RR-MS in Figure 4A) when considering
the whole cohorts. In contrast, when isolating the sub-
type of RR-MS samples with high-titer reactivity, their
cumulative anti-MOG IgG concentrations, i.e. the sum
of the respective high-titer anti-MOG IgG concentra-
tions (rhMOG
118
, rhMOG
125

, ratMOG
125
, where applic-
able), positively correlated with the EDSS at blood
sampling (Spearman r = 0.574; p = 0.0 25; Figure 4B).
There was no correlation observed for samples of MS
patients with chronic disease. Neither age, gender nor
disease duration were identified as confounding factors
for the EDSS correlation.
Figure 3 Scatter plot of ELISA react ivity of healthy control s and patients with CIS an d MS against rhMOG
118
,rhMOG
125
and
ratMOG
125
. Differences between 164 healthy controls (open symbols), 69 CIS patients (grey symbols) and 325 MS patients (solid symbols) for
the three MOG preparations, rhMOG
118
(-○-), rhMOG
125
(-□-) and ratMOG
125
(-◊-). Results expressed as IgG concentrations in μg/mL serum.
Menge et al. Journal of Neuroinflammation 2011, 8:161
/>Page 5 of 9
For six RR-MS patients longitudinal blood samples
were analyzed in a single ELISA assay and demonstrated
no significant variation in anti-MOG antibody titers
over time (additional file 4). This indicates that pending

exceptions, these titers are quite stable over time,
excluding titer variability at blood sampling (for exam-
ple, elevated total IgG due to infection) and that few
blood sample measurements would be necessary to
define the level of anti-MOG antibody reactivity.
Discussion
Numerous studies have attempted to assess the presence
and clinical implications of serum antibodies against
MOG in MS reporting a wide range for the prevalence
of anti-MOG antibodies (0% - 78%) (reviewed in [7,8]).
The reason for this variability are likely differences in
patient populations, assay techniques (e.g., Western blot-
ting, ELISA, RIA), and MOG antigen preparations used
[7,16]. Furthermore, an important factor to be taken
into consideration is the biophysical environment of
MOG in the respective assay system. In particular, dena-
turing conditions may render proteins linearized and
thus inaccessible to pathogenic antibodies targeting con-
formation-dependent epitopes.
The approach presented here addresses two critical
criteria: the diversity of the conformational MOG epi-
tope repertoire at the molecular level, and implementa-
tion of a fully quantitative assay of the MOG-directed
antibody response. In a preliminary experiment we
demonstrated that in our ELISA assay antigen coating
does not denature MOG (Figure 1), but rather harsh
chemical forces would be necessary to fully linearize
MOG rendering it inaccessible for antibodies specific for
conformational MOG epitopes. We are thus confident
that potentially pathogenic conformational anti-MOG

antibodies can be detected by our ELISA. We are
therefore able to stratify our analyses according to para-
meters of potential pathological relevance, an essential
step towards meaningful interpretation of serum antibo-
dies. We and others have previously shown that single
target antigen ELISA may not sufficiently discriminate
between pathogenic anti-MOG antibodies, naturally
occurring low-affinity autoantibodies or non-pathogenic
antibodies directed against linear MOG epito pes
[3,9,17]. To further emphasize the importance of anti-
body epitope characterization, we have recently reported
in CIS patients a high prevalence of antibodies against
native, membrane-embedded MOG that do not fully
cross-react with recombina nt MOG preparations as
demonstrated by cytometry and competition assays [18].
The most relevant finding of this study was derived
from 8.2% of samples that were ide ntified as high-titer
reactive. In these samples, we set out to further charac-
terize the diversity of the human serum anti-MOG anti-
body repertoire with respect to binding to
conformational epitopes that was otherwise masked in
the entire cohort predominantly consisting of low-titer
anti-MOG reactive antibodies (table 1 Figure 3). At least
three immunodominant epitopes became apparent, dis-
tinctly exposed on three different recombinant MOG
“isoforms” . These isoforms display only minor differ-
ences in terms of amino acid sequence (table 1) and
have no other purpose than to rigorously define specific
epitopes. These findings of distinct epitope exposure
were corroborated using a panel of differentially reactive

