DEVELOPMENTAL CELL ARTICLE ROLE OF ACTIN CYTOSKELETON IN BRASSINOSTEROID SIGNALING AND IN ITS INTEGRATION WITH THE AUXIN RESPONSE IN PLANTS

Bạn đang xem bản rút gọn của tài liệu. Xem và tải ngay bản đầy đủ của tài liệu tại đây (1.07 MB, 11 trang )

Trang 1<div class="page_container" data-page="1">

Role of Actin Cytoskeleton

in Brassinosteroid Signaling and in Its

Integration with the Auxin Response in Plants Mo´nica Lanza,

1,3,4

Berenice Garcia-Ponce,

1,3,5

Gabriel Castrillo,

1,3

Pablo Catarecha,

1,3

Michael Sauer,

1

Marı´a Rodriguez-Serrano,

2

Ana Pa´ez-Garcı´a,

1

Eduardo Sa´nchez-Bermejo,

1

Mohan TC,

1

Yolanda Leo del Puerto,

1

Luisa Marı´a Sandalio,

2

Javier Paz-Ares,

1

and Antonio Leyva

1,

*

1Department of Plant Molecular Genetics, Centro Nacional de Biotecnologı´a (CNB-CSIC), Darwin 3, Campus de Cantoblanco, 28049 Madrid, Spain

2Department of Biochemistry, Plant Molecular and Cellular Biology, Estacio´n Experimental del Zaidı´n-CSIC, Profesor Albareda 1, 18008 Granada, Spain

3These authors contributed equally to this work

4Present address: CBGP (UPM-INIA), Parque Cientı´fico y Tecnolo´gico, UPM, Campus de Montegancedo, Ctra M40 Km 38, 28223 Pozuelo de Alarco´n, Madrid, Spain

5Present address: Departamento de Ecologia Funcional, Instituto de Ecologı´a, Universidad Nacional Autono´ma de Me´xico, Ciudad Universitaria, circuito exterior. Coyoaca´n 04510 DF Me´xico

*Correspondence: DOI10.1016/j.devcel.2012.04.008

In plants, developmental programs and tropisms are modulated by the phytohormone auxin. Auxin recon-figures the actin cytoskeleton, which controls polar localization of auxin transporters such as PIN2 and thus determines cell-type-specific responses. In conjunction with a second growth-promoting phyto-hormone, brassinosteroid (BR), auxin synergistically enhances growth and gene transcription. We show that BR alters actin configuration and PIN2 localiza-tion in a manner similar to that of auxin. We describe a BR constitutive-response mutant that bears an allele of theACTIN2 gene and shows altered actin configuration, PIN2 delocalization, and a broad array of phenotypes that recapitulate BR-treated plants. Moreover, we show that actin filament reconfigura-tion is sufficient to activate BR signaling, which leads to an enhanced auxin response. Our results demon-strate that the actin cytoskeleton functions as an integration node for the BR signaling pathway and auxin responsiveness.

Auxin is an essential plant phytohormone with a major role in the organization of directional growth during the establishment of developmental programs and tropisms. Several observations indicate that these growth patterns are tightly controlled by auxin gradients (Benjamins and Scheres, 2008; Kleine-Vehn and Friml, 2008; Leyser, 2006; Rahman et al., 2010; Vanneste and Friml, 2009), which are established by a finely tuned auxin efflux/influx transport system (Wisniewska et al., 2006). Auxin efflux transport

is modulated by the amount and correct polar localization of the PIN-FORMED (PIN)transporters, which cycle constantly between the plasma membrane and endosomal compartments (Dhonukshe et al., 2007, 2008b; Geldner et al., 2001; Steinmann et al., 1999). This dynamic process provides a precise spatial and cell-type-specific auxin response, leading to a coordinated growth pattern; trafficking of PIN transporters is thus essential for auxin responsiveness. Pharmacological evidence supports the dependence of vesicle motility on actin cytoskeleton dynamics (Friml et al., 2002; Geldner et al., 2001; Grebe et al., 2003). Actin-depolymerizing drugs impair auxin transporter localization, which in turn alters auxin-mediated responses such as gravitropisms (Hou et al., 2003; Yamamoto and Kiss, 2002). Correct organization of actin filaments is thus necessary for appropriate auxin responsiveness.

Auxin interacts with brassinosteroids (BR), another phytohor-mone, whose responses overlap with those of auxin; in general, these two hormones operate in a synergistic manner (Halliday, 2004; Hardtke, 2007). BR enhances classical auxin growth responses such as hypocotyl elongation (Nakamura et al., 2006; Nemhauser et al., 2004), lateral root number (Bao et al., 2004), and gravitropic response (Kim et al., 2000; Li et al., 2005). This auxin:BR interplay is also evident at the transcriptional level. Microarray analysis showed that several genes respond synergistically when plants are exposed to auxins and BR in combination, in accordance with observa-tions for growth responses (Goda et al., 2004; Nakamura et al., 2003a, 2003b; Nemhauser et al., 2004; Vert et al., 2005, 2008).

The molecular basis of auxin:BR interdependence is still uncertain, although auxin control of BR biosynthesis has been demonstrated (Chung et al., 2011; Yoshimitsu et al., 2011; Mou-chel et al., 2006). Expression of DWARF4, which encodes a

rate-limiting enzyme for the BR biosynthetic pathway, is upregulated by auxin (Chung et al., 2011; Yoshimitsu et al., 2011). In addition,

BREVIS RADIX (BRX), an auxin-inducible transcription factor,

</div>Trang 2<div class="page_container" data-page="2">

activates expression of another rate-limiting enzyme for BR

biosynthesis, CONSTITUTIVE PHOTOMORPHOGENESIS AND

DWARF (CPD) (Mouchel et al., 2006).

Here we studied whether the actin cytoskeleton acts as a node of convergence in BR and auxin signaling. We show

that, in Arabidopsis, BR alters the actin cytoskeleton in an

auxin-like manner by unbundling actin filaments. Actin cytoskel-eton reorganization in response to BR correlates closely with enhanced auxin sensitivity. We also identify a mutant allele of

the ACTIN2 gene that causes a phenotype identical to that in

BR-treated plants. The mutant plant displays constitutively enhanced auxin responsiveness, with phenotypes and tran-script profiles that mirror BR constitutive signaling mutants. These observations provide genetic evidence that alterations in actin cytoskeleton configuration are sufficient to account for BR response activation, and they indicate that the cytoskel-eton is a convergence point for BR signaling and auxin responsiveness.

BR Alters Actin Configuration

Auxin increases the unbundling of actin filaments, leading to enhancement of auxin responsiveness (Nick et al., 2009). Since BR enhances some auxin responses (Vert et al., 2008), we eval-uated the effect of BR on actin cytoskeleton configuration. In vivo

F-actin imaging was performed on roots of Arabidopsis

seed-lings, using transgenic plants expressing the second actin-binding domain of fimbrin tagged with the green fluorescent

protein (ABD2:GFP) (Sheahan et al., 2004; Voigt et al., 2005). Long,intenselyfluorescentfilamentswereobservedin epidermal root cells (Figure 1A). Treatment with the brassinoste-roid 24-epibrassinolide (eBL) had a notable effect, rendering a faint fluorescent signal in actin filaments, with finer, shorter actin strands that move faster than in untreated plants (Movies S1andS2available online). The configuration was similar in plants exposed to the auxin indole-3-acetic acid (IAA) (Figure 1A).

Figure 1. BR Alters Actin Filament Organization and PIN2 Localization in Wild-Type Roots

(A) Confocal analysis of actin configuration in 5-day-old plants grown on vertical LN-MS plates and transferred to liquid media. Plants were untreated (Col-0) or treated with 5 nM eBL (2 hr, Col-0 eBL) or 50mM IAA (1 hr, Col-0 IAA). Bar = 10 mm.

(B) Quantification of actin filament displacement in untreated wild-type plants (eBL 0 nM) or plants treated with 5, 10, or 20 nM eBL (3 hr). Error bars represent SD. (C) Actin filament configuration in untreated wild-type plants (eBL 0 nM) or treated with 5, 10, or 20 nM eBL (3 hr).

(D) Percentage of mobile filaments (PMF; left) and skewness (right) (seeExperimental Procedures) in 5-day-old wild-type plants grown on vertical plates and transferred to liquid medium, alone or with 10 nM eBL (2 hr). Error bars indicate SD.

