Tài liệu Báo cáo khoa học: Molecular cloning and characterization of soybean protein disulfide isomerase family proteins with nonclassic active center motifs pdf

Molecular cloning and characterization of soybean
protein disulfide isomerase family proteins with nonclassic
active center motifs
Kensuke Iwasaki
1
, Shinya Kamauchi
1,
*, Hiroyuki Wadahama
1
, Masao Ishimoto
2
, Teruo Kawada
1
and Reiko Urade
1
1 Division of Food Science and Biotechnology, Graduate School of Agriculture, Kyoto University, Uji, Japan
2 National Agricultural Research Center for Hokkaido Region, Sapporo, Japan
Introduction
Secretory, organelle and membrane proteins are synthe-
sized and folded with the assistance of molecular chap-
erones and other folding factors in the endoplasmic
reticulum (ER). In many cases, the process of protein
folding is accompanied by N-glycosylation and the for-
mation of disulfide bonds [1]. Disulfide bonds are
essential for structural stabilization and for regulation
of the functions of many secretory and plasma mem-
brane proteins [2,3]. The formation and isomerization
of disulfide bonds are catalyzed by protein disulfide
isomerase (PDI) and other PDI family proteins located
in the ER [4,5]. PDI has two thioredoxin domains
containing the redox active site CGHC (a and a¢) and

two inactive domains (b and b¢) [6]. Other PDI family
Keywords
cotyledon; disulfide bond; endoplasmic
reticulum; protein disulfide isomerase;
soybean
Correspondence
R. Urade, Graduate School of Agriculture,
Kyoto University, Uji, Kyoto 611-0011, Japan
Fax: +81 774 38 3758
Tel: +81 774 38 3757
E-mail:
*Present address
Osaka Bioscience Institute, Suita, Japan
Database
The nucleotide sequence data for the
cDNA of GmPDIL-3a, GmPDIL-3b and
genomic GmPDIL-3b are available in the
DDBJ ⁄ EMBL ⁄ GenBank databases under
accession numbers AB189468, AB189469
and AB303863, respectively
(Received 2 April 2009, revised 14 May
2009, accepted 29 May 2009)
doi:10.1111/j.1742-4658.2009.07123.x
Protein disulfide isomerase (PDI) and other PDI family proteins are mem-
bers of the thioredoxin superfamily and are thought to play important roles
in disulfide bond formation and isomerization in the endoplasmic reticulum
(ER). The exact functions of PDI family proteins in plants remain
unknown. In this study, we cloned two novel PDI family genes from soy-
bean leaf (Glycine max L. Merrill cv. Jack). The cDNAs encode proteins of
520 and 523 amino acids, and have been denoted GmPDIL-3a and GmP-

DIL-3b, respectively. GmPDIL-3a and GmPDIL-3b are the first plant ER
PDI family proteins reported to contain the nonclassic redox center motif
CXXS ⁄ C, and both proteins are ubiquitously expressed in the plant body.
However, recombinant GmPDIL-3a and GmPDIL-3b did not function as
oxidoreductases or as molecular chaperones in vitro, although a proportion
of each protein formed complexes in both thiol-dependent and thiol-inde-
pendent ways in the ER. Expression of GmPDIL-3a and GmPDIL-3b in
the cotyledon increased during seed maturation when synthesis of storage
proteins was initiated. These results suggest that GmPDIL-3a and
GmPDIL-3b may play important roles in the maturation of the cotyledon
by mechanisms distinct from those of other PDI family proteins.
Structured digital abstract
l
MINT-7137566: Bip (uniprotkb:Q587K1), GmPDIL-3b (genbank_nucleotide_g:51848586)
and GmPDIL-3a (genbank_nucleotide_g:
51848584) colocalize (MI:0403)bycosedimentation
through density gradients (
MI:0029)
Abbreviations
ER, endoplasmic reticulum; PDI, protein disulfide isomerase; PDILT, testis-specific protein disulfide isomerase-like protein; PVDF,
poly(vinylidene difluoride).
4130 FEBS Journal 276 (2009) 4130–4141 ª 2009 The Authors Journal compilation ª 2009 FEBS
members contain one or more thioredoxin domains [7].
PDI family proteins containing the redox active center
transfer the disulfide bond between the two cysteine
residues of their active site to the substrate protein [8].
Recently, it has been shown that PDI family proteins
containing nonclassic redox motifs, such as yeast
Eug1p and mammalian testis-specific PDI-like protein
(PDILT) and ERp44, may function in protein folding,

retention or transport of ER proteins, or regulation of
ER calcium channel activity [9–12].
In plants, a set of 22 orthologs of known PDI family
proteins was discovered by a genome-wide search of
Arabidopsis thaliana, and was separated into 10 phylo-
genetic groups [13]. However, little is known about the
physiological roles of plant PDI family members. Stud-
ies investigating their contribution to protein folding,
transport and quality control are only now beginning.
Soybean seeds contain large amounts of protein,
especially in their cotyledon cells, where large quanti-
ties of storage proteins such as glycinin and b-conglyci-
nin are synthesized and folded in the ER during seed
development [14,15]. PDI family proteins are predicted
to function in collaboration with other molecular
chaperones during the folding of these proteins. Previ-
ously, we identified and characterized five soybean
PDI family proteins belonging to group I (GmPDIL-1),
group II (GmPDIL-2), group IV (GmPDIS and GmP-
DIS-2), and group V (GmPDIM) [16–18], which all
contain two classic CGHC motifs. All of these proteins
had thiol oxidoreductase activity in vitro and were
ubiquitously expressed in the body of the plant. GmP-
DIL-1, GmPDIM and GmPDIS-1 are unfolded protein
response genes, and were upregulated by the accumula-
tion of unfolded proteins in the ER. GmPDIS-1 and
GmPDIM associate with proglycinin (glycinin precur-
sor prior to proteolytic processing), and GmPDIL-1
and GmPDIL-2 associate with proglycinin and b-con-
glycinin in the ER, suggesting that they may play