anti-MOG monoclonal agents (Figure 2) [10]. Impor-
tantly, we present data (Figure 1) and have previously
shown that relevant conformational MOG epitopes are
preserved in ELISA systems [3,10]. Only after isolating
high-titer samples, a strong association of circulating
anti-MOG IgG with disability in RR-MS patients could
be unmasked (Figure 4). This was achieved by
Table 1 Differential reactivity against the three different MOG isoforms in samples with high-titer reactivity
Percentage of samples
tested (proportion)
a
Monospecific (1 antigen only) Oligospecific (2 antigens) All 3 antigens
% rhMOG
118
(n)
rhMOG
125
(n)
ratMOG
125
(n)
% rhMOG
118
+
rhMOG
125
(n)
rhMOG
118
+

ratMOG
125
(n)
rhMOG
125
+
ratMOG
125
(n)
rhMOG
118
,
rhMOG
125
,
ratMOG
125
% (n)
HC 10.4 (17/169) 47.1 5 1 2 47.1 7 1 0 5.9 (1)
CIS 7.3 (5/69) 80.0 3 1 0 20.0 1 0 0 0
MS 6.8 (22/325) 68.2 9 6 0 31.8 5 2 0 0
RR-
MS
7.8 (15/192) 66.7 6 4 0 33.3 4 1 0 0
SP/
PP-
MS
5.3 (7/133) 71.4 3 2 0 28.6 1 1 0 0
Percentage of samples with identi fied high-titer reactivity to have high-titer reactivity exclusively to one MOG isoform, two of the MOG isoforms used or all three
MOG isoforms, respectively. There are no significant differences between HC, CIS and MS or any of the MS subgroups (p > 0.05, c

2
test). Samples were deemed
high-titer reactive, if the respective BR at the 1/800 serum dilution was above the defined cut-off BRs (5.8, 5.6, 9.4 for rhMO G
118
, rhMOG
125
and ratMOG
125
).
a
refer to additional file 2 for characteristics of all samples tested.
Menge et al. Journal of Neuroinflammation 2011, 8:161
/>Page 6 of 9
combining the antibody reactivity against all identified
putative target epitopes. RatMOG
125
was included in
our pan el of MOG antigens in order to assess the reac-
tivity against an ubiquitously exposed common epitope,
and because of a previously demonstrated cross-reactiv-
ity between ratMOG
125
and human anti-MOG IgG [10].
The proportion of high-titer samples appears low at first
sight; it is however, quite consistent with recent findings
of the frequencies of MOG-reactive T cells in the per-
ipheral blood of MS patients, that ranged between
approximately 2-4 percent of T cells [19,20]. Interest-
ingly and complementing our data, the frequency of
these specific T cells correlated to disease activity and

disability [19].
It was an unexpected finding that reactivity to epi-
topes conserved between species, such as those defined
by 8.18c5 or M26 was not predominant in MS high-titer
samples (Figure 2A+B, table 1). Rather, specific reactiv-
ity appeared to be exclusively direc ted against restricted
epitopes of human MOG (table 1). In contrast, humoral
responses in rodent EAE are predominantly directed
against the 8.18c5 defined epitope [6].
This diversity in epitope recognition may explain why
previous studies employing different MOG preparations
have generate d such divergent results [7,16]. Indee d,
only one previous study has reported a comparable clin-
ical correlation in 262 patients with MS of which 14%
were deemed anti-MOG positive by comparison to the
HC samples [21]. Most other studies have tested consid-
erably smaller numbers of MS patients, and may have
not achieved sufficient statistical power to reveal corre-
lations with clinical parameters. To put in perspective,
in Type I diabetes mellitus, large sample numbers of
1,300 to over 4,000 per study were needed to identify
the prognostic value of autoantibodies in offspring of
diabetic patients, with less t han 5% of samples showing
high-titer reactivity against the respective antigens [22].
We are aware, that our study does not sufficiently
address the issue of specificity that has lacked in pre-
vious assays too [7,8], as ex emplified by similar overall
frequencies of high-titer reactivity in HC compared to
MS and CIS (Figure 3; table 1). However, it is striking,
that high-titer anti-MOG reactivity in HC includes epi-

