Nghiên cứu xây dựng quy trình phát hiện nhanh virus cúm gia cầm a h5n1 trong mẫu bệnh phẩm bằng kỹ thuật multiplex reverse transcription polymerase chain reaction




transcription polymerase chain reaction







Abstract. T       

-P
-
       -


Keywords. ; ; 

Content
I. Đặt vấn đề

Orthomyxoviridae. 















 











 . 
A/H5N1 , , 
. 

, 














, 






vir

/H5N1  . 

1. a chn p  thc hin phn ng multiplex RT-

2. n cu ti n ca phn ng multiplex RT-PCR: nhit
 i gian gn mi, nng  
3. Th nghin ng multiplex RT-t s
mu bnh phm thu thm.
II. Vật liệu và phương pháp nghiên cứu
Mâ
̃
u bệnh phẩm:  






 /H5N1: 8 






gi (





 ); 6 








 (



 - 


 g); 30

Tách chiết RNA: thu RNA  

Thiết kế mô
̀
i :  5, N1 
, 2.0.11. Sau khi


 5.4 /H5N1 

























, 






/H5N1 





 -PCR.
Phn ứng m utiplex RT-PCR: 
RT-










 



 1000 (Biorad). 

(10 ) 




2%, 



 ethidium bromide 0,5 /ml 15 , 















 . 


 100 bp.
Đa
́
nh gia
́
đô
̣
đă
̣
c hiê
̣
u cu
̉
a pha
̉
n ư
́
ng : 













A/H1N1, /H3,  (







 ), /H5
(





 ) 

























 
Đa
́
nh gia
́
đô
̣
nha
̣
y cu
̉
a pha
̉
n ư
́
ng : S, 







/H5N1 1.2/blunt (Fermentas) , 















Kit (Fermentas). 





















260 

(Eppendorf). 

























. Sau


, 















 10

1

/




























.
III. Kết qu
Thiê
́
t kê
́
mô
̀
i: 







 5, N1 




 , 3 

















utiplex RT-





/H5N1 

:

Mô
̀
i
Trnh t 5’-3’
V tr
Tm
Kch thưc
DiagMF
GTCTTCTAACCGAGGTCGAAAC
5-26
55.1
154 bp

DiagMR
GTGACAGGATTGGTCTTGTCTT
158-139
55.8
DiagH5F
AGTGATCAGATTTGCATTGGTTAC
46-69
54.6
371 bp
DiagH5R
GACCAAGAACTTTTGGGGATG
416-396
55.4
DiagN1F
CCAGTTGGTTGACAATTGGAAT
503-524
54.5
292 bp
DiagN1R
GCATCAGGATAACAGGAGCA
794-775
55.4
Tối ưu phn ứng mutiplex RT-PCR: -

























(

, nhi, 








, 






) . 

, 
mutiplex RT-









3 













 . 











 utiplex RT-




, 





0.3 , 0.5 

0.4 ; 
: c  50
o
C b 



95
o
C trong 15 ; 

45 

(94
o
C: 30 ; 57
o
C: 30 ; 72
o
C:
30 ); 
















72
o
C trong 5 .
Đa
́
nh gia
́
đô
̣
đă
̣
c hiê
̣
u cu
̉
a pha
̉
n ư
́
ng m utiplex RT-PCR: 
 (; /H1N1; /H5  
A/H3 

 N1)  . 


 m A/H5N1. , 























 (ngươ
̀
i, Escherichia coli, Mycobacteria tuberculosis,
Chlamydia trachomatis, Neisseria gorrnorhea, Hepatitis B virus, Hepatitis C virus,
Human immunodeficiency virus, Human Papillomavirus),  utiplex RT-PCR
.

Ảnh điện di đa
́
nh gia
́

độ đă
̣
c hiê
̣
u cu
̉
a pha
̉
n ư
́
ng multiplexRT-PCR.
M: thang DNA chuâ
̉
n 100 bp; NC: Chư
́
ng âm; 1: cm A/H5; 2: cm A/H3; 3: cm B; 4:
cm A/H5N1; 5: cm A/H1N1

Đa
́
nh gia
́
đô
̣
nha
̣
y cu
̉
a pha
̉

n ư
́
ng mutiplex RT-PCR:
 , 

10
1
10
10

/





 10 



 2%. 



 di cho







 (










bromide) 





10 .

Thư
̉
nghiê
̣
m đa
́
nh gia
́
đô
̣

nha
̣
y cu
̉
a pha
̉
n ư
́
ng multiplex RT-PCR
M: thang DNA 100 bp; NC: Chư
́
ng âm; S lưng bản sao RNA trong mu th đưc ghi
ch  pha trên.
ng dng k thuật mutiplex RT-PCR pha
́
t hiê
̣
n cu
́
m A /H5N1 trên mâ
̃
u bê
̣
nh
phâ
̉
m:
Kmutiplex RT-PCR 






 14 








A/H5N1 (2 



, 3 





, 3 





, 6 






). 






utiplex RT-









14 





.