(E) Localization of PIN2 transporters in epidermal cells in untreated plants (Col-0) or plants treated with 5 nM eBL (2 hr, Col-0 eBL) or 50mM IAA (1 hr, Col-0 IAA). Arrows indicate PIN2 depolarization. Bar = 5mm. Asterisks in (B) and (D) indicate significant differences relative to untreated Col-0 plants (eBL 0 nM) (p < 0.05, Student’s t test).

Filament displacement in eBL-treated plants was almost twice as fast as in untreated plants (Figure 1B). An increase in eBL concentration to 20 nM arrested filament displacement, although actin configuration remained altered (Figure 1C). We used two indicators to quantify actin cytoskeleton reconfiguration: percentage of mobile filaments (PMF), based on a recently described parameter (Ueda et al., 2010), and skewness, an accurate indicator for bundling quantification (Higaki et al., 2010). In eBL-treated plants, the PMF value was notably higher and skewness significantly lower than in untreated wild-type plants, in accordance with the presence of unbundled mobile filaments (Figure 1D).

Auxin transporter localization is dependent on actin filament configuration (Dhonukshe et al., 2008a; Geldner et al., 2001;

Figure 2. Phenotypic Characterization of the wavy1-1 Mutant

(A) Root-growth phenotype of Col-0 and wavy1-1 plants,

grown 5 days on vertical plates alone or with 5 nM eBL.

(B) Root wave-number quantification in Col-0 and wavy1-1

seedlings grown 5 days on vertical plates alone or with different eBL concentrations. Error bars show SD. *Significant differences relative to Col-0 plants in each treatment; Student’s t test, p < 0.05.

(C) wavy1-1 bending phenotype in stems and siliques,

rosette leaves, flower organs, and cauline leaves.

(D) Root-growth phenotypes of wild-type (Col-0), act2T-DNA null allele (act2-TDNA), bzr1-1D, and act2-5 plants

grown 5 days on vertical plates. See alsoFigure S1.

Kleine-Vehn et al., 2006). We thus analyzed the localization of the PIN2 transporter in the presence of eBL and IAA using a transgenic line expressing a PIN2:GFP fusion protein (Xu and Scheres, 2005). PIN2 polar localization was partially altered in the presence of eBL and was also depolarized in auxin-treated plants (Figure 1E). BR-induced changes in actin configuration thus alter PIN2 polar localization in a manner similar to that of auxin.

Identification of Mutants Displaying a Wavy-Root Phenotype

Mislocalization of PIN2 in response to eBL was consistent with a constitutive rhythmic wavy-root phenotype when plants were grown on vertical plates (Figure 2A). To identify genes involved in this cytoskeleton-mediated auxin and BR interplay, we screened 50,000 seedlings from an ethyl methanesulfonate-mutagenized M2 Columbia (Col-0) population to search for mutants with a wavy-root phenotype. We identi-fied one mutant with constitutive, regular wavy

growth in roots, wavy1-1 (Figure 2A). The root mutant phenotype perfectly mimics that of eBL-treated wild-type plants. In mutant plants treated with eBL at concentrations up to 5 nM, the wavy-root phenotype was unaltered, sug-gesting that wavy growth response to BR is

saturated in the wavy1-1 mutant (Figure 2A). Wild-type plants exposed to the same eBL concentration range showed a BR dose-response for root wave number (Figure 2B). Higher eBL concentrations provoked extreme microtorsions that in turn altered root growth and abolished the wavy-root phenotype in

mutant and wild-type roots. wavy1-1 showed no alterations in

root development other than the shorter root hairs and the wavy phenotype; root length and lateral root number were similar to those in wild-type plants (see below). This mutant also showed a broad array of constitutive bending and twisting phenotypes in elongating organs of the aerial part of the plant, including petals, leaves, and silique peduncle (Figure 2C). Some of these pheno-types show a striking resemblance to the BR

constitutive-response mutants bzr1-1D and bes1-D (Wang et al., 2002; Yin

</div>Trang 4<div class="page_container" data-page="4">

et al., 2002). When grown on vertical plates, the constitutive BR

signaling mutant bzr1-1D had a wavy-root phenotype (Figure 2D).

Genetic analysis showed that wavy1-1 behaved as recessivewhen crossed with wild-type ecotypes Col-0 or Landsberg erecta(Ler). Positional cloning of the mutation that caused the wavy-rootphenotype mapped the wavy1-1 locus to chromosome III, neara genomic region of BAC MVE11, which contains the ACTIN2gene. DNA sequencing of the ACTIN2 locus showed that it bearsa single point substitution (Arg-179 to Cys) in the wavy1-1 mutant

(Figure S1A). Transformation of the mutant with ACTIN2 cDNAunder the control of a 1.6 kb ACTIN2 promoter (Ringli et al., 2002) rescued the mutant phenotype (Figure S1B). We therefore

renamed the wavy1-1 mutant act2-5, following establishednomenclature for actin2 mutant alleles (Nishimura et al., 2003).

In our growth conditions, the act2-TDNA null allele had a

wavy-root phenotype, weaker than, but similar to, that of eBL-treated plants (Figure 2D), which prompted us to study the interallelic

interaction between act2-TDNA and act2-5 mutant alleles.

act2-5 behaved as a recessive mutation in an F1 cross with

wild-type plants, whereas it behaved as semidominant with

respect to the null act2-TDNA allele, since F1 plant phenotypes

ranged from strong to weak wavy phenotypes (Figure S2). We obtained transgenic plants that overexpress the act2-5 mutant protein under the control of an estradiol-inducible promoter (Zuo et al., 2000) in wild-type or in act2-TDNA plants. In the

pres-ence of estradiol, act2-5 protein-expressing wild-type plants did not show the wavy-root phenotype (Figure 3A). When we

expressed the mutated protein on the act2-TDNA background,

however, all estradiol-exposed plants showed a wavy-root phenotype (Figure 3B). Quantification of curl number in two inde-pendent lines showed intermediate curl intensity phenotypes (Figure 3C). We concluded that, overall, act2-5 behaves as

a semidominant negative mutation versus the null allele,

depen-dent on the dose of functional ACTIN alleles.

act2-5 Mutant Shows Altered Actin Cytoskeleton Configuration and PIN2 Delocalization

Wavy root growth in act2-5 plants was similar to that in

BR-treated wild-type roots. Since this phenotype was associated

with actin filament reconfiguration, we analyzed actin

cytoskel-eton status in the act2-5 mutant. We extended the study to

act2-TDNA and to the constitutive BR response mutant bzr1-1D, both of which have a wavy-root phenotype similar to that

of act2-5. We introduced a construct expressing the ABD2:GFP

fusion protein by crossing on the distinct backgrounds, and

visu-alized actin filaments in vivo by confocal microscopy. act2-5

showed trimmed, diffuse actin filaments (Figure 4A). In real-time live-cell microscopy, actin filament mobility was enhanced on the mutant background (Movie S3). The act2-5 mutant had

the highest PMF and lowest skewness values, consistent with the presence of mobile and unbundled filaments in the mutant (Figures 4B and 4C). Actin filament status is therefore altered in

the act2-5 mutant and resembles that of eBL-treated wild-typeplants. PIN2 localization was partially depolarized in act2-5,

which also resembles eBL-treated wild-type plants (Figure 4A). These observations support the idea that the wavy-root phenotype correlates with altered actin cytoskeleton

configura-tion and delocalized PIN2 distribuconfigura-tion. Furthermore, all act2-5

phenotypes recapitulated that of eBL-treated wild-type plants.

eBL treatment of act2-5 did not further enhance actin

cytoskel-eton reconfiguration or PIN2 delocalization, suggesting that both responses were saturated in the mutant background (Figures S3A and S3B). We compared actin cytoskeleton

config-uration and PIN2 localization in the act2-TDNA and bzr1-1Dmutants to that of act2-5. act2-TDNA and bzr1-1D showed

PIN2 polar delocalization as well as shorter, thinner actin

fila-ments compared to wild-type plants, closely resembling act2-5

(Figure 4A andMovies S4andS5). act2-TDNA nonetheless

also had parallel fiber bundles and fewer thin filaments; based on the presence of bundled filaments, PMF and skewness values

did not differ significantly from wild-type. In contrast, bzr1-1D

had a clear intermediate actin cytoskeleton configuration status, in accordance with their PMF and skewness values (Figure 4B

and 4C). All mutants examined, 5, bzr1-1D, and

act2-TDNA, thus showed close association between altered actin fila-ment configurations and PIN2 transporter delocalization, which supports a role for the actin cytoskeleton in PIN2 localization.