important roles in folding and in formation and
rearrangement of disulfide bonds in the storage
proteins.
Group III PDI family proteins have not been stud-
ied. Putative amino acid sequences obtained from
Arabidopsis genome sequence predict the typical PDI
domain structure a–b–b¢–a¢, but that both the
a-domain and a¢-domain contain nonclassic CXXS ⁄ C
motifs as opposed to the more traditional CGHC
sequence. In this study, we describe soybean group III
PDI family ER proteins, namely GmPDIL-3a and
GmPDIL-3b, and identify nonclassic redox center
CXXS ⁄ C motifs in each. Characterization of GmP-
DIL-3a and GmPDIL-3b and changes in their
expression during seed development are described. In
addition, our data suggest that GmPDL-3a and
GmPDIL-3b form protein complexes in both thiol-
dependent and thiol-independent ways in the ER.
Results
cDNA cloning of GmPDIL-3a and GmPDIL-3b
In order to clone the soybean orthologs of Arabidopsis
PDI-like1-5 and PDI-like1-6 (group III PDIs) [13], we
first obtained their nucleotide sequences from the Insti-
tute for Genomic Research Soybean Index and used
them in blast searches. We identified the tentative
consensus sequence TC183516, and primer sets were
designed on the basis of this sequence. Two cDNAs
were cloned using RNA extracted from young soybean
leaves by 5¢-RACE and 3¢-RACE using these primers.
Genomic GmPDIL-3b was cloned and sequenced,

whereas the genomic sequence data of GmPDIL-3a
were obtained from phytozome v3.1.1 (Department of
Energy Joint Genome Institute and the Center for
Integrative Genomics, />bean#A). Comparison of the genomic sequences of
GmPDIL-3a and GmPDIL-3b with those of the Ara-
bidopsis and rice orthologs showed conservation of
exon ⁄ intron structure across these plant species
(Fig. S1).
Two AUG codons (AUG1 and AUG2) were found
upstream of the putative functional translation initia-
tion codon (AUG3). Initiation of translation from
AUG3 produces 520 or 523 amino acid proteins
named GmPDIL-3a and GmPDIL-3b, respectively, in
both mRNAs (Figs 1A and S2). To determine
whether AUG3 in both mRNAs was the authentic
initiation codon, in vitro translation reactions were
performed using in vitro transcribed wild-type mRNA,
or an mRNA containing an AUG codon mutant(s).
A 54 kDa polypeptide was generated when wild-type
GmPDIL-3a mRNA was used (Fig. 1B, lane 2), but
was not detected when a mutant GmPDIL-3a mRNA
that contained AGG in place of AUG3 was used
(lane 6). However, this polypeptide was translated
when both AUG1 and AUG2 were changed to AGG,
confirming that neither AUG1 nor AUG2 is the
authentic initiation codon (Fig. 1B, lanes 3–5). A lar-
ger amount of the 54 kDa polypeptide was generated
from the GmPDIL-3a mRNA with the AUG2 muta-
tion (Fig. 1B, lanes 4 and 5) than from that contain-
ing only the AUG1 mutation (lane 3) or wild-type

mRNA (lane 2), suggesting that initiation events can
also begin at AUG2, but are unproductive because of
the stop codon located just upstream of AUG3. On
the other hand, AUG1 in GmPDIL-3a mRNA may
K. Iwasaki et al. Novel plant PDI family proteins
FEBS Journal 276 (2009) 4130–4141 ª 2009 The Authors Journal compilation ª 2009 FEBS 4131
not be used as efficiently for translation initiation,
and therefore may not interfere with translation from
AUG3. For GmPDIL-3b, a 59 kDa polypeptide was
generated from wild-type mRNA, and from mRNA
that contained AGG in place of both AUG1 and
AUG2 (Fig. 1C, lanes 2–5), whereas it was not trans-
lated from mutant mRNA in which both AUG3 and
AUG4 were changed to AGG (lane 6). The amino
acid sequence identity shared between GmPDIL-3a
and GmPDIL-3b, excluding the signal peptides, was
92%. The structure of GmPDIL-3a and GmPDIL-3b
was predicted to contain the four domains a–b–b¢–a¢
(Fig. 1D). GmPDIL-3a and GmPDIL-3b have two
predicted thioredoxin domains between amino acids
65–164 and 403–481, and 68–167 and 406–508,
respectively, corresponding to the a-domain and
a¢-domain of PDI [7]. Notably, both GmPDIL-3a and
GmPDIL-3b lack the two classic PDI redox-active
CGHC motifs within the a-domain and a¢-domain.
Instead, they both contain the sequence CPRS in the
a-domain and CMNC or CINC in the a¢-domain.
GmPDIL-3a and GmPDIL-3b contain a C-terminal
KDEL sequence that probably functions in ER reten-
tion ⁄ retrieval [19], and one putative N-glycosylation

site.
Recombinant GmPDIL-3a and GmPDIL-3b have
neither thiol oxidoreductase nor chaperone
activities in vitro
Many types of PDI family proteins have oxidative
refolding activity on unfolded polypeptides and ⁄ or the
ability to reduce disulfide bonds [7,8]. To determine
whether GmPDIL-3a or GmPDIL-3b possesses these
activities, recombinant mature forms of each pro-
tein were expressed in Escherichia coli and purified
(Fig. S3A,B). Both proteins were soluble and eluted in
a monomeric form from a gel filtration column (data
not shown). It was confirmed by far-UV CD experi-
ments that the two proteins were folded (Fig. S3C).
A
B
C
D
Fig. 1. Identification of the initiation codons
in GmPDIL-3a and Gm-PDIL-3b mRNAs. (A)
Schematic representation of the structure of
GmPDIL-3a and GmPDIL-3b mRNAs. The
putative ORFs (gray boxes) of GmPDIL-3a
and GmPDIL-3b are indicated. AUG1, AUG2,
AUG3 and AUG4 indicate the first, second,
third and fourth AUG codons from the
5¢-termini, respectively. Crosses indicate ter-
mination codons. (B) In vitro translation of
GmPDIL-3a. Translation reactions were per-
formed without (lane 1) or with (lane 2) 1 lg

