Tài liệu Báo cáo khoa học: Role of Kupffer cells in pathogenesis of sepsis-induced drug metabolizing dysfunction pptx

Role of Kupffer cells in pathogenesis of sepsis-induced
drug metabolizing dysfunction
Tae-Hoon Kim*, Sang-Ho Lee* and Sun-Mee Lee
School of Pharmacy, Sungkyunkwan University, Suwon, South Korea
Introduction
Sepsis, severe sepsis and septic shock are worldwide
problems and continue to be the most common causes
of death in surgical intensive care units [1]. The patho-
genesis of sepsis has often been viewed to involve
excessive immune inflammation that can lead to lethal
multiple organ failure, suggesting that the downregula-
tion of immunity could be beneficial [2]. As a result of
its major implications in essential metabolic functions
and host defense, the liver plays an important role in
the development of multiple organ failure [3].
Patients who are diagnosed with sepsis receive vari-
ous therapeutic agents because of its complex patho-
physiology and varied symptoms; the main clinical
concern has been that patients on a stable drug regi-
men would have increased exposure to an incidence of
adverse drug events. The cytochrome P450 (CYP)
enzyme system constitutes one of the major aspects of
hepatocyte function and contributes to the metabolism
and elimination of exogenous and endogenous sub-
stances [4]. In various models and in clinical reports,
Keywords
CYP450; HMGB1; Kupffer cells; sepsis;
Toll-like receptor
Correspondence
S M. Lee, School of Pharmacy,
Sungkyunkwan University, 300 Cheoncheon-

dong, Jangan-gu, Suwon-si, Gyeonggi-
do 440-746, South Korea
Fax: +82 31 292 8800
Tel: +82 31 290 7712
E-mail:
*These authors contributed equally to this
work
(Received 2 December 2010, revised 19
April 2011, accepted 28 April 2011)
doi:10.1111/j.1742-4658.2011.08148.x
The present study aimed to determine the role of Kupffer cells (KCs) in
cytochrome P450 (CYP) isozyme activity and the expression of its gene
during polymicrobial sepsis. For ablation of KCs, rats were pretreated with
gadolinium chloride (GdCl
3
) at 48 and 24 h before cecal ligation and punc-
ture (CLP). The depletion of KCs was confirmed by measuring the mRNA
level of the KC marker gene CD163. Serum aminotransferase levels and
lipid peroxidation showed an increase and hepatic glutathione content
showed a decrease at 24 h after CLP. These changes were prevented by
GdCl
3
pretreatment. Catalytic activities of CYP1A1, 1A2 and 2E1 showed
a significant reduction at 24 h after CLP but were prevented by GdCl
3
.
A reduction in the levels of CYP2E1 protein and CYP2B1 and CYP2E1
mRNA expression was prevented by GdCl
3
. Phosphorylation of

CYP1A1 ⁄ 1A2 markedly increased 24 h after CLP, which was prevented by
GdCl
3
. The increased serum level of high mobility group box 1, hepatic
level of Toll-like receptors 2 and 4, and inducible nitric oxide synthase pro-
tein expression were prevented by GdCl
3
. In addition, elevated serum con-
centrations of tumor necrosis factor-a and interleukin-6, and increased
hepatic mRNA levels of tumor necrosis factor-a and interleukin-6 were
decreased by depletion of KCs. Our findings suggest that ablation of KCs
protects against hepatic drug-metabolizing dysfunction by modulation of
the inflammatory response.
Abbreviations
ALT, alanine aminotrasferase; AST, aspartate aminotrasferase; CLP, cecal ligation and puncture; CYP, cytochrome P450; GdCl
3
, gadolinium
chloride; GSH, glutathione; GSSG, glutathione disulfide; HMGB1, high mobility group box 1; IL, interleukin; iNOS, inducible nitric oxide
synthase; KCs, Kupffer cells; LPS, lipopolysaccharide; MDA, malondialdehyde; NO, nitric oxide; PAP, p-aminophenol;
RIPA, radioimmunoprecipitation assay; ROS, reactive oxygen species; TLR, Toll-like receptor; TNF, tumor necrosis factor.
FEBS Journal 278 (2011) 2307–2317 ª 2011 The Authors Journal compilation ª 2011 FEBS 2307
inflammation or infection is associated with a decrease
in hepatic expression and ⁄ or activities of CYPs [5].
A previous study showed that hepatic CYP-mediated
drug metabolism is suppressed during polymicrobial
sepsis, particularly in the late phase [6].
The complex Toll-like receptor (TLR) and associ-
ated downstream regulators of immune cells play a
crucial role in the innate system as a first line of
defense against pathogens [7]. TLR2 and TLR4 expres-

sion in multi-organs, including the liver, lung, heart
and spleen, was significantly upregulated in experimen-
tal models of sepsis and in patients with sepsis [8].
Ghose et al. [9] reported that the expression of hepatic
drug-metabolizing enzymes was regulated by a TLR4-
dependent mechanism in a lipopolysaccharide (LPS)-
induced inflammation model. In addition, the TLR2
ligand, lipoteichoic acid, altered the expression of
hepatic genes involved in drug metabolism and trans-
port [10]. Kupffer cells (KCs), the resident hepatic
macrophages, mainly mediate inflammatory responses
in the liver by presenting TLRs on their surface. TLR4
associates with CD14 on the surface of KCs, mediating
LPS-induced signal transduction, and activates KCs to
produce several proinflammatory cytokines [11]. In vivo
observation by immunoelectronmicroscopy shows the
accumulation of TLR2 to the membrane of KCs dur-
ing endotoxemia [12]. A recent study reported that
KCs can release high mobility group box1 (HMGB1),
a critical late mediator of lethal sepsis, triggering the
production of proinflammatory cytokines and liver
injury [13].
Therefore, the present study aimed to elucidate the
role of KCs in the regulation of CYP isoform activities
and gene expression profiles, partly by investigating
the inflammatory signaling pathway.
Results
Hepatic CD163 mRNA expression
Pretreatment with gadolinium chloride (GdCl
3