Furthermore, bzr1-1D mimics act2-5 phenotypes to a great

Figure 3. act2-5/Col-0 and act2-5/act2-TDNA Interallelic Interaction

(A) Analysis of the wavy-root phenotype in Col-0, act2-5

and in the inducible overexpressor lines expressing act2-5 on the Col-0 background (oxact2-5;Col-0). Plants were grown on vertical plates alone ( Est) or with 10 mM estradiol (+Est).

(B) Analysis of the wavy-root phenotype in the act2 T-DNAnull allele mutant (act2-TDNA) and the act2-5 inducible

overexpressor line on the act2-TDNA background

(oxact2-5;act2-TDNA). Plants were grown on vertical

plates alone ( Est) or with 10mM estradiol (+Est).

(C) Quantification of root waves in TDNA in two act2-5-inducible overexpressor lines on the act2-TDNA back-ground (oxact2-5;act2-TDNA, lines 1 and 2) and in theact2-5 mutant alone ( Est) or with 10mM estradiol (+Est). Error bars indicate SD. *Significant differences relative to

act2-TDNA in each treatment; Student’s t test, p < 0.05.

extent, indicating a connection between BR signaling and actin cytoskeleton configuration.

act2-5 Mutants Show an Enhanced Auxin Response

The act2-5 phenotype reflects the rippled-pattern phenotype

observed when wild-type plants are grown on inclined agar plates; this phenotype is mediated by gravitropism and basipetal auxin transport (Rashotte et al., 2000; Simmons et al., 1995). BR enhances the gravitropic response, which depends strictly on auxin gradients (Rahman et al., 2010; Rashotte et al., 2000; Su-kumar et al., 2009); this gravity-driven response is thus a good example of auxin-BR interdependence. To test whether the

gravitropic response is stimulated in act2-5, we evaluated the

kinetics of gravistimulation in this mutant compared to parental Col-0 plants. eBL-treated wild-type plants showed an enhanced gravitropic response, with kinetics and response magnitude

similar to those in untreated act2-5 plants (Figure 5A). Compar-ative time course measurements showed that the root gravi-tropic response in the mutant was more rapid than in wild-type

plants, indicating that act2-5 plants are hypersensitive to

gravitropic stimuli (Figure 5A). As for the wavy-root phenotype,

gravistimulation kinetics in act2-5 plants was unaltered by eBLtreatment. The act2-TDNA mutant also showed an increasedgravitropic response, although it was slower than in act2-5

(Figure 5A). In the presence of eBL, however, the act2-TDNAgravitropic response was identical to that of the act2-5 mutant

(Figure 5A); in addition, the wavy-root phenotype in act2-TDNAwas intermediate between act2-5 and wild-type plants ( Fig-ure 5B). Root curl number was enhanced in the act2-TDNA

mutant in response to eBL (Figures 5B and 5C), mimicking the

act2-5 mutant (Figure 5C). Root curl intensity in response to eBL thus correlates with enhanced gravitropic kinetics, and

both responses are saturated in the act2-5 mutant.

Another example of auxin:BR interaction is the induction of lateral root primordia (LRP) and subsequent development of lateral roots. BR alone increases lateral root number, although to a lesser extent than auxin; when plants are exposed to a combination of auxin and BR; however, lateral root number

Figure 4. Wavy-Root Phenotype Correlates with Altered Actin Configuration and PIN2 Localization Images at left show actin configuration and those at right show PIN2 localization.

(A) Confocal analysis of actin filament configuration and PIN2 polar localization in 5-day-old seedlings of Col-0,

act2-5, bzr1-1D and act2 T-DNA null (act2-TDNA) grown

on vertical plates. Arrows indicate PIN2 depolarization. Scale bar = 10mm for actin; 5 mm for PIN2 panels. (B and C) PMF (B) and skewness (C) in 5-day-old wild-type plants grown on vertical plates. Error bars represent SD. Asterisks in (B) and (C) indicate significant differences relative to Col-0 plants; Student’s t test, p < 0.05. See

Figure S3andMovies S3andS4.

increases (Bao et al., 2004). As we found that

act2-5 has a constitutive wavy-root phenotype,

and root bending is reportedly sufficient to promote lateral root formation (Laskowski et al., 2008), we determined lateral root number on the mutant background. We first analyzed the expression pattern of wild-type and mutant plants express-ing the GUS protein under the control of the

auxin:BR-respon-sive synthetic promoter DR5; this construct is considered an

excellent marker for monitoring LRP formation (Ulmasov et al., 1997). LRP number was notably enhanced in the act2-5 mutant

(Figure S4). Following eBL treatment, wild-type seedlings

phe-nocopied untreated act2-5, whereas LRP number did not further

increase in the mutant (Figure S4). Although the mutant had more LRP than wild-type, the number of emerged lateral roots was not constitutively enhanced on the mutant background. In contrast to previous observations (Bao et al., 2004), in our growth

condi-tions, BR did not enhance lateral root number in act2-5 or

wild-type plants (Figure 5D). act2-5 plants nonetheless developed

more lateral roots than did wild-type plants in response to auxin (Figure 5D). Lateral root number was also stimulated by IAA in the

act2-TDNA mutant, although to a lesser extent than in act2-5

(Figure 5D). The number of lateral roots developed in IAA-treated

act2-5 plants was similar to that seen in wild-type plants treated

with eBL combined with IAA (Figure 5D). The synergistic effect of BR on the promotion of lateral roots in response to IAA is thus

constitutive in the mutant, and act2-5 is consequently

hypersen-sitive to auxin.

BR Transcriptional Response Is Upregulated in the act2-5 Mutant

We examined whether the BR constitutive phenotypes shown by

the act2-5 mutant, including BR-mediated auxin responses,

were manifested at the transcriptional level. We performed

RT-PCR in five auxin-responsive genes (IAA5, IAA6, IAA19,

BEE1, and BAS1), which are strongly upregulated in response

to a combination of auxin and BR (Goda et al., 2004; Nemhauser et al., 2004; Vert et al., 2005). All genes analyzed were upregu-lated in wild-type plants after 1mM IAA treatment; expression was further enhanced if IAA was combined with 1mM eBL ( Fig-ure 6A). act2-TDNA responses to both hormones were identical

to those for similarly treated wild-type plants. In contrast, auxin

responsiveness was higher in act2-5 than in wild-type plants

(Figure 6A). In four of the five genes analyzed, the induction level

</div>Trang 6<div class="page_container" data-page="6">

in the IAA-treated act2-5 mutant was identical to that in wild-type

plants treated with both IAA and eBL.

For a comprehensive comparison of transcriptome profiles

between wild-type and act2-5 plants, we hybridized Affymetrix

oligonucleotide microarrays representing approximately 22,000

Arabidopsis genes with RNA from three replicates of wild-type

or act2-5 mutant seedlings. In this analysis, 306 genes were up-regulated and 92 downup-regulated in the act2-5 mutant (cut-off

values 1.5-fold, false discovery rate <0.05;Table S1;Figure 6B). Comparison of these results with previous microarray data for auxin- and BR-treated seedlings (Nemhauser et al., 2004; Yu et al., 2011) showed significant overlap between auxin/BR-regulated genes and genes with altered expression on the

act2-5 background. More than 30% of the upregulated genes

were BR-inducible (Figure 6B). A significant number of

upregu-lated genes in the act2-5 mutant is therefore BR-reguupregu-lated. Wecompared act2-5-upregulated genes with the in vivo direct

targets of BZR1, a key transcription factor of the BR response (Sun et al., 2010). Nearly 40% of act2-5-upregulated genes

Figure 5. eBL Stimulation of Gravitropic Response and Lateral Root Number Are Activated inact2-5

(A) Time course measurement of the gravitropic

response in Col-0, act2-5, and act2-TDNA plants,

untreated or treated with 10 nM eBL. Error bars show SD.

(B) Wavy-root phenotype in 5-day-old Col-0,

act2-5, and act2-TDNA plants grown on vertical

plates alone or at various eBL concentrations. (C) Quantification of wave number per cm of the

main root in Col-0, act2-5, and act2-TDNA alone

( eBL) or at distinct eBL concentrations. Error bars indicate SD.