of wild-type GmPDIL-3a mRNA or mutant
GmPDIL-3a mRNA, of which the first (lane
3), second (lane 4), first and second (lane 5)
or third AUG (lane 6) was replaced with
AGG. Products were separated by
SDS ⁄ PAGE and detected by fluorography.
(C) In vitro translation of GmPDIL-3b. Trans-
lation reactions were performed without
(lane 1) or with (lane 2) 1 lg of wild-type
GmPDIL-3b mRNA, or with mutant GmP-
DIL-3b mRNA, of which the first (lane 3),
second (lane 4), first and second (lane 5)
or third and fourth AUGs (lane 6) were
replaced with AGG. (D) Putative domain
structure of GmPDIL-3a and GmPDIL-3b.
The boxes indicate the domain boundaries
predicted by an NCBI conserved domain
search. Black boxes in domain-a and
domain-a¢ represent the CPRS and CXXC
motifs. A closed circle with a bar represents
an N-glycosylation consensus site. SP,
signal peptide.
Novel plant PDI family proteins K. Iwasaki et al.
4132 FEBS Journal 276 (2009) 4130–4141 ª 2009 The Authors Journal compilation ª 2009 FEBS
As shown in Fig. 2A,B, neither protein was able to
catalyze the oxidation of thiol residues on the synthetic
peptide and the oxidative refolding of reduced and
denatured RNase A. In addition, neither protein
reduced the disulfide bond in insulin (Fig. 2C). As it
has been reported that mammalian PDI family pro-

teins function together with other PDI family proteins
or with molecular chaperones to effectively fold nas-
cent proteins [20–23], we next tested the ability of
GmPDIL-3a and GmPDIL-3b to work in concert with
the other soybean PD1 proteins Gm-PDIL-1 and
GmPDIL-2 [16]. However, as shown in Fig. 2B, GmP-
DIL-3a and GmPDIL-3b had no stimulatory effect on
the oxidative refolding of RNase A by GmPDIL-1 and
GmPDIL-2 when mixed together, further confirming
that the functional properties of GmPDIL-3a and
GmPDIL-3b are probably unique.
Among other soybean PDI proteins, GmPDIL-1
and GmPDIL-2 function as molecular chaperones, and
prevent the aggregation of unfolded rhodanese [16].
We next tested whether GmPDIL-3a and GmPDIL-3b
function in a similar manner. Aggregation of unfolded
rhodanese occurred over 14 min in the absence of
PDI, and was partially inhibited by GmPDIL-2
(Fig. 2D). On the other hand, GmPDIL-3a and GmP-
DIL-3b did not inhibit the aggregation of rhodanese,
even at concentrations up to 1.2 lm (3 : 1 molar ratio,
PDI to rhodanese), suggesting that they do not func-
tion as molecular chaperones like other PDI family
proteins.
A
B
C
D
Fig. 2. GmPDIL-3a and GmPDIL-3b have neither oxidoreductase nor chaperone activity. (A) Thiol oxidase activities of recombinant GmPDIL-
3a (open circles), GmPDIL-3b (solid circles) and bovine PDI (solid squares) were assayed using the synthetic peptide as a substrate as

described in Experimental procedures. (B) Oxidative refolding activity of recombinant GmPDIL-3a (3a), GmPDIL-3b (3b), GmPDIL-1 (L-1),
L-1 plus 3a or 3b, GmPDIL-2 (L-2), or L-2 plus 3a or 3b. Activity was assayed by measuring the RNase activity produced through the
regeneration of the active form of reduced RNase A. Data represent the mean ± standard deviation for three experiments. (C) Thiol
reductase activities of recombinant GmPDIL-3a (open circles), GmPDIL-3b (solid circles) and bovine PDI (solid squares) were assayed
using insulin as a substrate. (D) Chaperone activities of recombinant GmPDIL-3a, GmPDIL-3b and GmPDIL-2 were assayed by measuring
the aggregation of rhodanese in the absence (open triangles) or presence of GmPDIL-3a (open circles), GmPDIL-3b (solid circles), or
GmPDIL-2 (solid squares).
K. Iwasaki et al. Novel plant PDI family proteins
FEBS Journal 276 (2009) 4130–4141 ª 2009 The Authors Journal compilation ª 2009 FEBS 4133
Expression of GmPDIL-3a and GmPDIL-3b in
soybean tissue
We next prepared antiserum directed against recombi-
nant GmPDIL-3a and a synthetic peptide containing
sequences found in GmPDIL-3b, but not in GmPDIL-
3a. Anti-GmPDIL-3a serum recognized both recombi-
nant GmPDIL-3a and GmPDIL-3b (Fig. 3A, lanes 1
and 2), whereas anti-GmPDIL-3b serum reacted exclu-
sively with recombinant GmPDIL-3b (Fig. 3A, lanes 4
and 5). Anti-GmPDIL-3a serum reacted with both a
55 kDa and a 59 kDa band in western blot analysis
of cotyledon proteins (Fig. 3A, lane 3). Both the 55
and 59 kDa bands were N-glycosylated, as digestion
experiments using glycosidase F resulted in the
bands shifting to 53 and 57 kDa, respectively (Fig. 3B).
The cotyledon proteins that were deglycosylated
with glycosidase F and detected with the serum were
characterized by two-dimensional gel electrophoresis
and western blot analysis. Two spots of 53 and
57 kDa, with isoelectric points of 5.3 and 5.1, respec-
tively, were detected with anti-GmPDIL-3a serum