) alone
significantly decreased the hepatic mRNA level of
CD163 compared to that of sham group. Twenty-four
hours after cecal ligation and puncture (CLP), the
hepatic mRNA level of CD163 was similar with that
of the sham group, which markedly decreased to
approximately 7.0% of that of the CLP group (Fig. 1).
Serum aminotransferase activities and lipid
peroxidation
The serum level of alanine aminotransferase (ALT) in
sham-operated rats was 22.6 ± 1.6 UÆL
)1
at 24 h after
CLP. The serum ALT level in rats who underwent
CLP was 1.8-fold that of sham-operated rats at 24 h
after CLP, which was significantly attenuated by
GdCl
3
. Similar to the ALT level, the serum aspartate
aminotransferase (AST) level increased significantly at
24 h after CLP and this increase was attenuated by
GdCl
3
. The malondialdehyde (MDA) level in CLP rats
was 1.8-fold that of sham-operated rats. The increase
in the MDA level at 24 h after CLP was significantly
prevented by GdCl
3
(Table 1).
Hepatic glutathione (GSH)

The hepatic GSH concentration showed a significant
decrease at 24 h after CLP, and this decrease was pre-
vented by depletion of KCs by GdCl
3
. Although the
CD163
β-actin
Sham
3
CLP GdCl
3
+ CLP
GdCl
Fig. 1. Effect of GdCl
3
on the hepatic CD163 mRNA expression
levels 24 h after CLP. Rats were pretreated intravenously with
7.5 mgÆkg
)1
GdCl
3
or saline alone 48 and 24 h before CLP. The val-
ues are represented as the mean ± SEM for eight to ten rats per
group. ** P < 0.01, significantly different from sham.
++
P < 0.01,
significantly different from CLP.
Table 1. Effect of GdCl
3
on serum aminotransferase activites and

lipid peroxidation after CLP. Each value is presented as the
mean ± SEM for eight to ten rats per group.
Groups ALT (UÆL
)1
) AST (UÆL
)1
)
MDA
(nmolÆmg
)1
protein)
Sham 22.6 ± 1.6 68.1 ± 3.4 0.98 ± 0.05
GdCl
3
20.0 ± 1.9 82.6 ± 4.1 1.19 ± 0.07
CLP 41.4 ± 1.7** 143.6 ± 8.9** 1.72 ± 0.10**
GdCl
3
+ CLP 24.7 ± 2.1
++
119.9 ± 5.0
+
1.18 ± 0.09
++
**P < 0.01, significantly different from sham.
+
P < 0.05,
++
P < 0.01, significantly different from CLP.
KCs in drug-metabolizing dysfunction during sepsis T H. Kim et al.

2308 FEBS Journal 278 (2011) 2307–2317 ª 2011 The Authors Journal compilation ª 2011 FEBS
GSH disulfide (GSSG) concentration showed a marked
increase at 24 h after CLP, GdCl
3
pretreatment did
not affect the GSSG concentration. The GSH to
GSSG ratio showed a significant decline at 24 h after
CLP, which was attenuated by GdCl
3
pretreatment
(Table 2).
Total hepatic CYP content and NADPH-CYP
reductase activity
The hepatic microsomal CYP content in the sham
group was 0.39 ± 0.03 nmolÆmg
)1
protein. At 24 h
after CLP, the hepatic microsomal CYP content
showed a significant decrease to 0.14 ± 0.01
nmolÆmg
)1
protein and this decrease was attenuated by
GdCl
3
treatment. Hepatic microsomal NADPH-CYP
reductase activity showed a significant decrease at 24 h
after CLP. GdCl
3
markedly attenuated this decrease
(Table 3).

Hepatic microsomal CYP isozyme activities
The results for the CYP isozyme activities are summa-
rized in Table 4. At 24 h after CLP, CYP1A1, 1A2
and 2E1 activities were reduced to levels approximately
46.2%, 45.8% and 34.3% of that observed in micro-
somes in sham-operated rats, respectively. These
decreases were attenuated by GdCl
3
pretreatment.
CYP2B1 activity remained unchanged across all
experimental groups.
CYP isozyme protein expression
The amount of CYP1A1 and 1A2 protein expression in
the microsome showed a significant decrease at 24 h
after CLP. GdCl
3
pretreatment raised CYP1A1 and
1A2 protein expression levels without statistical signifi-
cance. No significant differences in CYP2B1 protein
expression level were observed among any experimental
groups. The amount of 2E1 protein expression showed
a significant decrease at 24 h after CLP. This decrease
was prevented by GdCl
3
pretreatment (Fig. 2).
CYP1A1
⁄
1A2 phosphorylation
The phosphorylation of CYP1A1 ⁄ 1A2 significantly
increased 24 h after CLP, which was attenuated by

GdCl
3
pretreatment (Fig. 3).
CYP isozyme mRNA expression
No differences were observed in CYP1A1 and 1A2
mRNA expression between the experimental groups.
The level of CYP2B1 mRNA expression showed a sig-
nificant decrease at 24 h after CLP, and the decrease
was prevented by GdCl
3
. Similar to CYP2B1, the level
of CYP2E1 mRNA expression showed a marked
decline at 24 h after CLP, and the reduction was atten-
uated by GdCl
3
(Fig. 4).
Hepatic TLR2 and TLR4 protein expression
The hepatic level of TLR2 and TLR4 protein expres-
sion showed a marked increase at 24 h after CLP.
These increases were significantly attenuated by GdCl
3
pretreatment (Fig. 5).
Serum HMGB1 and hepatic inducible nitric oxide
synthase (iNOS) protein expression
Serum levels of HMGB1 protein expression and hepa-
tic iNOS protein expression showed a significant
increase at 24 h after CLP. These increases were mark-
edly attenuated by pretreatment with GdCl
3
(Fig. 6).

Serum tumor necrosis factor (TNF)-a and
interleukin (IL)-6 levels
Compared to sham-operated rats, serum TNF-a and
IL-6 levels showed a significant increase at 24 h
Table 2. Effect of gadolinium chloride on concentrations of GSH,
GSSG and GSH ⁄ GSSG ratio after CLP. Each value is presented as
the mean ± SEM for eight to ten rats per group.
Groups
GSH
(nmolÆmg
)1
liver)
GSSG
(nmolÆmg
)1
liver)
GSH ⁄ GSSG
ratio
Sham 4.02 ± 0.25 0.24 ± 0.02 17.61 ± 2.37
GdCl
3
3.84 ± 0.14 0.24 ± 0.02 16.52 ± 1.86
CLP 3.01 ± 0.17** 0.33 ± 0.03* 9.32 ± 0.86**
GdCl
3
+ CLP 3.66 ± 0.17
+
0.30 ± 0.01 12.41 ± 0.51
+
*P < 0.05, **P < 0.01, significantly different from sham.