(D) Quantification of emerged lateral roots per cm of main root (see Experimental Procedures) in

Col-0, act2-5, and act2-TDNA alone ( eBL-IAA) or

treated with 2 nM eBL, 50 nM IAA, or both. Error bars indicate SD. Asterisks in (C) and (D) indicate significant differences relative to Col-0 plants in each treatment; Student’s t test, p < 0.05. SeeMovies S4andS5.

were direct BZR1 targets (Figure 6B), as confirmed by RT-PCR analysis of five direct BZR1 target genes (Figure 6C). Estradiol-mediatedact2-5expression

on the act2-TDNA background induced

BZR1 target gene expression after 3 hr exposure to estradiol, which closely

mimicked bzr1-1D (Figure 6C).

BZR1 Phosphorylation Status Is Affected inact2-5 Mutant

The striking overlap between act2-5

up-regulated genes and direct BZR1 targets led us to test whether ACTIN2 modulates BZR1 activity. Since BZR1 protein is negatively regulated by phosphorylation (He et al., 2002), we examined BZR1 phosphorylation status in wild-type and

act2-5 mutant plants expressing a chimeric BZR1-cyan

fluores-cent protein (CFP) (Wang et al., 2002). BZR1 was fully

dephos-phorylated on the act2-5 background, whereas in wild-type

plants, full BZR1 dephosphorylation was observed only after eBL treatment (Figure 6D). The BR signaling pathway was thus constitutively activated in the mutant. The actin cytoskeleton thus acts as a major factor in BR signaling and hence, in the stim-ulation of the BR-mediated auxin response.

Phytohormones frequently have overlapping responses, whichcan help to regulate continuous growth adaptation to environ-mental cues. Shared BR and auxin responses are exceptionalamong phytohormones since, in combination, they enhancegrowth responses and transcriptional regulation synergistically(Nemhauser et al., 2004; Vert et al., 2008). Despite this intriguingmode of interplay, the underlying molecular mechanisms arealmost unknown. Here we found that the actin cytoskeleton

</div>Trang 7<div class="page_container" data-page="7">

acts as a major factor in the confluence and integration of the BR signaling pathway and auxin responsiveness, functioning as a node of interaction of these two hormone pathways.

Auxin transport inhibitors bundle actin microfilaments, re-stricting actin filament displacement and altering auxin efflux transport (Dhonukshe et al., 2008a). Auxin counteracts this effect by unbundling and shortening the cytoskeleton strands (Nick et al., 2009). Indeed, auxin itself modulates its own transport simply by fine-tuning the configuration of the actin microfila-ments, providing a self-regulatory mechanism for auxin sensi-tivity (Holweg et al., 2004; Maisch and Nick, 2007; Nick, 2010; Paciorek et al., 2005; Waller et al., 2002). These data indicate that actin cytoskeleton remodeling has a prominent role in the correct establishment of auxin gradients, thus modulating auxin responses throughout the plant. We show that BRs alter cyto-skeletal configuration in a manner similar to that of auxin. More-over, BR-induced actin cytoskeleton reconfiguration causes delocalization of the PIN2 transporters, which promotes the auxin response.

BR stimulates the gravitropic response (Kim et al., 2000; Li et al., 2005), as well as the promotion of lateral roots (Bao et al., 2004). Disruption of the actin cytoskeleton by actin-depo-lymerizing drugs enhances gravitropism (Hou et al., 2003; Yama-moto and Kiss, 2002). We found that BR causes wavy root growth, a phenotype that resembles plants grown on inclined agar plates. Root bending requires an intact gravitropic response (Simmons et al., 1995) and itself promotes lateral root initiation (Ditengou et al., 2008; Laskowski et al., 2008).

The root bending phenotype observed here in response to BR might therefore be sufficient to enhance both the gravitropic response and the promotion of lateral root primordia, suggesting that screening for mutants with constitutive wavy root growth could help to identify genes involved in auxin/BR interplay.

The screening identified act2-5, a mutant allele of the ACTIN2gene; act2-5 mutants show an altered actin cytoskeleton

config-uration and, concomitantly, enhanced BR-mediated auxin

responsiveness. Characterization of act2-5 provided strong

evidence for a role of the cytoskeleton as a major link between

BR signaling and BR-mediated auxin responses. act2-5

cyto-skeleton yielded lower skewness numbers, in accordance with unbundled, short cytoskeletal strands (Higaki et al., 2010), similar to those in auxin- or BR-treated wild-type plants. Furthermore, the actin configuration of the constitutive BR signaling mutant

bzr1-1D resembled that of act2-5. act2-5 mutant seedlings also

showed an enhanced gravitropic response and, in response to auxin, increased lateral root formation. These phenotypic traits, together with the extreme root-curling growth habit of these plants, evoke the phenotype of BR-treated wild-type plants and suggest an enhanced BR response in the mutants. Enhanced BR signaling explains the auxin-hypersensitive response of

act2-5 seedlings (Vert et al., 2008); consistent with this hypoth-esis, no additional changes were observed in wavy root growth,

lateral root number, or gravitropic response in act2-5 seedlings

after BR treatment, indicating a saturated BR response. The

act2-TDNA mutant phenotype was intermediate, and was

exac-erbated after act2-5 expression or BR treatment, mimicking that

Figure 6. BR Signaling is Constitutively Activated inact2-5

(A) Gene expression analysis of auxin:BR-responsive genes. Relative expression of IAA5, IAA6, IAA19, BEE1, and BAS1 in wild-type, act2-5, and act2-TDNA

plants in response to IAA or IAA and eBL. Plants were grown for 5 days on vertical plates and transferred to liquid medium for treatment with 1mM IAA (IAA), or 1mM IAA and 1 mM eBL (IAA+eBL) (30 min) before RNA extraction. Error bars represent SD.

(B) Analysis of microarray data. Genes with significant expression in act2-5 versus Col-0 plants were compared to BZR1 target genes (Sun et al., 2010) or genes significantly up- or downregulated (>23) by eBL or IAA (seeYu et al., 2011; Nemhauser et al., 2004). Table includes the size of observed overlap and expected size in case of random distribution. Significant overlaps are highlighted in bold (c2

test, p < 0.05).

(C) qRT-PCR of BZR1 target genes in act2-TDNA and act2-5 mutants, and in the inducible overexpressor line oxact2-5;act2-TDNA, alone ( Est) or with estradiol

(+Est). Plants were grown for 5 days on vertical plates and transferred to liquid medium for estradiol treatment (10mM, 3 hr). Data were normalized to untreated

act2-TDNA conditions. Error bars show SD.

(D) Western blot analysis of 5-day-old BZR1-CFP seedlings grown in darkness in LN-MS medium supplemented with 1mM brassinazole. Seedlings were placed in liquid medium alone ( eBL) or treated with 1mM eBL (+eBL) for 2 hr prior to harvest. Ribulose-1,5-bisphosphate carboxylase oxygenase (RuB) was used as a loading control.

of act2-5 plants. This indicates that act2-5 behaves as a

semi-dominant negative mutation versus the null allele, depending on

the dose of functional ACTIN alleles, and that it causes actin

cyto-skeleton reconfiguration similar to that induced by BR, leading to a constitutively activated response to BR.

Auxin:BR interdependence is not restricted to growth responses but also applies to transcriptional regulation.

BR-responsive genes are upregulated in act2-5 seedlings;

accord-ingly, auxin alone is sufficient to induce high gene expression levels, similar to those observed in wild-type plants after combined BR and auxin treatment. Enhanced activation of these genes correlates with accumulation of the active, nonphos-phorylated form of BZR1, considered a biomarker for activated BR signaling. Indeed, BZR1 target gene expression was activated immediately at 3 hr after act2-5 induction on the

act2-TDNA background. These results demonstrate direct actin

cytoskeleton feedback to BR signaling and show that auxin responsiveness and BR signaling interact through a primary effect on actin cytoskeleton configuration. In conclusion, the

identification of an ACTIN2 mutant allele with constitutive

BR-triggered auxin hypersensitivity establishes the actin cytoskel-eton as a crucial node at which BR signaling and BR-mediated auxin responses are integrated.