(Fig. 3C, upper panel). The isoelectric point of the
53 kDa spot (5.3) was identical to a pI value calcu-
lated from the amino acid sequence of GmPDIL-3a,
and the isoelectric point of the 57 kDa spot (5.1) was
consistent with that from the amino acid sequence of
GmPDIL-3b. GmPDIL-3b antiserum detected the
57 kDa spot, but not the 53 kDa spot (Fig. 3C, lower
panel), suggesting that the 53 and 57 kDa spots are
GmPDIL-3a and GmPDIL-3b, respectively. Samples
from different parts of the soybean plant were
then prepared and analyzed by western immunoblot.
GmPDIL-3a and GmPDIL-3b were expressed in roots,
stems, trifoliolate leaves, flowers, and cotyledons
(Fig. 3D), suggesting that it is a ubiquitously expressed
protein that probably performs a function common to
all of these tissues.
Both GmPDIL-3a and GmPDIL-3b have N-termi-
nal signal sequences that target these proteins to the
A
B D
C
Fig. 3. Expression of GmPDIL-3a and GmPDIL-3b in soybean
tissues. (A) Purified recombinant GmPDIL-3a (lanes 1 and 4),
GmPDIL-3b (lanes 2 and 5) and proteins extracted from the cotyle-
don (lane 3) were analyzed by western blot using anti-GmPDIL-3a
serum (lanes 1–3) or anti-GmPDIL-3b serum (lanes 4 and 5).
(B) GmPDIL-3a and GmPDIL-3b are N-glycosylated in soybean. The
proteins extracted from the cotyledon were treated without (lane 1)
or with (lane 2) glycosidase F. Proteins were analyzed by western
blot using anti-GmPDIL-3a serum. (C) Cotyledon proteins were

treated with glycosidase F, separated by two-dimensional electro-
phoresis, and analyzed by western blot using anti-GmPDIL-3a
serum (upper panel) or anti-GmPDIL-3b serum (lower panel). pI, iso-
electric point. (D) Thirty micrograms of protein extracted from the
cotyledon (80 mg bean) (lane 1), root (lane 2), stem (lane 3), leaf
(lane 4) and flower (lane 5) were analyzed by western blot using
anti-GmPDIL-3a serum.
A
B
Fig. 4. Localization of GmPDIL-3a and GmPDIL-3b in the ER
lumen. (A) Microsomes were isolated from cotyledons (100 mg
bean), and were fractionated on isopyknic sucrose gradients in the
presence of MgCl
2
or EDTA. Proteins from each fraction were ana-
lyzed by western blot using anti-GmPDIL-3a serum or anti-BiP
serum. The top of the gradient is on the left, and density (gÆmL
)1
)
is indicated on the top. (B) Microsomes were treated without (lanes
1 and 2) or with (lanes 3 and 4) proteinase K, in the absence (lanes
1 and 3) or presence (lanes 2 and 4) of Triton X-100. Microsomal
proteins (10 lg) were analyzed by western blot using anti-GmPDIL-
3a serum.
Novel plant PDI family proteins K. Iwasaki et al.
4134 FEBS Journal 276 (2009) 4130–4141 ª 2009 The Authors Journal compilation ª 2009 FEBS
ER, and a C-terminal ER retention sequence (KDEL).
To confirm localization of GmPDIL-3a and GmPDIL-
3b to the ER, microsomes were prepared from cotyle-
don cells and were separated by sucrose gradient

centrifugation in the presence of MgCl
2
or EDTA, and
fractions were collected and analyzed by western blot
(Fig. 4A). Peaks corresponding to GmPDIL-3a and
GmPDIL-3b were detected at a density of 1.21 gÆmL
)1
in the presence of MgCl
2
. In the presence of EDTA,
which releases ribosomes from the rough ER [24], the
peaks of GmPDIL-3a and GmPDIL-3b were shifted to
the lighter sucrose fractions and therefore had a
reduced density of 1.16 gÆmL
)1
, suggesting that GmP-
DIL-3a and GmPDIL-3b localize to the rough ER. To
confirm the presence of GmPDIL-3a and GmPDIL-3b
in the ER lumen, microsomes were prepared from
cotyledon cells and were treated with proteinase K in
the absence or presence of Triton X-100. Both GmP-
DIL-3a and GmPDIL-3b were resistant to protease
treatment in the absence of detergent, and were
degraded when detergent was added (Fig. 4B), suggest-
ing that they are both luminal proteins.
Generally, PDI family proteins play important roles
in folding and quality control of nascent polypeptides
[25]. In soybean cotyledon, large amounts of seed stor-
age proteins such as glycinin and b-conglycinin are
synthesized and translocated into the ER lumen during

the maturation stage of embryogenesis. Therefore, we
next measured the mRNA and protein levels of GmP-
DIL-3a and GmPDIL-3b by real-time RT-PCR and
western blotting, respectively, during different stages of
development. The amounts of pro-b-conglycinin and
proglycinin are considered to be nearly equivalent to
the synthesis levels of both b-conglycinin and glycinin,
as pro-b-conglycinin and proglycinin are transient pro-
tein forms that are present in the ER prior to process-
ing in the protein storage vacuoles. The synthesis of
proglycinin and pro-b-conglycinin was initiated when
the seeds achieved a mass of 50 mg (Fig. 5A, lanes 2
and 4). The amount of GmPDIL-3a and GmPDIL-3b
proteins increased until the seeds grew from 40 to
80 mg (Fig. 5A, lane 1). Thereafter, the level remained
constant. This event correlated with the amount of
GmPDIL-3a mRNA, although the amount of GmP-
DIL-3b mRNA was not consistent with the amount of
GmPDIL-3b protein expression (Fig. 5B).
Expression of many ER-resident proteins can be
upregurated by ER stress in plant cells [26–28]. There-
fore, we next measured the amounts of GmPDIL-3a
and GmPDIL-3b mRNA in cotyledon cells under
stress by treatment with tunicamycin or dithiothreitol.
The amount of neither mRNA was affected by either
treatment, whereas the mRNA of BiP, which is a
representative unfolded protein response gene, was
dramatically upregulated (data not shown). These data
suggest that expression of neither GmPDIL-3a nor
GmPDIL-3b is influenced by cellular stress.