+
P < 0.05,
significantly different from CLP.
Table 3. Effect of gadolinium chloride on the total cytochrome
P450 content and NADPH-cytochrome P450 reductase activity after
CLP. Each value is presented as the mean ± SEM for eight to ten
rats per group.
Groups
Cytochrome
P450 content
(nmolÆmg
)1
protein)
NADPH-cytochrome
P450 reductase activity
(nmolÆmg
)1
protein)
Sham 0.39 ± 0.03 72.2 ± 2.1
GdCl
3
0.37 ± 0.04 67.5 ± 2.1
CLP 0.14 ± 0.01** 51.6 ± 2.8**
GdCl
3
+ CLP 0.29 ± 0.03
+
68.9 ± 2.4
++
**P < 0.01, significantly different from sham.

+
P < 0.05,
++
P < 0.01, significantly different from CLP.
T H. Kim et al. KCs in drug-metabolizing dysfunction during sepsis
FEBS Journal 278 (2011) 2307–2317 ª 2011 The Authors Journal compilation ª 2011 FEBS 2309
after CLP (450.8 ± 22.6 pgÆmL
)1
and 255.1 ±
40.8 pgÆmL
)1
, respectively). GdCl
3
pretreatment atten-
uated these increases (Fig. 7).
Hepatic TNF-a and IL-6 mNRA expression
As shown in Fig. 8, the hepatic level of TNF-a and
IL-6 mRNA expression showed a significant increase
at 24 h after CLP, and this increase was attenuated by
GdCl
3
.
Discussion
Several studies have shown that interactions between
KCs and endotoxin comprise the initiating event lead-
ing to hepatotoxicity in liver injury, including endotox-
emia and ischemia ⁄ reperfusion injury [14]. In our
studies, we employed GdCl
3
to inactivate KCs based

on the findings of other investigators showing the
destruction of KCs after the intravenous administra-
tion of GdCl
3
[15]. Hardonk et al. [15] demonstrated
that large KCs were no longer present 24 h after
GdCl
3
treatment. Splenic macrophages are less vulner-
able to GdCl
3
because only some of the red pulp mac-
rophages transiently disappear. The white pulp
Sham GdCl
3
CLP GdCl
3
+ CLP
CYP1A1
β-actin
β-actin
β-actin
β-actin
CYP2B1
CYP2E1
CYP1A2
Fig. 2. Effects of KCs on hepatic CYP1A1, 1A2, 2B1 and 2E1 protein expression levels 24 h after CLP. Rats were pretreated intravenously
with 7.5 mgÆkg
)1
GdCl

3
or saline alone 48 and 24 h before CLP. The values are represented as the mean ± SEM for eight to ten rats per
group. *P < 0.05, **P < 0.01, significantly different from sham. +P < 0.05, significantly different from CLP.
Phospho-CYP1A1
CYP1A2
CYP1A1
IP : CYP1A1/1A2
Blot : phosphoserine/
threonine
Phospho-CYP1A2
GdCl
3
– + – +
––++CLP
Fig. 3. Effects of KCs on the phosphorylation of CYP1A1 ⁄ 1A2 24 h
after CLP. Rats were pretreated intravenously with 7.5 mgÆkg
)1
GdCl
3
or saline alone 48 and 24 h before CLP. The livers samples
were subjected to immunoprecipitation (IP) using anti-CYP1A1 ⁄ 1A2
serum. Immunoprecipitates were subjected to immunoblot analysis
using anti-phosphoserine ⁄ threonine serum. The values are repre-
sented as the mean ± SEM for eight to ten rats per group.
*P < 0.05, **P < 0.01, significantly different from sham.
+
P < 0.05,
significantly different from CLP.
Table 4. Effect of gadolinium chloride on the hepatic microsomal cytochrome P450 isozyme activities after CLP. Each value is represented
as the mean ± SEM for eight to ten rats per group.

Sham GdCl
3
CLP GdCl
3
+ CLP
Ethoxyresorufin O-deethylase (pmol resorufinÆmg
)1
protein) 69.9 ± 2.4 66.4 ± 1.7 32.3 ± 2.3** 59.2 ± 4.1
++
Methoxyresorufin O-demethylase (pmol resorufinÆmg
)1
protein) 34.5 ± 0.7 25.8 ± 0.4 15.8 ± 1.4** 32.3 ± 1.9
++
Penthoxyresorufin O-dealkylase (pmol resorufinÆmg
)1
protein) 18.6 ± 1.8 19.3 ± 2.5 16.9 ± 1.2 17.2 ± 1.0
Aniline p-hydroxylase (nmol PAPÆmg
)1
protein) 0.35 ± 0.01 0.36 ± 0.02 0.12 ± 0.01** 0.33 ± 0.02
++
**P < 0.01, significantly different from sham.
++
P < 0.01, significantly different from CLP.
KCs in drug-metabolizing dysfunction during sepsis T H. Kim et al.
2310 FEBS Journal 278 (2011) 2307–2317 ª 2011 The Authors Journal compilation ª 2011 FEBS
macrophages are not affected. GdCl
3
pretreatment has
been demonstrated to have an effect on the prevention
of LPS-evoked release of reactive oxygen species