EXPERIMENTAL PROCEDURES Plant Material and Growth Conditions

All Arabidopsis thaliana plants used in this study, including mutants and

trans-genic plants, were on the Columbia (Col-0) background. We used seeds of

previ-ously termed act2-3 (Nishimura et al., 2003), BZR1-CFP (Wang et al., 2002),

Scheres, 2005). Homozygous lines of ABD2:GFP, PIN2:GFP, and BZR1:CFPon the act2-5, act2-TDNA, and bzr1-1D backgrounds were obtained by

crosses and selection. Growth conditions were as described (Catarecha et al., 2007), except for darkness treatment. Root-growth phenotypes were observed in 5 day plants grown on vertical plates in modified Murashige and Skoog medium (Murashige and Skoog, 1962) with reduced nitrate content (LN-MS), in which 95% KNO3was replaced with 95% K2SO4and 0.5% sucrose. For specific experiments, auxin (IAA) and brassinosteroid (eBL) concentrations are indicated.

Plasmid Construction and Plant Transformation

A Gateway-compatible fragment bearing the ACT2 or act2-5 ORF was PCR-amplified from cDNA from wild-type or act2-5 mutant plants, respectively,

using primers Act2F, ggggacaagtttgtacaaaaaagcaggctcaatggctgaggctgat gatattc, and Act2R, ggggaccactttgtacaagaaagctgggtcttagaaacattttctgtgaa. PCR products were purified and cloned by LR recombination, according to manufacturer’s recommendations (Invitrogen, Paisley, Scotland), into the binary vector pMDC7, which has the CaMV 35S promoter and a human estrogen receptor regulatory region (Zuo et al., 2000). Prior to transformation of Agrobacterium, the expression construct was sequenced. A binary vector

containing the ACT2 or act2-5 ORF was introduced into Agrobacteriumtumefaciens strain C58C1. A. thaliana Col-0 and the mutants act2-5 andact2-TDNA were transformed by dipping the flowers in MS medium with Silwet

L77 (Bechtold et al., 1993). Transgenic seedlings were selected on medium containing 30 mg/l hygromycin. For further analyses, T1 segregation ratios were analyzed to select transformants with one T-DNA insertion and to isolate T3-homozygous plants. Other standard procedures were as described (Sambrook et al., 1989), except where indicated.

Confocal Microscopy, Image Analysis, and Quantification

For static images, maximum projections of 12 z-stacks with a fixed 2mm z-distance were generated on a Leica SP5 microscope with a 633 1.2 NA

water immersion objective (zoom 1.0, field 246 3 246 mm scanned at 10243 1024 pixels). Pinhole was set to 1.4 Airy units, and laser and PMT settings were adjusted to avoid under-/overexposed pixels; signal-to-noise ratio was increased by averaging eight times (line-averaging mode). Settings were identical for all samples. For time-lapse imaging, laser and PMT settings were identical; pinhole was set to 3.5 Airy units to allow tracking of filaments moving out of the direct confocal plane and to alleviate potential slight focus drift. A 5123 512 pixel field was scanned at zoom 2.0 (123 3 123 mm field. T was 60 s, line average 4, and 23 frames were captured per movie.

All image analyses were performed in FIJI distribution of ImageJ 1.46a ( For actin displacement measurements, we used a modification of the method ofVan Bruaene et al. (2004). Two 3D stacks (x, y, z at 0.5mm intervals) from single cells were acquired at 1 min intervals and maximum projections analyzed by image subtraction using Volocity (Improvision, Coventry, UK), to yield the filament displacement distance. For analysis of skewness, we used an approach similar to that ofHigaki et al. (2010); maximum projections of static image stacks were generated, Gaussian blur at 1.7 px radius applied and skeletonized with the ThinLine function of the Kbi_2d-filter package plugin ( KbiFilter2d). Skewness parameters were obtained by the line features function of the package for the entire frame, comprising four cells. At least 60 cells/ sample were measured. For PMF, we used the preprocessing stage of the Kbi_Flow analysis plugin (Ueda et al., 2010), which sectorizes a time-lapse stack and detects changes due to motion in each sector. The plugin returns number of mobile and static image sectors; the percentage of mobile sectors was calculated. Only parts with clearly visible filaments were analyzed by adequate masking. Each stack normally corresponds to three cells with clearly visible filament areas; at least 30 areas/sample were measured.

Root Measurements

Plants were cultured for 5 days on vertical LN-MS plates before transfer to the same medium supplemented with 50 nM IAA, 2 nM eBL, or both. After 3 days culture, apparent rootlets and root buds were counted with the aid of a dissect-ing microscope essentially as described (Bao et al., 2004). Root waving was analyzed using ImageJ in plants sown on LN-MS vertical plates, alone or

sup-plemented with 2 or 5 nM eBL. To avoid root wave disturbance, DR5:GUS lines

wereb-glucuronidase (GUS)-stained (Catarecha et al., 2007) in the plates in which plants were grown. Gravitropic response was analyzed in 5-day-old plants sown on vertical plates and covered with a layer of medium to prevent root bending. Plants were grown for 5 days, alone or supplemented with 10 nM eBL; they were then turned 90, and the curvature angle of the main root was measured with ImageJ after 3, 9, and 24 hr.

Identification and Positional Cloning of theact2-5 Mutation

An Arabidopsis EMS-mutagenized population from Lehle’s collection wasscreened on vertical plates and wavy1-1 was selected. Mutant homozygous

plants were backcrossed three times to wild-type Col-0 plants. Seeds from

the last self-pollinated progeny were crossed to Landsberg erecta (Ler)

ecotype, and 100 7-day-old F2 individuals screened for wavy phenotype in vertical plates. Genomic DNA was extracted (Dellaporta et al., 1983) from selected mutant F2 individuals and mapped using cleaved amplified poly-morphic sequence, simple sequence length polymorphism markers (Bell and Ecker, 1994; Konieczny and Ausubel, 1993), and other PCR-based markers from the Monsanto Arabidopsis Polymorphism and Ler Sequence Collections ( The construct used for complementation of the mutation was described byRingli et al. (2002).

Microarray Studies

Transcriptomic analyses were performed using the Affymetrix ATH1 platform.

Three replicates of wild-type and act2-5 seedlings were grown on 0.53 MS medium (8 days) before harvest and storage at 80C. RNA was isolated with TriReagent and Plant RNA Isolation Aid (Ambion, Austin, TX, USA), fol-lowed by cleanup with the RNeasy Mini Kit (QIAGEN, Venlo, The Netherlands). Biotin-labeled cRNA was synthesized using One-Cycle target labeling and control reagents (Affymetrix, Shanghai, China), and fragmented into 35–200

bases. Each replicate was hybridized independently to the Arabidopsis

ATH1 genome array (Affymetrix). Microarrays were washed and stained with

</div>Trang 9<div class="page_container" data-page="9">

streptavidin-phycoerythrin and scanned at 2.5mm resolution in a GeneChip Scanner 3000 7G System (Affymetrix). Data were analyzed using GeneChip Operating Software and the affylmGUIR package (Wettenhall et al., 2006). The Robust Multi-Array Analysis algorithm was used for background correc-tion, normalizacorrec-tion, and expression-level summarization (Irizarry et al., 2003).

Differential expression analysis was performed with the Bayes t-statistics

from the linear models for microarray data (limma). p values were corrected for multiple-testing using the Benjamini-Hochberg method (false discovery rate) (Reiner et al., 2003). Data discussed here are deposited in the NCBI Gene Expression Omnibus (Edgar et al., 2002), accessible through GEO Series Accession No. GSE27077.

Gene Expression Analysis

RNA was isolated from A. thaliana using TRIzol (Invitrogen). For cDNA

synthesis, we used 2 mg RNA with the High-Capacity cDNA Archive Kit (Applied Biosystems, Foster City, CA, USA). Quantitative PCR (qRT-PCR) reactions were performed in the Applied Biosystems 7300 real-time PCR system using FastStart Universal SYBR Green Master-Rox (Roche, Basel, Switzerland); three biological replicates were analyzed in each case. CTvalues were obtained with 7300 Systems SDS software v.1.4 (Applied Biosystems). Relative expression changes were calculated by the comparative CTmethod;

difference between the CTvalue and the CTvalue of EF1a. DDCTwas the difference betweenDCTand the CTvalue of the calibrator. Primers used in quantitative PCR reactions are shown in the Supplemental Experimental Procedures.