topes of rodent MOG, while that in MS and CIS
patients does not. While our study was clearly not
designed to prove pathogenicity of anti-MOG antibodies
as shown previously by passive transfer experiments in
animals [3,23], our findings do suggest, that potentially
pathogenic anti-MOG antibody responses are highly
specific for certain epitopes of human MOG. In this
context it was recently shown that demyelination is aug-
mented i n an animal model of v irally induced mild
demyelination if the animals are engineered to produce
anti-MOG IgG prior to infection [24]. Thus, it is intri-
guing to speculate that anti-MOG antibodies in HC ren-
der the same pathogenic potential as in MS patients, but
HC individuals have not encountered the pathogeneti-
cally relevant viral infection. Furthermore, we cannot
rule out the possibility, that the high-titer anti-MOG
response occurs secondary to acquired myelin destruc-
tion and may as such reflect the magnitude of clinical
disability [25].
In summary, we demonstrate for the first time that
target epitopes of autoantibody responses are differen-
tially exposed and that the immune response in
humans is restricted to distinct epitopes but not iden-
tical in all patients and certainly not identical to
rodent EAE. Only in a fraction of samples a strong
Figure 4 Correlation of anti-MOG IgG concentration to disease
disability in high-titer RR-MS samples. Lack of correlation of the
magnitude of combined reactivity against rhMOG
118
, rhMOG

125
and
ratMOG
125
(expressed as anti-MOG IgG concentration) with EDSS in
all 192 RR-MS patients tested (A); positive correlation in the subset
of RR-MS patients with high-titer anti-MOG reactivity with EDSS (B):
Spearman r = 0.574; p = 0.025.
Menge et al. Journal of Neuroinflammation 2011, 8:161
/>Page 7 of 9
and sustained anti-MOG response can be detect ed,
deemed high-titer reactivity. We report that in RR-MS
patients with such reactivity the amount of anti-MOG
antibodies are correlated with disability. Our findings
bear significant clinical relevance that may have been
overlooked in previous studies due to smaller sample
sizes. This study supports the concept that establishing
certain serum autoantibodies as predictive biomarkers
in MS may be possible.
Additional material
Additonal file 1: SDS-PAGE and CD-spectroscopy of MOG. Figures of
a SDS-PAGE demonstrating high purity of the three recombinant MOG
isoforms, and of a circular dichroism spectroscopy experiment proving
correct b-sheet folding.
Additonal file 2: Clinical characteristics of healthy control, CIS and
MS samples tested. Table compiling the demographic and clinical
features of the three patient group s.
Additonal file 3: Dilution series of samples with high titers. Figure of
an ELISA of two-fold serial serum dilutions against the three MOG
isoforms to demonstrate sustained ELISA reactivity of samples with high

IgG concentrations (> 95
th
percentile) beyond dilutions of 1/2,000.
Additonal file 4: Persistent anti-MOG reactivity in serial samples.
Figure of an ELISA reactivity against rhMOG
118
of six samples, for which
longitudinal samples were drawn every three months over 18 months;
the data prove that anti-MOG IgG concentrations vary only within the
limits of the assay.
Abbreviations
ANOVA: analysis of variance; BR: binding ratio; BSA: bovine serum albumin;
CD: circular dichroism; CIS: clinically isolated syndrome; CNS: central nervous
system; EAE: experimental allergic encephalomyelitis; EDSS: expanded
disability status scale; HC: healthy control; HT: high-titer; mAb: monoclonal
antibody; MOG: myelin oligodendrocyte glycoprotein; rMOG: recombinant
rat MOG (extracellular domain); MS: multiple sclerosis; OD: optical density;
PBS: phosphate buffered saline; PP-MS: primary progressive MS; RR-MS:
relapsing remitting MS; SNK: student Newman-Keuls test; SP-MS: secondary
progressive MS.
Acknowledgements
T.M. and P.H.L. were postdoctoral research fellows of the National Multiple
Sclerosis Society.
We are indebted to Ishita Barman for recombinant MOG preparation and to
Drew Dover and Lev Igoudin for performing the assay. Dr. Win Than helped
with the denaturing ELISA assay. Lars Lüers oversaw the CD-spectroscopy at
the biophysical research core facility in Düsseldorf.
We thank the UCSF MS Center staff and neurologists, and Dr. Pablo
Villoslada (University of Navarra, Spain) for sample collection and extended
clinical examination.