(ROS) and proinflammatory cytokines from KCs [16].
Our recent studies have shown that GdCl
3
attenuated
the imbalanced vascular stress gene expression induced
by sepsis [17]. In the present study, the depletion of
KCs was confirmed by dramatically reduced expression
of the KC marker gene CD163.
In humans and animals, infections or inflammatory
stimuli cause changes in the activities and expression
levels of various forms of CYP in the liver. In most
cases, CYPs and their activities are suppressed; how-
ever, some are unaffected or induced under these con-
ditions [18]. Our previous study reported on
abnormalities in microsomal drug-metabolizing func-
tion during the late phase of sepsis [6]. However, the
underlying mechanisms involved in hepatic dysfunction
during sepsis remain elusive.
Among various CYP isoforms, CYP1A1, 1A2, 2B1
and 2E1 are both present in hepatic microsome of
human and normal rats. The function and regulation
of these isozymes are highly conserved among mam-
malian species [19].
CYP1A1 is not expressed in normal adult tissues
but can be induced several fold by polycyclic or halo-
genated hydrocarbons [20]. CYP1A2, which is consti-
tutively expressed in the liver, is primarily involved in
the oxidative metabolism of xenobiotics and is capable
of the metabolic activation of numerous procarcino-
gens, including aflatoxin B1 [21]. In the present study,

CYP1A1 and 1A2 activities were significantly
decreased, with a concomitant decrease in their protein
levels during the late phase of sepsis. However,
CYP1A1 and 1A2 mRNA expression was not altered.
Depletion of KCs restored CYP1A1 and 1A2
activities, whereas protein levels remained decreased.
There is evidence showing that oxidative stress contrib-
utes to the inhibition of CYP activity observed in the
absence of changes in protein expression in rabbit he-
patocytes [22]. ROS indirectly reduced the activity of
selected isoforms of CYP by inducing phosphorylation
of the isoforms [23]. Activated KCs cause oxidative
stress on the surrounding tissue, releasing large
amounts of ROS during sepsis [24]. Interestingly, phos-
phorylation of CYP1A1 ⁄ 1A2 occurred at 24 h after
Sham GdCl
3
CLP GdCl
3
+ CLP
CYP1A1
β-actin
β-actin
β-actin
β-actin
CYP2B1
CYP2E1
CYP1A2
Fig. 4. Effects of KCs on hepatic CYP1A1, 1A2, 2B1 and 2E1 mRNA expression levels 24 h after CLP. Rats were pretreated intravenously
with 7.5 mgÆkg

)1
GdCl
3
or saline alone 48 and 24 h before CLP. The values are represented as the mean ± SEM for eight to ten rats per
group. **P < 0.01, significantly different from sham.
+
P < 0.05,
++
P < 0.01, significantly different from CLP.
Sham GdCl
3
CLP GdCl
3
+ CLP
β-actin
TLR4
TLR2
Fig. 5. Effects of KCs on hepatic TLR2 and TLR4 protein expres-
sion levels 24 h after CLP. Rats were pretreated intravenously with
7.5 mgÆkg
)1
GdCl
3
or saline alone 48 and 24 h before CLP. The val-
ues are represented as the mean ± SEM for eight to ten rats per
group. **P < 0.01, significantly different from sham.
++
P < 0.01,
significantly different from CLP.
T H. Kim et al. KCs in drug-metabolizing dysfunction during sepsis

FEBS Journal 278 (2011) 2307–2317 ª 2011 The Authors Journal compilation ª 2011 FEBS 2311
CLP, and GdCl
3
pretreatment attenuated this phos-
phorylation. GdCl
3
pretreatment also prevented lipid
peroxidation and a decrease in hepatic GSH ⁄ GSSG
ratio during sepsis. Thus, the results of the present
study suggest that ROS produced by KCs mediate the
sepsis-induced decrease in CYP1A1 and 1A2 activities
partly through a post-translational phosphorylation.
Upregulation of CYP2E1 has been reported in vari-
able experimental pathological conditions, including
carbon tetachloride-induced hepatic fibrosis, alcohol-
induced liver diseases and hepatic ischemia ⁄ reperfusion
injury, which were implicated in the activation of KCs
[25]. The expression and activity of CYP2E1 were
downregulated in a rat hepatoma cell line after the
administration of proinflammatory cytokines, leading
to a loss of catalytic activity. This downregulation was
at the level of transcription [26]. In the present study,
the activity and protein and mRNA levels of CYP2E1
showed a significant decrease at 24 h after CLP. These
decreases were attenuated by GdCl
3
pretreatment. Our
results suggest that KCs are involved in the sepsis-
induced downregulation of CYP2E1 at the transcrip-
tional level.

Depression of CYP-dependent hepatic drug metabo-
lism in inflammatory reactions and infectious diseases
has been attributed to the inflammatory events. TLRs
play a critical role in the immune system by providing
an early recognition of pathogen invasion and a facili-
tation of the body’s subsequent immune responses [27].
The stimulation of these receptors activates inflamma-
tory responses characterized by the release of a wide
range of proinflammatory cytokines, including IL-6
Sham GdCl
3
CLP GdCl
3
+ CLP
HMGB1
iNOS
β-actin
Fig. 6. Effects of KCs on serum HMGB1 and hepatic iNOS protein expression levels 24 h after CLP. Rats were pretreated intravenously
with 7.5 mgÆkg
)1
GdCl
3
or saline alone 48 and 24 h before CLP. The values are represented as the mean ± SEM for eight to ten rats per
group. **P < 0.01, significantly different from sham.
++
P < 0.01, significantly different from CLP.
Fig. 7. Effects of KCs on serum TNF-a and IL-6 levels 24 h after
CLP. Rats were pretreated intravenously with 7.5 mgÆkg
)1
GdCl

3
or
saline alone 48 and 24 h before CLP. The values are represented
as the mean ± SEM for eight to ten rats per group. **P < 0.01,
significantly different from sham.
++
P < 0.01, significantly different
from CLP.
Sham GdCl
3
CLP GdCl
3
+ CLP
IL-6
TNF-α
β-actin
β-actin
Fig. 8. Effects of KCs on hepatic TNF-a and IL-6 mRNA expression
levels 24 h after CLP. Rats were pretreated intravenously with
7.5 mgÆkg
)1
GdCl
3
or saline alone 48 and 24 h before CLP. The val-
ues are represented as the mean ± SEM for eight to ten rats per
group. *P < 0.05, significantly different from sham.
+
P < 0.05,
++
P < 0.01, significantly different from CLP.