Kết qua

̉
thư
̉
nghiê
̣
m pha
̉
n ư
́
ng multiplex RT-PCR trên mâ
̃
u bê
̣
nh phâ
̉
m dương tnh. M:
thang DNA chuẩn 100 bp; NC: Chư
́
ng âm; md: muscovy duck; ck: chicken; d: duck 1, 2, 3;
h: human 1, 2, 3, 4, 5, 6
K thut mutiplex RT-u bnh phm (thu thp t gia
cm b b dt qu t hic 9 m
H5N1 (31 m70%).

Kết qua
̉
thư
̉
nghiê
̣

m pha
̉
n ư
́
ng multiplex RT-PCR phát hiện virus cm gia cầm A/H5N1
trên một s mu bê
̣
nh phâ
̉
m
M: Thang DNA chuẩn 100 bp; NC: Chứng âm; PC: Chứng dương;
1-10: Mu bệnh phẩm.

Kết luận
- 
mutiplex RT-PCR.
- 









 -






 nhanh


 /H5N1 



































/H5N1 .
- ex RT-PCR 

References :
Tiếng Việt
 Báo cáo tình hình cm gia cầm tại Việt Nam, 



Tạp ch Công nghệ Sinh học 2(1): 1-18.
Tạp ch Khoa học Kỹ thuật Th y, 11(1): 81-86.
Tạp ch Khoa học Kỹ thuật Th y,
11(2): 53-58.
Tiếng Anh
5. Abdel-Ghafar AN, Chotpitayasunondh T, Gao Z, Hayden FG, Nguyen DH, et al,
N. Engl.
J. Med, 358, pp. 261-73.
6. Apisarnthanarak A, Kitphati R, Thongphubeth K, Patoomanunt P, et al, 2004,
Emerg Infect Dis, 10, pp. 1321- 4.
-length

of neuraminidase combine to regulate the growth of avian influenza viruses in
Virus Res, 79(1-2): 177-185.
            
Arch. Virol., 119, pp. 37-42.
9. Beigel JH, Farrar J, Han AM, Hayden FG, Hyer R, de Jong MD, Lochindarat S,

N Engl J Med, 353, pp. 1374- 85.
10. Bloomberg News articles (2006), Two Bird Flu Gene Mutations Might Lead to
Faster Human Spread, Published.
 Nature, 439, pp. 248-9
12. CDC (2009), Interim guidance on the planning for the use of surgical masks and
respirators in health care settings during an influenza pandemic.
fection in Hong
Clin Infect Dis, 34(suppl 2):S58- S64.


Proc Natl Acad Sci USA, 103, pp. 2845- 50.
The evolution of
, Proc Natl Acad Sci USA,
101: p. 10452-10457.
16. Chotpitayasunondh T, Ungchusak K, Hanshaoworaku     
Emerg Infect Dis, 11, pp. 201- 9.
17. Conenello G, Zamarin D,

Perrone L,

Tumpey T and Palese P (2007), A Single
Mutation in the PB1-F2 of H5N1 (HK/97) and 1918 Influenza A Viruses
Contributes to I, PLoS Pathog, 3(10), pp. 1414-21
18. De Jong MD, Bach VC, Phan TQ, Vo MH, Tran TT, Nguyen BH, Beld M, Le TP,

            
influenza A (H5N1) in a child presenting with diarrhea foll N
Engl J Med, 352, pp. 686-91.
19. De Jong MD, Simmons CP, Thanh TT, Hien VM, Smith GJ, Chau TN, Hoang DM,
Chau NV, Khanh TH, Dong VC, Qui PT, Cam BV, Ha DQ, Guan Y, Peiris JS,
           uenza A
Nat Med, 12,
pp. 1203- 07.
20. De Jong MD, Tran TT, Truong HK, Vo MH, Smith GJ, Nguyen VC, Bach VC, Phan
e
N Engl J Med, 353, pp. 2667-
72
Proc Natl
Acad Sci U S A, 90(9): 4171-4175.
22. Duan L, Bahl J, Smith G, et al. (2008), The development and genetic diversity of
H5N1 influenza virus in China, 1996-Virology, 380, pp. 243-54.
          Evolution of the receptor
Virology; 344:432-438.
24. Greninger A (2004), The Definition and Measurement of Dangerous Research.
25. Guan Y, et al (2004), H5N1 influenza: A protean pandemic threat, PNAS, 101(21),
pp. 8156-61

Proc. Natl Acad. Sci. USA, 99, pp. 89505.
27. Hamada S., Suzuki Y., Suzuki T., et al (2006), Haemagglutinin mutations
responsible for the binding of H5N1 influenza A virus to human-
Nature, 444(7117), pp.378-82.
Influenza, Report 2006.
29. Hatta M., et al (2007), Growth of H5N1 Influenza A Viruses in the Upper
Respiratory Tracts of Mice, PLoS. Pathog.
30. Hoa, L.T., D.D. Khang, P.V. Chi, N.V. Hai, T.N. Hai, N.T.B. Nga, and L.T. Binh