Protein Extraction and Western Blot Analysis

Protein extraction and western blot analysis of whole seedlings were as described (Stavang et al., 2009). Five-day-old seedlings were homogenized in nondenaturing buffer (100 mM Tris-HCl, pH 7.5, 150 mM NaCl, 0.2% NP40, 1 mM PMSF, protease inhibitor cocktail tablets (Roche)). After two centrifugations (10,0003 g, 10 min, 4C), supernatant was collected and total

protein content measured using a Bradford protein assay kit (Bio-Rad Labora-tories, Hercules, CA, USA). Samples were resolved in 10% SDS-polyacryl-amide gels, transferred to PVDF membranes, incubated with anti-GFP antibody (632460, Clontech, Mountain View, CA, USA; overnight at 4C), followed by HRP-conjugated secondary antibodies (A1949, Sigma-Aldrich, St. Louis, MO, USA; 1 hr, room temperature). Detection was with ECL reagent (PerkinElmer, Waltham, MA, USA).

SUPPLEMENTAL INFORMATION

Supplemental information includes four figures, one table, Supplemental Experimental Procedures, and five movies and can be found with this article online atdoi:10.1016/j.devcel.2012.04.008.

We thank Salome´ Prat, Roberto Solano, Pablo Vera, Carlos Alonso-Blanco, and Carmen L. Tora´n for critical reading of the manuscript. We are very grateful

to Andrew Meagher and Beat Keller for providing the construct of the ACTIN2gene promoter fused to the ACTIN2 cDNA, Frantisek Baluska for theABD2:GFP expression line, Joan Chory for the BZR1-1D:CFP expressionline, and Juan Carlos del Pozo for the DR5:GUS- and PIN2:GFP-expressing

lines. We also thank Sylvia Gutie´rrez for her help with confocal microscopy studies, Jose´ Manuel Franco and the CNB Genomics Facility for microarray hybridization and analysis, Luis Caldero´n for technical assistance, and Cather-ine Mark for editorial assistance. This work was supported by fellowships from the Spanish Ministry of Science and Innovation (MICINN) (to M.L., B.G.-P., P.C., and E.S.-B.) and La-Caixa/CNB International PhD program (to M.T.C.), as well as research grants (BIO2004-03759, BIO2007-66104, BIO2011-25306, CSD2007-00057, and EUI2009-03993) from MICINN.

Bao, F., Shen, J., Brady, S.R., Muday, G.K., Asami, T., and Yang, Z. (2004). Brassinosteroids interact with auxin to promote lateral root development in

Arabidopsis. Plant Physiol. 134, 1624–1631.

Bechtold, N., Ellis, J., and Pelletier, G. (1993). In planta Agrobacterium mediated gene transfer by infiltration of adult Arabidopsis thaliana plants.

C. R. Acad. Sci. 316, 1194–1199.

Bell, C.J., and Ecker, J.R. (1994). Assignment of 30 microsatellite loci to the

linkage map of Arabidopsis. Genomics 19, 137–144.

Benjamins, R., and Scheres, B. (2008). Auxin: the looping star in plant

development. Annu. Rev. Plant Biol. 59, 443–465.

Catarecha, P., Segura, M.D., Franco-Zorrilla, J.M., Garcı´a-Ponce, B., Lanza, M., Solano, R., Paz-Ares, J., and Leyva, A. (2007). A mutant of the Arabidopsis phosphate transporter PHT1;1 displays enhanced arsenic

accu-mulation. Plant Cell 19, 1123–1133.

Chung, Y., Maharjan, P.M., Lee, O., Fujioka, S., Jang, S., Kim, B., Takatsuto, S., Tsujimoto, M., Kim, H., Cho, S., et al. (2011). Auxin stimulates DWARF4

expression and brassinosteroid biosynthesis in Arabidopsis. Plant J. 66,

Dellaporta, S.L., Wood, J., and Hicks, J.B. (1983). A plant DNA

miniprepara-tion: version II. Plant Mol. Biol. Rep. 1, 19–21.

Dhonukshe, P., Aniento, F., Hwang, I., Robinson, D.G., Mravec, J., Stierhof, Y.D., and Friml, J. (2007). Clathrin-mediated constitutive endocytosis of PIN

auxin efflux carriers in Arabidopsis. Curr. Biol. 17, 520–527.

Dhonukshe, P., Grigoriev, I., Fischer, R., Tominaga, M., Robinson, D.G., Hasek, J., Paciorek, T., Petra´sek, J., Seifertova´, D., Tejos, R., et al. (2008a). Auxin transport inhibitors impair vesicle motility and actin cytoskeleton

dynamics in diverse eukaryotes. Proc. Natl. Acad. Sci. USA 105, 4489–4494.

Dhonukshe, P., Tanaka, H., Goh, T., Ebine, K., Maăhoănen, A.P., Prasad, K., Blilou, I., Geldner, N., Xu, J., Uemura, T., et al. (2008b). Generation of cell polarity in plants links endocytosis, auxin distribution and cell fate decisions.

Nature 456, 962–966.

Ditengou, F.A., Teale, W.D., Kochersperger, P., Flittner, K.A., Kneuper, I., van der Graaff, E., Nziengui, H., Pinosa, F., Li, X., Nitschke, R., et al. (2008). Mechanical induction of lateral root initiation in Arabidopsis thaliana. Proc.

Natl. Acad. Sci. USA 105, 18818–18823.

Edgar, R., Domrachev, M., and Lash, A.E. (2002). Gene Expression Omnibus: NCBI gene expression and hybridization array data repository. Nucleic Acids

Res. 30, 207–210.

Friml, J., Wisniewska, J., Benkova´, E., Mendgen, K., and Palme, K. (2002). Lateral relocation of auxin efflux regulator PIN3 mediates tropism in

Arabidopsis. Nature 415, 806809.

Geldner, N., Friml, J., Stierhof, Y.D., Juărgens, G., and Palme, K. (2001). Auxin

transport inhibitors block PIN1 cycling and vesicle trafficking. Nature 413,

Goda, H., Sawa, S., Asami, T., Fujioka, S., Shimada, Y., and Yoshida, S. (2004). Comprehensive comparison of auxin-regulated and brassinosteroid-regulated

genes in Arabidopsis. Plant Physiol. 134, 1555–1573.

Grebe, M., Xu, J., Moăbius, W., Ueda, T., Nakano, A., Geuze, H.J., Rook, M.B., and Scheres, B. (2003). Arabidopsis sterol endocytosis involves

actin-mediated trafficking via ARA6-positive early endosomes. Curr. Biol. 13,

Halliday, K.J. (2004). Plant hormones: the interplay of brassinosteroids and

auxin. Curr. Biol. 14, R1008–R1010.

Hardtke, C.S. (2007). Transcriptional auxin-brassinosteroid crosstalk: who’s

talking? Bioessays 29, 1115–1123.

He, J.X., Gendron, J.M., Yang, Y., Li, J., and Wang, Z.Y. (2002). The GSK3-like kinase BIN2 phosphorylates and destabilizes BZR1, a positive regulator of the brassinosteroid signaling pathway in Arabidopsis. Proc. Natl. Acad. Sci. USA

99, 10185–10190.

Higaki, T., Kutsuna, N., Sano, T., Kondo, N., and Hasezawa, S. (2010). Quantification and cluster analysis of actin cytoskeletal structures in plant

</div>Trang 10<div class="page_container" data-page="10">

cells: role of actin bundling in stomatal movement during diurnal cycles in

Arabidopsis guard cells. Plant J. 61, 156165.

Holweg, C., Suăsslin, C., and Nick, P. (2004). Capturing in vivo dynamics of the

actin cytoskeleton stimulated by auxin or light. Plant Cell Physiol. 45, 855–863.

Hou, G., Mohamalawari, D.R., and Blancaflor, E.B. (2003). Enhanced

gravi-tropism of roots with a disrupted cap actin cytoskeleton. Plant Physiol. 131,

Irizarry, R.A., Hobbs, B., Collin, F., Beazer-Barclay, Y.D., Antonellis, K.J., Scherf, U., and Speed, T.P. (2003). Exploration, normalization, and summaries

of high density oligonucleotide array probe level data. Biostatistics 4, 249–264.