KCs in drug-metabolizing dysfunction during sepsis T H. Kim et al.
2312 FEBS Journal 278 (2011) 2307–2317 ª 2011 The Authors Journal compilation ª 2011 FEBS
and TNF-a. KCs strongly express all TLRs, except
TLR5 [28]. TLR4 and TLR2 in hepatic and splenic
macrophages were significantly upregulated in mice
with experimental peritonitis induced by CLP [29]. It
has been reported that the regulation of hepatic CYP
gene expression elicited by chemically-induced inflam-
matory bowel disease was entirely dependent on TLR4
[30]. However, hepatic inflammation induced by Cit-
robacter rodentium infection was mainly TLR4-inde-
pendent because hepatic CYPs mRNA expression was
similarly downregulated and cytokine mRNAs were
similarly induced in both wild-type and TLR4-mutant
mice [31]. Recently, the TLR2 ligand, lipoteichoic acid,
altered the expression of hepatic genes associated with
drug metabolism and transport [10]. The results of the
present study show that inactivation of KCs by GdCl
3
pretreatment attenuates any increases in hepatic TLR4
and TLR2 protein expression levels at 24 h after CLP.
KCs mediated the specific downregulation of CYP2B1
via the release of TNF-a in a KCs ⁄ hepatocyte cocul-
ture system [32]. Moreover, proinflammatory cytokines
released from KC, although not the direct effects of
LPS, play an important role in downregulating hepatic
CYP1A2 expression in sepsis [33]. In the present study,
increased serum levels of TNF-a and IL-6 and the pro-
tein expression of iNOS were markedly suppressed by
GdCl

3
treatment. This result suggests that septic insult
stimulates both TLR4 and TLR2 expression on KCs,
resulting in the release of proinflammatory mediators
and the downregulation of CYP enzymes in hepato-
cytes.
HMGB1, a DNA-binding nuclear protein, is
released actively by monocytes ⁄ macrophages and pas-
sively by cell death, and plays a critical role in the
mediation of immune responses in several inflamma-
tory disorders [34]. The delayed secretion of HMGB1
was observed both in vitro and in vivo, and these
delayed secretions were crucial to the increased mortal-
ity in septic patients and experimental animals [35].
The findings reported in recent in vitro studies suggest
that some of the effects of HMGB1 result from its
interaction with TLR2 or TLR4, leading to the media-
tion of various cellular responses and the release of
proinflammatory cytokines [36]. There is evidence that
LPS stimulation increases HMGB1 mRNA expression
in both cultured primary hepatocytes and KCs. How-
ever, only KCs release HMGB1 protein into the cul-
ture media [13]. In the present study, the inactivation
of KCs by GdCl
3
treatment attenuated the increase in
serum HMGB1 and improved the survival rate at 24 h
after CLP (data not shown).
The full complexity of the regulatory mechanisms
underlying the alteration of CYP enzymes remains to

be elucidated; however, our results show that KCs dif-
ferentially regulate the expression of each form of
CYP among the various CYP subfamilies. These dif-
ferential regulations were attributed to the ability of
KCs to develop exaggerated inflammatory responses
through TLR overexpression, the release of HMGB1
and the upregulation of proinflammatory cytokines.
Materials and methods
Animals
Male Sprague-Dawley rats, weighing 280–320 g, were sup-
plied by the Jeil Animal Breeding Company (Deajeon,
Korea). The animals were housed in cages located in tem-
perature controlled rooms under a 12 : 12 h light ⁄ dark
photocycle, and received water and food ad libitum for at
least 1 week. All animal procedures were approved by the
Sungkyunkwan University Animal Care Committee and
were performed in accordance with the guidelines of the
National Institutes of Health.
Treatment with GdCl
3
and experimental groups
For depletion of KCs in vivo, 7.5 mgÆkg
)1
of GdCl
3
was
injected via the tail vein at 48 and 24 h before the perfor-
mance of CLP or sham operation, based on the findings of
other investigators who showed the destruction of KCs
after the intravenous administration of GdCl

3
, where large
KCs were no longer present at 24 h after GdCl
3
treatment
[15]. In vehicle-treated rats, physiological saline solution
was injected with the same volume and in the same manner
as GdCl
3
. Four treatment groups were studied: (a) vehicle-
treated sham (sham); (b) GdCl
3
-treated sham (GdCl
3
); (c)
vehicle-treated CLP (CLP); and (d) GdCl
3
-treated CLP
(GdCl
3
+ CLP).
CLP
Polymicrobial sepsis was induced by CLP in accordance
with the method previously described by Chaudry et al.
[37]. After anesthetization with ether, a 2 cm ventral mid-
line incision was performed. The cecum was then carefully
exposed, ligated just distal to the ileocecal valve to avoid
intestinal obstruction, and punctured twice with an
18-gauge needle. The punctured cecum was squeezed to
expel a small amount of fecal material and returned to the

abdominal cavity, and the abdominal incision was closed in
two layers. Sham-operated animals underwent the same
surgical procedure, except that the cecum was neither
ligated, nor punctured. All animals received normal saline
(3 mLÆ100 g
)1
body weight) subcutaneously immediately
after surgery (i.e. fluid resuscitation). At 24 h (i.e. late
phase of sepsis) after CLP, blood was obtained from the
T H. Kim et al. KCs in drug-metabolizing dysfunction during sepsis
FEBS Journal 278 (2011) 2307–2317 ª 2011 The Authors Journal compilation ª 2011 FEBS 2313
abdominal aorta. The left and median lobes of the liver
were isolated immediately, and stored at )75 °C until
assayed.
Isolation of hepatic microsomal fraction
The excised liver was minced and then homogenized in four
volumes of ice-cold 1.15% KCl for 1 g of liver, and centri-
fuged at 9000 g for 60 min. The supernatant was collected
and centrifuged at 105 000 g for 60 min, and the precipi-
tates (microsomal fractions) were resuspended with four
volumes of 0.1 m phosphate buffer at pH 7.4, for 1 g of
liver microsome and stored at )75 °C until assayed.
Analytical procedures
Serum ALT and AST activities were determined by stan-
dard spectrophotometric procedures using a diagnostic kit
(Sigma Chemical Co., St Louis, MO, USA). Lipid peroxide
was assayed by the method of Buege and Aust [38], and
1,1,3,3-tetraethoxypropane (MDA tetraethyl acetal) was
used as the standard. Total GSH was determined in liver
homogenates after precipitation with 1% picric acid, using