GmPDIL-3a and GmPDIL-3b form protein
complexes in the ER
Many ER proteins form complexes with other ER resi-
dent proteins, and associate with nascent polypeptides
during folding [22,29]. We next determined whether
GmPDIL-3a or GmPDIL-3b forms complexes in the
ER. Cotyledon proteins were extracted with digitonin
A
B
Fig. 5. Expression of GmPDIL-3a and GmPDIL-3b in soybean coty-
ledons during maturation. (A) Cotyledon proteins (25 lg) were sepa-
rated by SDS ⁄ PAGE and immunostained with anti-GmPDIL-3a
serum (lane 1), anti-pro-b-conglycinin a¢ serum (lane 2), anti-b-con-
glycinin a¢ serum (lane 3), and anti-glycinin acidic subunit serum
(lanes 4 and 5). 3a, GmPDIL-3a; 3b, GmPDIL-3b; Pro 7S-a¢, pro-
b-conglycinin a¢; 7S-a¢, mature-b-conglycinin a¢; Pro 11S, proglyci-
nin; and 11S-A, mature glycinin acidic subunit. (B) GmPDIL-3a
mRNA (upper panel) and GmPDIL-3b mRNA (lower panel) were
quantified by real-time RT-PCR. Each value was normalized by
dividing it by that for actin mRNA. Values were calculated as a
percentage of the highest value obtained during maturation. Data
represent the mean ± standard deviation of four experiments.
K. Iwasaki et al. Novel plant PDI family proteins
FEBS Journal 276 (2009) 4130–4141 ª 2009 The Authors Journal compilation ª 2009 FEBS 4135
and were separated by blue native PAGE, which pro-
vides analysis of native proteins and protein complexes
[30]. Blue native gels were subjected to SDS⁄ PAGE as
a second-dimension separation, followed by western
blot analysis (Fig. 6A). Multiple complexes containing
GmPDIL-3a or GmPDIL-3b with molecular sizes

larger than those of monomeric GmPDIL-3a or
GmPDIL-3b were detected in the region of 130–
300 kDa (Fig. 6A). A proportion of GmPDIL-3a or
GmPDIL-3b in these complexes was detected as mixed
disulfides. When western blots were performed in the
presence of N-ethylmaleimide to trap any disulfide-
bound intermediates under nonreducing conditions,
trace amounts of GmPDIL-3a and GmPDIL-3b mole-
cules were found to be engaged in intermolecular,
disulfide-linked complexes of approximately 130 kDa
(Fig. 6B, lane 3). As these mixed disulfide bonds disap-
peared under reducing conditions (Fig. 6B, lane 1), it
is likely that GmPDIL-3a or GmPDIL-3b interacts
with proteins in the ER through a redox-dependent
mechanism. When nonreducing experiments were per-
formed after crosslinking treatment of associated pro-
teins with dithiobis(succinimidyl propionate), the
130 kDa complexes decreased in abundance, whereas
complexes ranging in size from 200 kDa to greater
than 250 kDa appeared (Fig. 6B, lane 4). This could
suggest that a proportion of the 130 kDa disulfide-
linked complexes associated noncovalently with other
proteins. Partner proteins for GmPDIL-3a or GmP-
DIL-3b in these complexes remain to be identified.
Discussion
In this report, we characterized new members of the
plant PDI family, which we now refer to as GmP-
DIL-3a and GmPDIL-3b. The conserved exon struc-
ture of the GmPDIL-3a and GmPDIL-3b genomic
sequences suggests that both genes may have arisen

by gene or chromosome duplication. The conservation
of GmPDIL-3a and GmPDIL-3b orthologs in higher
plants suggests that they play important physiological
roles in these systems. In the cotyledon, maximal
expression of GmPDIL-3a and GmPDIL-3b in the
late stage of seed development suggests that they per-
form a unique role in folding or in accumulation of
storage proteins, which are synthesized during this
stage. Both GmPDIL-3a and GmPDIL-3b have the
same domain architecture, a–b–b ¢–a¢, as the soybean
group I and group II PDI family proteins GmPDIL-1
and GmPDIL-2. GmPDIL-3a and GmPDIL-3b share
30% identity with GmPDIL-2, but contain the non-
classic redox motif CXXS ⁄ C as opposed to the more
common CGHC motif. Atypical CXXS ⁄ C motifs in
thioredoxin domains have been noted in some PDI
family proteins of yeast and animals [9–12], but this
is the first report to confirm expression of such pro-
teins in the ER of plants. A CXXS motif and a
CXXC motif in the N-terminal and C-terminal thi-
oredoxin domains and the surrounding sequences are
extremely conserved between plant orthologs of GmP-
DIL-3a and GmPDIL-3b, suggesting an important
functional role for these regions. PDI requires both
cysteine residues present in the redox active site for
oxidase activity, but the N-terminal cysteine is suffi-
cient for isomerase function [31,32]. Recombinant
GmPDIL-3a and GmPDIL-3b showed no oxidase
activity in vitro, although they have a CXXC motif in
A

B
Fig. 6. GmPDIL-3a or GmPDIL-3b form protein complexes in a
thiol-dependent or thiol-independent manner in the ER. (A) Cotyle-
don proteins (100 mg bean) were extracted with digitonin and ana-
lyzed by two-dimensional electrophoresis on blue native (BN) PAGE
and SDS ⁄ PAGE and western blot using anti-GmPDIL-3a serum. (B)
Cotyledon proteins (100 mg bean) treated with (lanes 2 and 4) or
without (lanes 1 and 3) dithiobis(succinimidyl propionate) (DSP)
were lysed in the presence of N-ethylmaleimide and analyzed by
10% reducing (R) or nonreducing (NR) SDS ⁄ PAGE and western blot
using anti-GmPDIL-3a serum.
Novel plant PDI family proteins K. Iwasaki et al.
4136 FEBS Journal 276 (2009) 4130–4141 ª 2009 The Authors Journal compilation ª 2009 FEBS
their a¢-domain. Additionally, GmPDIL-3a and GmP-
DIL-3b showed no reductase activity. Replacement of
the second and third amino acids in classic redox-
active CGHC motifs with methionine or isoleucine
and asparagine in GmPDIL-3a and GmPDIL-3b may
be the cause of the lack of such enzymatic activities.
Alternatively, the lack of other amino acids, such as
arginine, which is important for the regulation of the
active site redox potential in human PDI [8,33], may
cause the lack of enzymatic activity. Mammalian
PDILT, which has the same domain structure as
PDI, but lacks oxidoreductase activity, has been dem-
onstrated to have chaperone activity in vitro [34]. As
PDILT forms a complex with the calnexin homolog
calmegin in vitro, this protein is thought to function
as a redox-inactive chaperone for glycoprotein folding
in testis. However, neither GmPDIL-3a nor GmP-