Kim, S.K., Chang, S.C., Lee, E.J., Chung, W.S., Kim, Y.S., Hwang, S., and Lee, J.S. (2000). Involvement of brassinosteroids in the gravitropic response of

primary root of maize. Plant Physiol. 123, 997–1004.

Kleine-Vehn, J., and Friml, J. (2008). Polar targeting and endocytic recycling in

auxin-dependent plant development. Annu. Rev. Cell Dev. Biol. 24, 447–473.

Kleine-Vehn, J., Dhonukshe, P., Swarup, R., Bennett, M., and Friml, J. (2006). Subcellular trafficking of the Arabidopsis auxin influx carrier AUX1 uses a novel

pathway distinct from PIN1. Plant Cell 18, 3171–3181.

Konieczny, A., and Ausubel, F.M. (1993). A procedure for mapping Arabidopsis mutations using co-dominant ecotype-specific PCR-based markers. Plant J.

4, 403–410.

Laskowski, M., Grieneisen, V.A., Hofhuis, H., Hove, C.A., Hogeweg, P., Mare´e, A.F., and Scheres, B. (2008). Root system architecture from coupling cell

shape to auxin transport. PLoS Biol. 6, e307.

Leyser, O. (2006). Dynamic integration of auxin transport and signalling.

Curr. Biol. 16, R424–R433.

Li, L., Xu, J., Xu, Z.H., and Xue, H.W. (2005). Brassinosteroids stimulate plant tropisms through modulation of polar auxin transport in Brassica and

Arabidopsis. Plant Cell 17, 2738–2753.

Maisch, J., and Nick, P. (2007). Actin is involved in auxin-dependent

patterning. Plant Physiol. 143, 1695–1704.

Mouchel, C.F., Osmont, K.S., and Hardtke, C.S. (2006). BRX mediates feed-back between brassinosteroid levels and auxin signalling in root growth.

Nature 443, 458–461.

Murashige, T., and Skoog, F. (1962). A revised medium for rapid growth and

bioassays with tobacco tissue culture. Physiol. Plant. 15, 473–497.

Nakamura, A., Higuchi, K., Goda, H., Fujiwara, M.T., Sawa, S., Koshiba, T., Shimada, Y., and Yoshida, S. (2003a). Brassinolide induces IAA5, IAA19, and DR5, a synthetic auxin response element in Arabidopsis, implying a cross

talk point of brassinosteroid and auxin signaling. Plant Physiol. 133, 1843–

Nakamura, A., Shimada, Y., Goda, H., Fujiwara, M.T., Asami, T., and Yoshida, S. (2003b). AXR1 is involved in BR-mediated elongation and SAUR-AC1 gene

expression in Arabidopsis. FEBS Lett. 553, 28–32.

Nakamura, A., Nakajima, N., Goda, H., Shimada, Y., Hayashi, K., Nozaki, H., Asami, T., Yoshida, S., and Fujioka, S. (2006). Arabidopsis Aux/IAA genes are involved in brassinosteroid-mediated growth responses in a manner

dependent on organ type. Plant J. 45, 193–205.

Nemhauser, J.L., Mockler, T.C., and Chory, J. (2004). Interdependency of

brassinosteroid and auxin signaling in Arabidopsis. PLoS Biol. 2, E258.Nick, P. (2010). Probing the actin-auxin oscillator. Plant Signal. Behav. 5,

Nick, P., Han, M.J., and An, G. (2009). Auxin stimulates its own transport by

shaping actin filaments. Plant Physiol. 151, 155–167.

Nishimura, T., Yokota, E., Wada, T., Shimmen, T., and Okada, K. (2003). An Arabidopsis ACT2 dominant-negative mutation, which disturbs F-actin polymerization, reveals its distinctive function in root development. Plant

Cell Physiol. 44, 1131–1140.

Paciorek, T., Zazı´malova´, E., Ruthardt, N., Petra´sek, J., Stierhof, Y.D., Kleine-Vehn, J., Morris, D.A., Emans, N., Juărgens, G., Geldner, N., and Friml, J. (2005).

Auxin inhibits endocytosis and promotes its own efflux from cells. Nature 435,

Rahman, A., Takahashi, M., Shibasaki, K., Wu, S., Inaba, T., Tsurumi, S., and Baskin, T.I. (2010). Gravitropism of Arabidopsis thaliana roots requires the polarization of PIN2 toward the root tip in meristematic cortical cells. Plant

Cell 22, 1762–1776.

Rashotte, A.M., Brady, S.R., Reed, R.C., Ante, S.J., and Muday, G.K. (2000). Basipetal auxin transport is required for gravitropism in roots of Arabidopsis.

Plant Physiol. 122, 481–490.

Reiner, A., Yekutieli, D., and Benjamini, Y. (2003). Identifying differentially expressed genes using false discovery rate controlling procedures.

Bioinformatics 19, 368–375.

Ringli, C., Baumberger, N., Diet, A., Frey, B., and Keller, B. (2002). ACTIN2 is essential for bulge site selection and tip growth during root hair development

of Arabidopsis. Plant Physiol. 129, 1464–1472.

Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual, Second Edition (Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press).

Sheahan, M.B., Staiger, C.J., Rose, R.J., and McCurdy, D.W. (2004). A green fluorescent protein fusion to actin-binding domain 2 of Arabidopsis fimbrin highlights new features of a dynamic actin cytoskeleton in live plant cells.

Plant Physiol. 136, 3968–3978.

Simmons, C., Migliaccio, F., Masson, P., Caspar, T., and Soăll, D. (1995). A novel root gravitropism mutant of Arabidopsis thaliana exhibiting altered auxin

physiology. Physiol. Plant. 93, 790–798.

Stavang, J.A., Gallego-Bartolome´, J., Go´mez, M.D., Yoshida, S., Asami, T., Olsen, J.E., Garcı´a-Martı´nez, J.L., Alabadı´, D., and Bla´zquez, M.A. (2009). Hormonal regulation of temperature-induced growth in Arabidopsis. Plant J.

60, 589–601.

Steinmann, T., Geldner, N., Grebe, M., Mangold, S., Jackson, C.L., Paris, S., Gaălweiler, L., Palme, K., and Juărgens, G. (1999). Coordinated polar localization

of auxin efflux carrier PIN1 by GNOM ARF GEF. Science 286, 316–318.

Sukumar, P., Edwards, K.S., Rahman, A., Delong, A., and Muday, G.K. (2009). PINOID kinase regulates root gravitropism through modulation of

PIN2-dependent basipetal auxin transport in Arabidopsis. Plant Physiol. 150,

Sun, Y., Fan, X.Y., Cao, D.M., Tang, W., He, K., Zhu, J.Y., He, J.X., Bai, M.Y., Zhu, S., Oh, E., et al. (2010). Integration of brassinosteroid signal transduction with the transcription network for plant growth regulation in Arabidopsis. Dev.

Cell 19, 765–777.

Ueda, H., Yokota, E., Kutsuna, N., Shimada, T., Tamura, K., Shimmen, T., Hasezawa, S., Dolja, V.V., and Hara-Nishimura, I. (2010). Myosin-dependent endoplasmic reticulum motility and F-actin organization in plant cells. Proc.

Natl. Acad. Sci. USA 107, 6894–6899.

Ulmasov, T., Murfett, J., Hagen, G., and Guilfoyle, T.J. (1997). Aux/IAA proteins repress expression of reporter genes containing natural and highly active

synthetic auxin response elements. Plant Cell 9, 1963–1971.

Van Bruaene, N., Joss, G., and Van Oostveldt, P. (2004). Reorganization and in vivo dynamics of microtubules during Arabidopsis root hair development.

Plant Physiol. 136, 3905–3919.

Vanneste, S., and Friml, J. (2009). Auxin: a trigger for change in plant

development. Cell 136, 1005–1016.

Vert, G., Nemhauser, J.L., Geldner, N., Hong, F., and Chory, J. (2005). Molecular mechanisms of steroid hormone signaling in plants. Annu. Rev.

Cell Dev. Biol. 21, 177–201.

Vert, G., Walcher, C.L., Chory, J., and Nemhauser, J.L. (2008). Integration of auxin and brassinosteroid pathways by Auxin Response Factor 2. Proc.

Natl. Acad. Sci. USA 105, 98299834.