yeast GSH reductase, 5,5¢-dithio-bis(2-nitrobenzoic acid)
and NADPH at 340 nm. GSSG was determined by the
same method in the presence of 2-vinylpyridine and reduced
GSH was calculated from the difference between total glu-
tathione and GSSG [39]. CYP content was calculated using
the molar extinction coefficient for the absorbance differ-
ence between 450 and 480 nm, as measured with a differen-
tial spectrophotometer [40]. The activity of NADPH-CYP
reductase was indirectly determined by its NADPH-cyto-
chome c reductase activity [41]. The catalytic activity of
CYP1A1, 1A2 and 2B1 in liver microsomal fractions was
measured as 7-ethoxyresourfin O-deethylase, methoxyre-
sourfin O-demethylase and pentoxyresourfin O-dealkylase
activities, respectively, using the method previously
described by Burke et al. [42]. Microsomal CYP2E1 activity
was determined by measurement of 4-hydroxylation of
aniline to p-aminophenol (PAP) [43].
ELISA
Serum concentrations of TNF-a and IL-6 were determined
using ELISA kits in accordance with the manufacturer’s
instructions (BD Biosciences, San Diego, CA, USA).
Western blot immunoassay
Protein samples (10–20 lg per well) from liver tissue and
serum were separated by 10–12% SDS ⁄ PAGE, and were
transferred to nitrocellulose membranes using a semi-dry
transfer process. Bands were immunologically detected using
polyclonal antibodies against rat CYP1A1, 1A2, 2B1 and
2E1 (Gentest, Woburn, MA, USA); iNOS (Transduction
Laboratories, San Jose, CA, USA); TLR4 and TLR2 (Santa
Cruz Biotechnology, Santa Cruz, CA, USA); and HMGB1

(Abcam, Cambridge, MA, USA). Binding of all of the anti-
bodies was detected using an ECL detection system (iNtRON
Biotechnology, Seoul, Korea) in accordance with the manu-
facturer’s instructions. The intensity of the immunoreactive
bands was determined using densitometric analysis software
(image gauge, version 3.12; Fujifilm, Tokyo, Japan).
Immunoprecipitation
Liver tissues were homogenized with ice-cold radioimmuno-
precipitation assay (RIPA) buffer (150 mm NaCl, 50 mm
Tris, 1% Triton X-100, 1% deoxycholic acid, 0.1% SDS,
pH 7.4) containing protease and phosphatase inhibitor
cocktail set (Calbiochem, La Jolla, CA, USA). Aliquots of
500 lg of protein diluted to 1 mgÆmL
)1
in RIPA buffer were
precleared with protein A ⁄ G agarose beads (Santa Cruz
Biotechnology) for 30 min and then incubated overnight at
4 °C with anti-CYP1A1 ⁄ 1A2 serum (Abcam) with a con-
stant rotation of the samples. Protein A ⁄ G agarose beads
was then added, and the samples were incubated for a fur-
ther 3 h at 4 °C with constant rotation. The immune com-
plexes were washed three times in a RIPA buffer for 30 s.
After the third wash, the immunoprecipitants were resus-
pended in Laemmli sample buffer. The samples were then
analyzed by western blotting using the polyclonal anti-phos-
phoserine ⁄ threonine serum (Abcam) as the primary anti-
body. Binding of all of the antibodies was detected using an
ECL detection system (iNtRON Biotechnology) in accor-
dance with the manufacturer’s instructions. The intensity of
the immunoreactive bands was determined using densito-

metric analysis software (image gauge, version 3.12).
Total RNA extraction and RT-PCR
Isolation of total RNA was carried out in accordance with
the method previously described by Chomczynski and Sacchi
[44]. Reverse transcription of total RNA was performed for
synthesis of the first strand of cDNA using the oligo
12–18
pri-
mer and SuperScriptÔ II RNase H
)
Reverse Transcriptase
(Tech-LineÔ; Invitrogen Carlsbad, CA, USA). The PCR
reaction was performed with a diluted cDNA sample and
amplified in each 20 lL reaction volume. The final reaction
concentrations were: primers (Table 5), 10 pmol; dNTP mix,
250 lL; 10· PCR buffer; and Ex Taq DNA polymerase,
0.5 U per reaction. All PCR reactions had an initial denatur-
ation step at 94 °C for 5 min, and a final extension at 72 °C
for 5 min using the GeneAmp 2700 thermocycler (Applied
Biosystems, Foster City, CA, USA). PCR amplification
cycling conditions comprised: 94 °C for 30 s, 55 °C for 30 s,
72 °C for 60 s, 30 cycles for CD163; 94 ° C for 30 s, 57 °C
for 30 s, 72 °C for 60 s, 30 cycles for CYP1A1; 94 °C for
KCs in drug-metabolizing dysfunction during sepsis T H. Kim et al.
2314 FEBS Journal 278 (2011) 2307–2317 ª 2011 The Authors Journal compilation ª 2011 FEBS
30 s, 60 °C for 30 s, 72 °C for 60 s, 23 cycles for CYP2E1;
94 °C for 30 s, 62 °C for 30 s, 72 °C for 60 s, 22 cycles and
23 cycles for CYP1A2 and CYP2B1, respectively; and 94 °C
for 30 s, 54 °C for 30 s, 72 °C for 60 s, 26 cycles, 25 cycles
and 25 cycles for TNF-a, IL-6 and b-actin, respectively.

After RT-PCR, 10 lL samples of the amplified products
were resolved by electrophoresis in 1.5% agarose gel, and
stained with ethidium bromide. The intensity of each PCR
product was semi-quantitatively evaluated using a digital
camera (DC120; Eastman Kodak, New Haven, CT, USA)
and densitometric scanning analysis software (1d main;
Advanced American Biotechnology, Fullerton, CA, USA).
Statistical analysis
All results are presented as the mean ± SEM. Overall sig-
nificance was tested by one-way analysis of variance.
P < 0.05 was considered statistically significant for differ-
ences between groups at specific time points, with the
appropriate Bonferroni correction being made for multiple
comparisons.
Acknowledgements
This research was supported by Basic Science Research
Program through the National Research Foundation
of Korea (NRF) funded by the Ministry of Education,
Science and Technology (2010-0028646).
References
1 Jacob A, Zhou M, Wu R & Wang P (2009) The role of
hepatic cytochrome P-450 in sepsis. Int J Clin Exp Med
2, 203–211.
2 Llewelyn M & Cohen J (2002) Superantigens: microbial
agents that corrupt immunity. Lancet Infect Dis 2, 156–
162.
3 Aninat C, Seguin P, Descheemaeker PN, Morel F, Mal-
ledant Y & Guillouzo A (2008) Catecholamines induce
an inflammatory response in human hepatocytes. Crit
Care Med 36, 848–854.