DIL-3b showed chaperone activity in vitro, although
it was demonstrated that they formed noncovalent
complexes with unidentified proteins in the ER. In
addition, interaction between GmPDIL-3a or GmP-
DIL-3b and storage proteins such as proglycinin and
b-conglycinin, and other ER molecular chaperones
such as calnexin, calreticulin, BiP and PDI family
proteins, in vivo was not detected (data not shown),
suggesting that GmPDIL-3a and GmPDIL-3b may
not act as chaperones in the ER.
A proportion of GmPDIL-3a and GmPDIL-3b
formed mixed disulfide complexes with an unidenti-
fied protein in the ER. Mammalian PDI family pro-
tein ERp44 forms transient intermolecular bonds
with substrate proteins or with the disulfide donor
Ero1s. ERp44 cannot be an oxidoreductase, because
it has CRFS instead of CGHC. However, the cyste-
ine in this motif forms transient mixed disulfide
bonds with IgM subunits, adiponectin, and formyl-
glycine-generating enzyme, which are devoid of ER
retention signals, to regulate their transport [35–38].
ERp44 also functions to retain Ero1a and Ero1b into
the ER by forming a mixed disulfide bond and by
controlling the ratio of redox isoforms of Ero1a
[12,38,39]. Instead, GmPDIL-3a and GmPDIL-3b
may function as retention or redox devices, like
ERp44, rather than as chaperones. In any case, iden-
tification of partner proteins in the mixed disulfide
complex and noncovalent complexes of GmPDIL-3a
and GmPDIL-3b will be required to establish their

physiological function.
Little is known about the coordinated function of
ER chaperones in the plant. Previously, we observed
that at least four types of PDI family proteins (GmP-
DIL-1, GmPDIL-2, GmPDIM, and GmPDIS) were
expressed ubiquitously in the plant body [16–18]. Thus,
it may be difficult to substitute other PDI family pro-
teins for GmPDIL-3a or Gm-PDIL-3b, as they proba-
bly have unique functions in the plant. The details of
how PDI family proteins contribute to ER function
and protein folding are beginning to emerge, and,
importantly, knowledge concerning GmPDIL-3a and
GmPDIL-3b can now be applied to the understanding
of how divergent PDI family proteins contribute to
quality control in the ER, and how this process influ-
ences vital plant function.
Experimental procedures
Plants
Soybean seeds (Glycine max L. Merrill cv. Jack) were
planted in 5 L pots and grown in a controlled environment
chamber at 25 °C under 16 h day ⁄ 8 h night cycles. Roots
were collected from plants 10 days after seeding. Flowers,
leaves and stems were collected from plants 45 days after
seeding. All samples were immediately frozen and stored in
liquid nitrogen until use.
Cloning of GmPDIL-3a and GmPDIL-3b
Cloning of the cDNAs for GmPDIL-3a and GmPDIL-3b
was performed by 3¢-RACE and 5¢-RACE. Soybean trifolio-
late center leaves were frozen under liquid nitrogen and then
ground into a fine powder with an SK-100 micropestle

(Tokken, Inc., Chiba, Japan). Total RNA was isolated using
the RNeasy Plant Mini kit (Qiagen Inc., Valencia, CA,
USA), according to the manufacturer’s protocol. mRNA
was isolated from total RNA with the PolyATtract mRNA
Isolation System (Promega Corporation, Madison, WI,
USA). The 3¢-RACE method was performed using the
SMART RACE cDNA Amplification kit (Clontech Labora-
tories, Inc., Mountain View, CA, USA), according to the
manufacturer’s protocol, using the primer 5¢-ACTCTCC
TGAATCTTGTTAAC-3¢. The amplified DNA fragments
were subcloned into the pT7Blue vector (TaKaRa Bio Inc.,
Shiga, Japan), and the inserts in the plasmid vectors were
sequenced using the fluorescence dideoxy chain termination
method and an ABI PRISM 3100-Avant Genetic Analyzer
(Applied Biosystems, Foster City, CA, USA). The 5¢-RACE
method was performed using the primer 5¢-GAAGCGTGG
GGTAGTCATTCACTTGCAG-3¢, which was designed on
the basis of the sequence obtained by 3¢-RACE. The ampli-
fied DNA fragments were subcloned into the pT7Blue vector
and sequenced as described above.
In vitro translation
Plasmids containing the cDNA fragments encoding GmP-
DIL-3a or GmPDIL-3b with mutations in the ATG codons
K. Iwasaki et al. Novel plant PDI family proteins
FEBS Journal 276 (2009) 4130–4141 ª 2009 The Authors Journal compilation ª 2009 FEBS 4137
were constructed as follows. DNA fragments with mutations
were amplified from cDNA of wild-type GmPDIL-3a or
GmPDIL-3b as template by PCR, using a mutagenic primer
and a forward primer (Table S1). Then, the second PCR
was performed using the reaction mixture of the first PCR

and a reverse primer (Table S1). Wild-type and mutagenic
DNA fragments were subcloned at the SpeI restriction site
into pT7Blue (TaKaRa Bio Inc.) and sequenced. Plasmids
were linearized by digestion with KpnI, and were tran-
scribed in vitro using a RiboMax Large Scale RNA produc-
tion systems kit (Promega Corporation). In vitro translation
reactions were performed in in a total volume of 25 lL
containing 1 lg of mRNA, 555 kBq of L-[
35
S] in vitro cell
labeling mix (37 TBqÆmmol
)1
; GE Healthcare BioSciences
Corporation, Piscataway, NJ, USA), 80 lm cysteine ⁄ methi-
onine-free amino acid mixture, 0.8 units of RNasin ribo-
nuclease inhibitor, 120 mm potassium acetate, and 12.5 lL
of wheat germ extract (Promega Corporation) at 25 °C
for 90 min. Proteins were separated by 10% SDS ⁄ PAGE,
and were detected by fluorography with ENLIGHTNING
(Perkin Elmer Life Sciences, Boston, MA, USA).
Construction of expression plasmids
Expression plasmids encoding mature GmPDIL-3a (Thr24–
Leu520) and GmPDIL-3b (Ser27–Leu523), excluding the
putative signal peptides, were constructed as follows. DNA
fragments were amplified from GmPDIL-3a and GmPDIL-
3b cDNAs by PCR using the primers 5¢-GACGACGACA
AGATGGAGGTTAAGGATGAGTTG-3¢ and 5¢-GAG
GAGAAGCCCGGTCTATAACTCATCTTTGAGTAC-3¢
for GmPDIL-3a, and 5¢ -GACGACGACAAGATGGAGG
TTGAGGATGAGTTGG-3¢ and 5¢-GAGGAGAAGCCCG