This work has been supported by grants from the National Institutes of
Health (NS4678-01 to CPG); the National Multiple Sclerosis Society (RG3370-
A-3 and 3438-A-7 to CPG); EMD-Serono; the Cure MS Now fund, the Lunardi
fund and the Nancy Davis Center Without Walls.
Author details
1
Neuroimmunology Laboratories, Department of Neurology, University of
California San Francisco, CA, USA.
2
Department of Neurology, Medical
Faculty, Heinrich-Heine-University, Düsseldorf, Germany.
3
Department of
Neurosciences, Division of Neurology, Faculty of Medicine, University of
Geneva, Switzerland and Department of Pathology and Immunology, Faculty
of Medicine, University of Geneva, Switzerland.
Authors’ contributions
TM designed the study, performed the experiments, analyzed data, wrote
the paper. PHL analyzed data, wrote the paper and performed experiments.
H-CvB performed experiments, wrote the paper and reviewed the
manuscript. CPG wrote the paper and reviewed the manuscript. TM and
CPG had full access to all of the data in the study and take responsibility for
the integrity of the data and the accuracy of the data analysis. All authors
read and approved the final manuscript.
Competing interests
The authors declare that they have no competing interests.
Received: 12 August 2011 Accepted: 17 November 2011
Published: 17 November 2011
References
1. Johns TG, Bernard CC: The structure and function of myelin

oligodendrocyte glycoprotein. J Neurochem 1999, 72:1-9.
2. von Büdingen HC, Tanuma N, Villoslada P, Ouallet JC, Hauser SL, Genain CP:
Immune responses against the myelin/oligodendrocyte glycoprotein in
experimental autoimmune demyelination. J Clin Immunol 2001,
21:155-170.
3. von Büdingen HC, Hauser SL, Ouallet JC, Tanuma N, Menge T, Genain CP:
Frontline: Epitope recognition on the myelin/oligodendrocyte
glycoprotein differentially influences disease phenotype and antibody
effector functions in autoimmune demyelination. Eur J Immunol 2004,
34:2072-2083.
4. Mathey E, Breithaupt C, Schubart AS, Linington C: Commentary: Sorting
the wheat from the chaff: identifying demyelinating components of the
myelin oligodendrocyte glycoprotein (MOG)-specific autoantibody
repertoire. Eur J Immunol 2004, 34:2065-2071.
5. Breithaupt C, Schubart A, Zander H, Skerra A, Huber R, Linington C,
Jacob U: Structural insights into the antigenicity of myelin
oligodendrocyte glycoprotein. Proc Natl Acad Sci USA 2003, 100:9446-9451.
6. Breithaupt C, Schafer B, Pellkofer H, Huber R, Linington C, Jacob U:
Demyelinating myelin oligodendrocyte glycoprotein-specific
autoantibody response is focused on one dominant conformational
epitope region in rodents. J Immunol 2008, 181:1255-1263.
7. Reindl M, Khalil M, Berger T: Antibodies as biological markers for
pathophysiological processes in MS. J Neuroimmunol 2006, 180:50-62.
8. Bielekova B, Martin R: Development of biomarkers in multiple sclerosis.
Brain 2004, 127:1463-1478.
9. Menge T, von Büdingen HC, Lalive PH, Genain CP: Relevant antibody
subsets against MOG recognize conformational epitopes exclusively
exposed in solid-phase ELISA. Eur J Immunol 2007, 37:3229-3239.
10. von Büdingen HC, Hauser SL, Fuhrmann A, Nabavi CB, Lee JI, Genain CP:
Molecular characterization of antibody specificities against myelin/

oligodendrocyte glycoprotein in autoimmune demyelination. Proc Natl
Acad Sci USA 2002, 99:8207-8212.
11. O’Connor KC, Appel H, Bregoli L, Call ME, Catz I, Chan JA, Moore NH,
Warren KG, Wong SJ, Hafler DA, Wucherpfennig KW: Antibodies from
inflamed central nervous system tissue recognize myelin
oligodendrocyte glycoprotein. J Immunol 2005, 175:1974-1982.
12. Gori F, Mulinacci B, Massai L, Avolio C, Caragnano M, Peroni E, Lori S,
Chelli M, Papini AM, Rovero P, Lolli F: IgG and IgM antibodies to the
refolded MOG(1-125) extracellular domain in humans. J Neuroimmunol
2011, 233:216-220.
13. Linnington C, Webb M, Woodhams PL: A novel myelin-associated
glycoprotein defined by a mouse monoclonal antibody. J Neuroimmunol
1984, 6:387-396.
14. Poser CM, Paty DW, Scheinberg L, McDonald WI, Davis FA, Ebers GC,
Johnson KP, Sibley WA, Silberberg DH, Tourtellotte WW: New diagnostic
criteria for multiple sclerosis: guidelines for research protocols. Ann
Neurol 1983,
13:227-231.
15.
McDonald WI, Compston A, Edan G, Goodkin D, Hartung HP, Lublin FD,
McFarland HF, Paty DW, Polman CH, Reingold SC, Sandberg-Wollheim M,
Sibley W, Thompson A, van den Noort S, Weinshenker BY, Wolinsky JS:
Recommended diagnostic criteria for multiple sclerosis: guidelines from
the International Panel on the diagnosis of multiple sclerosis. Ann Neurol
2001, 50:121-127.
Menge et al. Journal of Neuroinflammation 2011, 8:161
/>Page 8 of 9
16. Amor S, Giovannoni G: Antibodies to myelin oligodendrocyte
glycoprotein as a biomarker in multiple sclerosis–are we there yet? Mult
Scler 2007, 13:1083-1085.