4 Anzenbacher P & Anzenbacherova E (2001) Cyto-
chromes P450 and metabolism of xenobiotics. Cell Mol
Life Sci 58, 737–747.
5 Aitken AE, Richardson TA & Morgan ET (2006) Regu-
lation of drug-metabolizing enzymes and transporters in
inflammation. Annu Rev Pharmacol Toxicol 46, 123–
149.
6 Lee SH & Lee SM (2005) Suppression of hepatic cyto-
chrome p450-mediated drug metabolism during the late
stage of sepsis in rats. Shock 23, 144–149.
7 van der Poll T & Opal SM (2008) Host-pathogen inter-
actions in sepsis. Lancet Infect Dis 8, 32–43.
8 Cinel I & Opal SM (2009) Molecular biology of inflam-
mation and sepsis: a primer. Crit Care Med 37,
291–304.
9 Ghose R, White D, Guo T, Vallejo J & Karpen SJ
(2008) Regulation of hepatic drug-metabolizing enzyme
genes by Toll-like receptor 4 signaling is independent of
Toll-interleukin 1 receptor domain-containing adaptor
protein. Drug Metab Dispos 36, 95–101.
10 Ghose R, Guo T & Haque N (2009) Regulation of gene
expression of hepatic drug metabolizing enzymes and
transporters by the Toll-like receptor 2 ligand, lipotei-
choic acid. Arch Biochem Biophys 481, 123–130.
11 Miyaso H, Morimoto Y, Ozaki M, Haga S, Shinoura S,
Choda Y, Murata H, Katsuno G, Huda K, Takahashi
H et al. (2006) Protective effects of nafamostat mesilate
on liver injury induced by lipopolysaccharide in rats:
possible involvement of CD14 and TLR-4 downregula-
tion on Kupffer cells. Dig Dis Sci 51, 2007–2012.

12 Ojaniemi M, Liljeroos M, Harju K, Sormunen R, Vuol-
teenaho R & Hallman M (2006) TLR-2 is upregulated
Table 5. PCR primers used in the present study.
Gene
(accession
number)
Primer sequences
(5¢-to3¢)
Product
length (bp)
CD163
(XM_053094.2)
Sense:
AGCTGGGCTGTGCAGACAACG
Antisense:
TGAATGACCCCCGAGGATTTCAGC
736
CYP1A1
(X00469)
Sense:
CTGGTTCTGGATACCCAGCTG
Antisense:
CCTAGGGTTGGTTACCAGG
331
CYP1A2
(X01031)
Sense:
CAGTCACAACAGCCATCTTC
Antisense:
CCACTGCTTCTCATCATGGT

302
CYP2B1
(XM_342078)
Sense:
TTGTTTGGTGCTGGGACAGAG
Antisense:
GGCTAGGCCCTCTCCTGCACA
443
CYP2E1
(M20131)
Sense:
AAACTTCATGAAGAAATTGAC
Antisense:
TCTCCAACACACACACGCTTTCC
311
TNF-a
(X66539)
Sense:
GTAGCCCACGTCGTAGCAAA
Antisense:
CCCTTCTCCAGCTGGAAGAC
346
IL-6
(NM_012589)
Sense:
GAAAGTCAACTCCATCTGCC
Antisense:
CATAGCACACTAGGTTTGCC
678
b-actin

(BC063166)
Sense:
TTGTAACCAACTGGGACGATATGG
Antisense:
GATCTTGATCTTCATGGTGCTAG
764
T H. Kim et al. KCs in drug-metabolizing dysfunction during sepsis
FEBS Journal 278 (2011) 2307–2317 ª 2011 The Authors Journal compilation ª 2011 FEBS 2315
and mobilized to the hepatocyte plasma membrane in
the space of Disse and to the Kupffer cells TLR-4
dependently during acute endotoxemia in mice. Immunol
Lett 102, 158–168.
13 Zhao ZF, Han DW, Liu MS, Zhang GY, Zhang Y,
Yang H & Yang LX (2007) [Expression of HMGB-1
and its extracellular release of cultured primary hepatic
parenchymal cells and Kupffer cells induced by LPS].
Zhonghua Gan Zang Bing Za Zhi 15, 676–680.
14 Gregory SH & Wing EJ (2002) Neutrophil-Kupffer cell
interaction: a critical component of host defenses to sys-
temic bacterial infections. J Leukoc Biol 72, 239–248.
15 Hardonk MJ, Dijkhuis FW, Hulstaert CE & Koudstaal
J (1992) Heterogeneity of rat liver and spleen macro-
phages in gadolinium chloride-induced elimination and
repopulation. J Leukoc Biol 52, 296–302.
16 Xu DX, Wei W, Sun MF, Wu CY, Wang JP, Wei LZ
& Zhou CF (2004) Kupffer cells and reactive oxygen
species partially mediate lipopolysaccharide-induced
downregulation of nuclear receptor pregnane X receptor
and its target gene CYP3a in mouse liver. Free Radic
Biol Med 37, 10–22.