GTTCATAACTCATCTTTGACGAC-3¢ for GmPDIL-3b.
Amplified DNA fragments were subcloned into pET46Ek ⁄
LIC (EMD Biosciences, Inc., San Diego, CA, USA) and
sequenced. The recombinant proteins have the His-tag
linked to the N-terminus.
Expression and purification of recombinant
GmPDIL-3a and GmPDIL-3b
E. coli BL21(DE3) cells were transformed with the expres-
sion vectors described above. The expression of recombi-
nant GmPDIL-3a was induced in the presence of 0.4 mm
isopropyl thio-b-d-galactoside at 4 °C for 5 days, whereas
the expression of recombinant GmPDIL-3b was induced in
the presence of 0.4 mm isopropyl thio-b-d-galactoside at
30 °C for 4 h. Extraction and purification of recombinant
proteins was performed as described previously [18]. The
concentration of each protein was determined by measuring
the absorbance at 280 nm using the molar extinction coeffi-
cient of 31 830 m
)1
Æcm
)1
for both proteins, as calculated
according to the modified method of Gill and von Hippel
[40]. The concentration of the proteins extracted from
soybean tissues was measured by RC-DC protein assay
(Bio-Rad Laboratories, Hercules, CA, USA).
Enzymatic activity assays
Thiol oxidative refolding activity was assayed as previously
described by measuring RNase activity produced through the
regeneration of the active form from reduced and denatured

RNase A in the presence of 0.5 lm recombinant GmPDIL-
3a, GmPDIL-3b, GmPDIL-1, or GmPDIL-2 [41,42]. Thiol
reductase activity was measured as previously described,
where the glutathione-dependent reduction of insulin was
measured by Morjana and Gilbert [43]. Briefly, 50 lgof
bovine PDI (TaKaRa Bio Inc.), recombinant GmPDIL-3a or
recombinant GmPDIL-3b was incubated in 1 mL of 0.2 m
sodium phosphate buffer (pH 7.5) containing 5 mm EDTA,
3.7 mm reduced glutathione, 0.12 mm NADPH, 16 U of glu-
tathione reductase (Sigma-Aldrich Inc., St Louis, MO, USA)
and 30 lm insulin (Sigma-Aldrich Inc.) at 25 °C, and absor-
bance was monitored at 340 nm. Oxidase activity was
assayed using a synthetic peptide, NH
2
-NRCSQGSCWN-
COOH, as described by Alanen et al. [44]. Briefly, 0.5 lm
bovine PDI, recombinant GmPDIL-3a or recombinant
GmPDIL-3b was incubated in 0.2 m sodium phosphate ⁄
citrate buffer (pH 6.5), 2 mm reduced glutathione, 0.5 mm
oxidized glutathione and 5 lm synthetic peptide at 25 °C,
and fluorescence was monitored at 350 nm with excitation at
280 nm on a Hitachi F-3000 fluorescence spectrophotometer
(Hitachi Ltd, Tokyo, Japan).
Chaperone activity assays
Chaperone activity was assayed as described previously
[45]. Briefly, aggregation of 0.4 lm rhodanese (Sigma-
Aldrich Inc.) during refolding was measured spectrophoto-
metrically at 320 nm (25 °C) in the absence or presence
of 1.2 lm recombinant GmPDIL-3a, GmPDIL-3b, and
GmPDIL-2.

Antibody production
Guinea pig antiserum specific for GmPDIL-3a and rabbit
antiserum specific for a GmPDIL-3b peptide were prepared
using recombinant GmPDIL-3a and the synthetic peptide
GSVTEAEKFLRKY, which was conjugated to keyhole
limpet hemocyanin by Operon Biotechnologies, K.K.
(Tokyo, Japan). Antisera specific for pro-b-conglycinin,
b-conglycinin, glycinin acidic subunit and BiP were
prepared as described previously [18].
Western blot analysis
Proteins were extracted from plant tissues by boiling in
SDS ⁄ PAGE buffer [46]. To cleave N-linked glycans,
Novel plant PDI family proteins K. Iwasaki et al.
4138 FEBS Journal 276 (2009) 4130–4141 ª 2009 The Authors Journal compilation ª 2009 FEBS
proteins were extracted from the cotyledons in buffer
containing 0.02% SDS, 0.1 m Tris ⁄ HCl (pH 8.6), and 1%
Nonidet P-40. Approximately 0.4 mg of protein was treated
with 10 mU of glycosidase F (Sigma-Aldrich Inc.) at 37 °C
for 16 h. For crosslinking of proteins, slices of cotyledons
were homogenized with 20 strokes of a Dounce homo-
genizer at 4 °C in 3 mL of buffer containing 20 mm Hepes
(pH 7.2), 150 mm NaCl, 1% protease inhibitor cocktail for
plant cells (Sigma-Aldrich Inc.), and 20 mm N-ethylmale-
imide, in the presence or absence of 20 mm dithiobis(succin-
imidyl propionate). The homogenate was placed on ice for
2 h, and crosslinking was terminated by the addition of
20 mm glycine for 20 min on ice. Proteins were then sus-
pended in SDS ⁄ PAGE buffer and subjected to SDS ⁄ PAGE
[46], and were transferred to poly(vinylidene difluoride)
(PVDF) membranes. For two-dimensional separation by