Molecular characterization of the H5 gene for the highly pathogenic
A/H5N1 strains isolated in Vietnam during 2004   Proceedings of
International Workshop on Biotechnology in Agriculture, p. 68-71.
31. Hui DS (2         
Respirology, 13(suppl 1):S10-S13.
32. International Committee on Taxonomy of Viruses Index of Viruses (2009),
Orthomyxoviridae, In: ICTVdB - The Universal Virus Database, version 7.
B#chen-Osmond, C (Ed), Columbia University, New York, USA.
33. Julkunen I, Pyhala R, Hovi T, 1985, Enzyme immunoassay, complement fixation
and hemagglutination inhibition tests in the diagnosis of influenza A and B virus
Purified hemagglutinin in subtype-specific diagnosis, J. Vir.Methods.
10, 75-84.
34. Kandun IN, Wibisono H, Sedyaningsih ER, Yusharmen, Hadisoedarsuno W, et al.
(N. Engl. J.
Med, 355, pp. 2186-94.
35. Katz JM, Lim W, et al.       
avian influenza A (H5N1) viruses and detection of anti-H5 antibody among
J Infect Dis, 180, pp. 1763-70.
36. Lamb RA and Krug RM (2001),     
Fields Virology, 4th Edition, (D.M. Knipe and P.M. Howley, eds),
pp 1487-1531.
37. Lamb RA (1989), Genes and proteins of the influenza viruses. In: Krug R M, editor.
The influenza viruses. 1st ed. New York, N.Y: Plenum Press.
38. Le, Q., M. Kiso, K. Someya, Y. Sakai, T. Nguyen, K. Nguyen, N. Pham, H.
Nguyen, S. Yamada, Y. Muramoto, T. Horimoto, A. Takada, H. Goto, T.
       Avian flu: isolation of drug-
resistant H5N. Nature, 437(7062): p. 1108.
39. Lee C. W., Suarez D., Tumpey T., et al (2005), Characterization of Highly
Pathogenic H5N1 Avian Influenza A Viruses Isolated from South Korea,
Journal of Virology, 79(6), pp. 3692-3702.

40. Luong, G. and P. Pales      , Curr
Opinion Gen Develop, 2: p. 77-81.

Emerg. Infect. Dis., 11, pp. 1303-5
42. Rowe T, Abernathy RA, Hu-Primmer J, et al (1999), Detection of Antibody to
Avian Influenza A (H5N1) Virus in Human Serum by Using a Combination of
Serologic Assays, J Clin Microbiol, 37(4), pp. 937- 43.
43. Sastre A (2006), Antiviral Response in Pandemic Influenza Viruse, CDC, vol 12
number 1
44. Senne, DA, Panigrahy, B, Kawaoka, Y, Pearson, JE, Suss, J, Lipkind, M, Kida, H
and Webster, RG (1996) Survey of the hemagglutinin (HA) cleavage site
sequence of H5 and H7 avian influenza viruses: amino acid sequence at the HA
cleavage site as a marker oAvian Diseases, 40: 425-
437.
45. Swayne DE and Halverson DA (2007), Diseases of Poultry: Influenza, 12th edn.
Ames, IA: Blackwell Publishing Professional.
46. Takano R, Nidom CA, Kiso M, Muramoto Y, Yamada S, Sakai-Tagawa Y, Macken

viruses isolated in Indonesia from 2003-Virology, 390, pp. 13-21.
              
influenza A (H5N1) in 10 patN Engl J Med, 350, pp. 1179-88.
48. Uiprasertkul, M., R. Kitphati, P. Puthavathana, R. Kriwong, A. Kongchanagul, K.
Ungchusak, S. Angkasekwinai, K. Chokephaibulkit, K. Srisook, N. Vanprapar,
Apoptosis and pathogenesis of avian influenza A
 Emerg Infect Dis, 13(5): p. 708-712.
49. WHO inter-country-consultation, influenza A/H5N1 in humans in Asia: Manila,
Philippines, 6-7 May 2005.
50. World Health Organization (2009), Continuing progress towards a unified
nomenclature system for the highly pathogenic H5N1 avian influenza viruses.
                 

Science, 52, pp. 40711.
52. Yamada S, Suzuki Y, Suzuki T, Le MQ, Nidom CA, Sakai-Tagawa Y, Muramoto Y,
Ito M, Kiso M, Horimoto T, Shinya K, Sawada T, Kiso M, Usui T, Murata T, Lin
Y, Hay A, Haire LF, Stevens DJ, Russell RJ, Gamblin SJ, Skehel JJ, Kawaoka Y
   nsible for the binding of H5N1
influenza A viruses human-Nature, 444(7117): 378-382.