17 Lee SH, Clemens MG & Lee SM (2010) Role of Kupf-
fer cells in vascular stress genes during trauma and sep-
sis. J Surg Res 158, 104–111.
18 Morgan ET (2001) Regulation of cytochrome p450 by
inflammatory mediators: why and how? Drug Metab
Dispos 29, 207–212.
19 Paine AJ (1995) Heterogeneity of cytochrome P450 and
its toxicological significance. Hum Exp Toxicol 14, 1–7.
20 Gonzalez FJ (1988) The molecular biology of cyto-
chrome P450s. Pharmacol Rev 40, 243–288.
21 Shimada T & Fujii-Kuriyama Y (2004) Metabolic acti-
vation of polycyclic aromatic hydrocarbons to carcino-
gens by cytochromes P450 1A1 and 1B1. Cancer Sci 95,
1–6.
22 El-Kadi AO, Bleau AM, Dumont I, Maurice H & du
Souich P (2000) Role of reactive oxygen intermediates
in the decrease of hepatic cytochrome P450 activity by
serum of humans and rabbits with an acute inflamma-
tory reaction. Drug Metab Dispos 28, 1112–1120.
23 Rhee SG (1999) Redox signaling: hydrogen peroxide as
intracellular messenger. Exp Mol Med 31, 53–59.
24 Spolarics Z (1998) Endotoxemia, pentose cycle, and the
oxidant ⁄ antioxidant balance in the hepatic sinusoid.
J Leukoc Biol 63, 534–541.
25 Rivera CA, Bradford BU, Hunt KJ, Adachi Y, Schrum
LW, Koop DR, Burchardt ER, Rippe RA & Thurman
RG (2001) Attenuation of CCl(4)-induced hepatic fibro-
sis by GdCl(3) treatment or dietary glycine. Am J Phys-
iol Gastrointest Liver Physiol 281, G200–207.
26 Hakkola J, Hu Y & Ingelman-Sundberg M (2003)

Mechanisms of down-regulation of CYP2E1 expression
by inflammatory cytokines in rat hepatoma cells. J
Pharmacol Exp Ther 304, 1048–1054.
27 Kumar H, Kawai T & Akira S (2009) Toll-like recep-
tors and innate immunity. Biochem Biophys Res Com-
mun 388, 621–625.
28 Wu J, Meng Z, Jiang M, Zhang E, Trippler M, Broer-
ing R, Bucchi A, Krux F, Dittmer U, Yang D et al.
(2010) Toll-like receptor-induced innate immune
responses in non-parenchymal liver cells are cell type-
specific. Immunology 129, 363–374.
29 Tsujimoto H, Ono S, Majima T, Kawarabayashi N, Ta-
kayama E, Kinoshita M, Seki S, Hiraide H, Moldawer
LL & Mochizuki H (2005) Neutrophil elastase, MIP-2,
and TLR-4 expression during human and experimental
sepsis. Shock 23, 39–44.
30 Chaluvadi MR, Nyagode BA, Kinloch RD & Morgan
ET (2009) TLR4-dependent and -independent regula-
tion of hepatic cytochrome P450 in mice with chemi-
cally induced inflammatory bowel disease. Biochem
Pharmacol 77, 464–471.
31 Richardson TA, Sherman M, Antonovic L, Kardar SS,
Strobel HW, Kalman D & Morgan ET (2006) Hepatic
and renal cytochrome p450 gene regulation during cit-
robacter rodentium infection in wild-type and toll-like
receptor 4 mutant mice. Drug Metab Dispos 34,
354–360.
32 Milosevic N, Schawalder H & Maier P (1999) Kupffer
cell-mediated differential down-regulation of cyto-
chrome P450 metabolism in rat hepatocytes. Eur J

Pharmacol 368, 75–87.
33 Wu R, Cui X, Dong W, Zhou M, Simms HH & Wang
P (2006) Suppression of hepatocyte CYP1A2 expression
by Kupffer cells via AhR pathway: the central role of
proinflammatory cytokines. Int J Mol Med 18, 339–346.
34 Sims GP, Rowe DC, Rietdijk ST, Herbst R & Coyle AJ
(2010) HMGB1 and RAGE in inflammation and can-
cer. Annu Rev Immunol 28, 367–388.
35 Ulloa L, Ochani M, Yang H, Tanovic M, Halperin D,
Yang R, Czura CJ, Fink MP & Tracey KJ (2002) Ethyl
pyruvate prevents lethality in mice with established
lethal sepsis and systemic inflammation. Proc Natl Acad
Sci USA 99, 12351–12356.
36 Park JS, Svetkauskaite D, He Q, Kim JY, Strassheim
D, Ishizaka A & Abraham E (2004) Involvement of
toll-like receptors 2 and 4 in cellular activation by high
mobility group box 1 protein. J Biol Chem 279, 7370–
7377.
37 Chaudry IH, Wichterman KA & Baue AE (1979) Effect
of sepsis on tissue adenine nucleotide levels. Surgery 85,
205–211.
38 Buege JA & Aust SD (1978) Microsomal lipid peroxida-
tion. Methods Enzymol 52, 302–310.
39 Anderson ME (1985) Determination of glutathione and
glutathione disulfide in biological samples. Methods
Enzymol 113, 548–555.
40 Omura T & Sato R (1964) The carbon monoxide-bind-
ing pigment of liver microsomes. II. Solubilization,
KCs in drug-metabolizing dysfunction during sepsis T H. Kim et al.
2316 FEBS Journal 278 (2011) 2307–2317 ª 2011 The Authors Journal compilation ª 2011 FEBS

purification, and properties. J Biol Chem 239, 2379–
2385.
41 Vermilion JL & Coon MJ (1978) Identification of the
high and low potential flavins of liver microsomal
NADPH-cytochrome P-450 reductase. J Biol Chem 253,
8812–8819.
42 Burke MD, Thompson S, Elcombe CR, Halpert J,
Haaparanta T & Mayer RT (1985) Ethoxy-, pentoxy-
and benzyloxyphenoxazones and homologues: a series
of substrates to distinguish between different induced
cytochromes P-450. Biochem Pharmacol 34, 3337–3345.
43 Schenkman JB, Remmer H & Estabrook RW (1967)
Spectral studies of drug interaction with hepatic micro-
somal cytochrome. Mol Pharmacol 3, 113–123.
44 Chomczynski P & Sacchi N (1987) Single-step method
of RNA isolation by acid guanidinium thiocyanate-
phenol-chloroform extraction. Anal Biochem 162,
156–159.
T H. Kim et al. KCs in drug-metabolizing dysfunction during sepsis
FEBS Journal 278 (2011) 2307–2317 ª 2011 The Authors Journal compilation ª 2011 FEBS 2317