Voigt, B., Timmers, A.C.J., Samaj, J., Muăller, J., Baluska, F., and Menzel, D. (2005). GFP-FABD2 fusion construct allows in vivo visualization of the dynamic

actin cytoskeleton in all cells of Arabidopsis seedlings. Eur. J. Cell Biol. 84,

Waller, F., Riemann, M., and Nick, P. (2002). A role for actin-driven secretion in

auxin-induced growth. Protoplasma 219, 72–81.

Wang, Z.Y., Nakano, T., Gendron, J., He, J., Chen, M., Vafeados, D., Yang, Y., Fujioka, S., Yoshida, S., Asami, T., and Chory, J. (2002). Nuclear-localized

</div>

DEVELOPMENTAL CELL ARTICLE ROLE OF ACTIN CYTOSKELETON IN BRASSINOSTEROID SIGNALING AND IN ITS INTEGRATION WITH THE AUXIN RESPONSE IN PLANTS

Role of Actin Cytoskeleton

in Brassinosteroid Signaling and in Its

Integration with the Auxin Response in Plants Mo´nica Lanza,

Berenice Garcia-Ponce,

Gabriel Castrillo,

Pablo Catarecha,

Michael Sauer,

Marı´a Rodriguez-Serrano,

Ana Pa´ez-Garcı´a,

Eduardo Sa´nchez-Bermejo,

Mohan TC,

Yolanda Leo del Puerto,

Luisa Marı´a Sandalio,

Javier Paz-Ares,

and Antonio Leyva

*

The molecular basis of auxin:BR interdependence is still uncertain, although auxin control of BR biosynthesis has been demonstrated (Chung et al., 2011; Yoshimitsu et al., 2011; Mou-chel et al., 2006<i>). Expression of DWARF4, which encodes a </i>

rate-limiting enzyme for the BR biosynthetic pathway, is upregulated by auxin (Chung et al., 2011; Yoshimitsu et al., 2011). In addition,

<i>BREVIS RADIX (BRX), an auxin-inducible transcription factor,</i>

activates expression of another rate-limiting enzyme for BR

<i>biosynthesis, CONSTITUTIVE PHOTOMORPHOGENESIS AND</i>

<i>DWARF (CPD) (</i>Mouchel et al., 2006).

Here we studied whether the actin cytoskeleton acts as a node of convergence in BR and auxin signaling. We show

<i>that, in Arabidopsis, BR alters the actin cytoskeleton in an</i>

auxin-like manner by unbundling actin filaments. Actin cytoskel-eton reorganization in response to BR correlates closely with enhanced auxin sensitivity. We also identify a mutant allele of

<i>the ACTIN2 gene that causes a phenotype identical to that in</i>

BR Alters Actin Configuration

Auxin increases the unbundling of actin filaments, leading to enhancement of auxin responsiveness (Nick et al., 2009). Since BR enhances some auxin responses (Vert et al., 2008), we eval-uated the effect of BR on actin cytoskeleton configuration. In vivo

<i>F-actin imaging was performed on roots of Arabidopsis </i>

seed-lings, using transgenic plants expressing the second actin-binding domain of fimbrin tagged with the green fluorescent

Auxin transporter localization is dependent on actin filament configuration (Dhonukshe et al., 2008a; Geldner et al., 2001;

Identification of Mutants Displaying a Wavy-Root Phenotype

<i>growth in roots, wavy1-1 (</i>Figure 2A). The root mutant phenotype perfectly mimics that of eBL-treated wild-type plants. In mutant plants treated with eBL at concentrations up to 5 nM, the wavy-root phenotype was unaltered, sug-gesting that wavy growth response to BR is

<i>mutant and wild-type roots. wavy1-1 showed no alterations in</i>

<i>constitutive-response mutants bzr1-1D and bes1-D (</i>Wang et al., 2002; Yin

et al., 2002). When grown on vertical plates, the constitutive BR

<i>signaling mutant bzr1-1D had a wavy-root phenotype (</i>Figure 2D).

(Figure S1<i>A). Transformation of the mutant with ACTIN2 cDNAunder the control of a 1.6 kb ACTIN2 promoter (</i>Ringli et al., 2002) rescued the mutant phenotype (Figure S1B). We therefore

<i>renamed the wavy1-1 mutant act2-5, following establishednomenclature for actin2 mutant alleles (</i>Nishimura et al., 2003).

<i>In our growth conditions, the act2-TDNA null allele had a </i>

wavy-root phenotype, weaker than, but similar to, that of eBL-treated plants (Figure 2D), which prompted us to study the interallelic

<i>interaction between act2-TDNA and act2-5 mutant alleles.</i>

<i>act2-5 behaved as a recessive mutation in an F1 cross with</i>

wild-type plants, whereas it behaved as semidominant with

<i>respect to the null act2-TDNA allele, since F1 plant phenotypes</i>

ranged from strong to weak wavy phenotypes (Figure S2). We obtained transgenic plants that overexpress the act2-5 mutant protein under the control of an estradiol-inducible promoter (Zuo et al., 2000<i>) in wild-type or in act2-TDNA plants. In the </i>

pres-ence of estradiol, act2-5 protein-expressing wild-type plants did not show the wavy-root phenotype (Figure 3A). When we

<i>expressed the mutated protein on the act2-TDNA background,</i>

however, all estradiol-exposed plants showed a wavy-root phenotype (Figure 3B). Quantification of curl number in two inde-pendent lines showed intermediate curl intensity phenotypes (Figure 3<i>C). We concluded that, overall, act2-5 behaves as</i>

a semidominant negative mutation versus the null allele,

<i>depen-dent on the dose of functional ACTIN alleles.</i>

act2-5 Mutant Shows Altered Actin Cytoskeleton Configuration and PIN2 Delocalization

<i>Wavy root growth in act2-5 plants was similar to that in </i>

BR-treated wild-type roots. Since this phenotype was associated

with actin filament reconfiguration, we analyzed actin

<i>cytoskel-eton status in the act2-5 mutant. We extended the study to</i>

<i>act2-TDNA and to the constitutive BR response mutant bzr1-1D, both of which have a wavy-root phenotype similar to that</i>

<i>of act2-5. We introduced a construct expressing the ABD2:GFP</i>

fusion protein by crossing on the distinct backgrounds, and

<i>visu-alized actin filaments in vivo by confocal microscopy. act2-5</i>

showed trimmed, diffuse actin filaments (Figure 4A). In real-time live-cell microscopy, actin filament mobility was enhanced on the mutant background (Movie S3<i>). The act2-5 mutant had</i>

the highest PMF and lowest skewness values, consistent with the presence of mobile and unbundled filaments in the mutant (Figures 4B and 4C). Actin filament status is therefore altered in

<i>the act2-5 mutant and resembles that of eBL-treated wild-typeplants. PIN2 localization was partially depolarized in act2-5,</i>

which also resembles eBL-treated wild-type plants (Figure 4A). These observations support the idea that the wavy-root phenotype correlates with altered actin cytoskeleton

<i>configura-tion and delocalized PIN2 distribuconfigura-tion. Furthermore, all act2-5</i>

phenotypes recapitulated that of eBL-treated wild-type plants.

<i>eBL treatment of act2-5 did not further enhance actin </i>

cytoskel-eton reconfiguration or PIN2 delocalization, suggesting that both responses were saturated in the mutant background (Figures S3A and S3B). We compared actin cytoskeleton

<i>config-uration and PIN2 localization in the act2-TDNA and bzr1-1Dmutants to that of act2-5. act2-TDNA and bzr1-1D showed</i>

PIN2 polar delocalization as well as shorter, thinner actin

<i>fila-ments compared to wild-type plants, closely resembling act2-5</i>

(Figure 4A andMovies S4andS5<i>). act2-TDNA nonetheless</i>

also had parallel fiber bundles and fewer thin filaments; based on the presence of bundled filaments, PMF and skewness values

<i>did not differ significantly from wild-type. In contrast, bzr1-1D</i>

had a clear intermediate actin cytoskeleton configuration status, in accordance with their PMF and skewness values (Figure 4B

<i>and 4C). All mutants examined, 5, bzr1-1D, and </i>

act2-TDNA, thus showed close association between altered actin fila-ment configurations and PIN2 transporter delocalization, which supports a role for the actin cytoskeleton in PIN2 localization.

<i>Furthermore, bzr1-1D mimics act2-5 phenotypes to a great</i>

extent, indicating a connection between BR signaling and actin cytoskeleton configuration.