17. Marta CB, Oliver AR, Sweet RA, Pfeiffer SE, Ruddle NH: Pathogenic myelin
oligodendrocyte glycoprotein antibodies recognize glycosylated
epitopes and perturb oligodendrocyte physiology. Proc Natl Acad Sci USA
2005, 102:13992-13997.
18. Lalive PH, Menge T, Delarasse C, Della GB, Pham-Dinh D, Villoslada P, von
Budingen HC, Genain CP: Antibodies to native myelin oligodendrocyte
glycoprotein are serologic markers of early inflammation in multiple
sclerosis. Proc Natl Acad Sci USA 2006, 103:2280-2285.
19. Bahbouhi B, Pettre S, Berthelot L, Garcia A, Elong NA, Degauque N,
Michel L, Wiertlewski S, Lefrere F, Meyniel C, Delcroix C, Brouard S,
Laplaud DA, Soulillou JP: T cell recognition of self-antigen presenting
cells by protein transfer assay reveals a high frequency of anti-myelin T
cells in multiple sclerosis. Brain 2010, 133:1622-1636.
20. Raddassi K, Kent SC, Yang J, Bourcier K, Bradshaw EM, Seyfert-Margolis V,
Nepom GT, Kwok WW, Hafler DA: Increased Frequencies of Myelin
Oligodendrocyte Glycoprotein/MHC Class II-Binding CD4 Cells in Patients
with Multiple Sclerosis. J Immunol 2011, 187:1039-1046.
21. Mantegazza R, Cristaldini P, Bernasconi P, Baggi F, Pedotti R, Piccini I,
Mascoli N, Mantia LL, Antozzi C, Simoncini O, Cornelio F, Milanese C: Anti-
MOG autoantibodies in Italian multiple sclerosis patients: specificity,
sensitivity and clinical association. Int Immunol 2004, 16:559-565.
22. Achenbach P, Ziegler AG: Diabetes-related antibodies in euglycemic
subjects. Best Pract Res Clin Endocrinol Metab 2005, 19:101-117.
23. Zhou D, Srivastava R, Nessler S, Grummel V, Sommer N, Bruck W,
Hartung HP, Stadelmann C, Hemmer B: Identification of a pathogenic
antibody response to native myelin oligodendrocyte glycoprotein in
multiple sclerosis. Proc Natl Acad Sci USA 2006, 103:19057-19062.
24. Burrer R, Buchmeier MJ, Wolfe T, Ting JP, Feuer R, Iglesias A, von
Herrath MG: Exacerbated pathology of viral encephalitis in mice with
central nervous system-specific autoantibodies. Am J Pathol 2007,

170:557-566.
25. Antel JP, Bar-Or A: Do myelin-directed antibodies predict multiple
sclerosis? N Engl J Med 2003, 349:107-109.
doi:10.1186/1742-2094-8-161
Cite this article as: Menge et al.: Conformational epitopes of myelin
oligodendrocyte glycoprotein are targets of potentially pathogenic
antibody responses in multiple sclerosis. Journal of Neuroinflammation
2011 8:161.
Submit your next manuscript to BioMed Central
and take full advantage of:
• Convenient online submission
• Thorough peer review
• No space constraints or color figure charges
• Immediate publication on acceptance
• Inclusion in PubMed, CAS, Scopus and Google Scholar
• Research which is freely available for redistribution
Submit your manuscript at
www.biomedcentral.com/submit
Menge et al. Journal of Neuroinflammation 2011, 8:161
/>Page 9 of 9