isoelectric focusing and SDS ⁄ PAGE, SDS was removed
from the samples with the 2D clean-up kit (GE Healthcare
UK Ltd). Proteins (100 lg) were applied to 7 cm Ready-
Strip IPG Strips (Bio-Rad Laboratories), and isoelectric
focusing was performed using a Protean IEF Cell (Bio-Rad
Laboratories). The strips were then subjected to SDS ⁄
PAGE, and proteins on the gel were transferred to PVDF
membranes. For two-dimensional electrophoresis of blue
native PAGE [30] and SDS ⁄ PAGE, slices of cotyledons
were homogenized with 20 strokes of a Dounce homo-
genizer in ice-cold buffer containing 50 mm Bis-Tris (pH
7.2), 50 mm NaCl containing 10% (w ⁄ v) glycerol, 0.001%
ponceau S, and 1% digitonin. After standing at 4 °C for
1 h, the homogenate was centrifuged for 30 min at
14 000 g. Five per cent Coomassie Brilliant Blue G-250
solution was added to the supernatant to a final concentra-
tion of 0.25%, and the supernatant was subjected to
3–12% polyacrylamide gradient gel electrophoresis accord-
ing to the manufacturer’s protocol for the Native PAGE
Novex Bis-Tris Gel System (Invitrogen Corporation, Carls-
bad, CA, USA). Blue native PAGE gels were then sub-
jected to SDS ⁄ PAGE, and proteins on the gel were
transferred to PVDF membranes. Membranes were incu-
bated with primary antibody, followed by a horseradish
peroxidase-conjugated IgG secondary antibody (Promega
Corporation), and were developed using Western Lightning
Chemiluminescence Reagent (Perkin Elmer Life Science) as
previously described [18].
Real-time RT-PCR
Measurement of mRNA was performed as described previ-

ously [18]. Briefly, total RNA was isolated using the
RNeasy Plant Mini kit (Qiagen Inc.). mRNA was quanti-
fied by real-time RT-PCR with a Thermal Cycler Dice Real
Time System (TaKaRa Bio Inc.). Forward primers 5¢-CG
TTTGAAGGGTGAGGAGGAAAA[FAM]G-3¢ and 5¢-CA
CAAGAGAGTTCTGCGATAACCTTG[FAM]G-3¢ (Invi-
trogen Corporation) and reverse primers 5¢-AAGTAGGCA
ACAAAACAACG-3¢ and 5¢-GTTTTCCCGACAATAA-
CATGG-3¢ were used for detecting GmPDIL-3a and
GmPDIL-3b, respectively. Primers for quantification of
actin mRNA were as described previously [18]. Each
value was normalized by dividing it by that for actin
mRNA.
Proteinase K treatment of microsomes
Microsomes were prepared from cotyledons as described
previously [17], and treated with 0.5 mgÆmL
)1
proteinase K
(Sigma-Aldrich Inc.) in the presence or absence of 1% Tri-
ton X-100 for 5 min at 4 °C. Proteins were precipitated
with 10% trichloroacetic acid for 30 min at 4 °C and
analyzed by western blot.
ER fractionation
Slices of cotyledons were homogenized with 20 strokes of a
Dounce homogenizer in ice-cold buffer containing 100 mm
Tris ⁄ HCl (pH 7.8), 10 mm KCl containing 12% (w ⁄ v)
sucrose, and either 5 mm MgCl
2
or 5 mm EDTA. Homo-
genates were centrifuged for 10 min at 1000 g at 4 °C. Next,

600 lL of the supernatant was loaded onto a 12 mL linear
21–56% (w ⁄ w) sucrose gradient prepared in the same buffer.
Samples were centrifuged at 154 400 g for 2 h at 4 °C, and
1 mL fractions were collected and assayed by western blot.
Acknowledgements
We thank Dr M. Kito for critical reading of the man-
uscript and warm encouragement. This work was
supported by a grant from the Program for Promotion
of Basic Research Activities for Innovative Biosciences,
and a Grant-in-Aid for Exploratory Research from the
Ministry of Education, Culture, Sports, Science and
Technology of Japan (18658055).
References
1 Helenius A & Aeb M (2004) Roles of N-linked glycans
in the endoplasmic reticulum. Annu Rev Biochem 73,
1019–1049.
2 Wittrup KD (1995) Disulfide bond formation and
eukaryotic secretory productivity. Curr Opin Biotechnol
6, 203–208.
3 Hogg PJ (2002) Biological regulation through protein
disulfide bond cleavage. Redox Rep 7, 71–77.
4 Freedman RB, Hirst TR & Tuite MF (1994) Protein
disulphide isomerase: building bridges in protein
folding. Trends Biochem Sci 19, 331–336.
5 Creighton TE, Zapun A & Darby NJ (1995) Mecha-
nisms and catalysts of disulfide bond formation in
proteins. Trends Biotechnol 13, 18–23.
K. Iwasaki et al. Novel plant PDI family proteins
FEBS Journal 276 (2009) 4130–4141 ª 2009 The Authors Journal compilation ª 2009 FEBS 4139
6 Gilbert HF (1998) Protein disulfide isomerase. Methods

Enzymol 290, 26–50.
7 Hatahet F & Ruddock LW (2007) Substrate recognition
by the protein disulfide isomerases. FEBS J 274, 5223–
5234.
8 Ellgaard L & Ruddock LW (2005) The human protein
disulphide isomerase family: substrate interactions and
functional properties. EMBO Rep 6, 28–32.
9 Tachibana C & Stevens TH (1992) The yeast EUG1
gene encodes an endoplasmic reticulum protein that is
functionally related to protein disulfide isomerase. Mol
Cell Biol 12, 4601–4611.
10 Nørgaard P & Winther JR (2001) Mutation of yeast
Eug1p CXXS active sites to CXXC results in a dra-
matic increase in protein disulfide isomerase activity.
Biochem J 358, 269–274.
11 van Lith M, Hartigan N, Hatch J & Benham AM
(2005) PDILT, a divergent testis-specific protein disul-
fide isomerase with a non-classical SXXC motif that
engages in disulfide-dependent interactions in the endo-
plasmic reticulum. J Biol Chem 280, 1376–1383.
12 Anelli T, Alessio M, Mezghrani A, Simmen T, Talamo
F, Bachi A & Sitia R (2002) ERp44, a novel endo-
plasmic reticulum folding assistant of the thioredoxin
family. EMBO J 21, 835–844.
13 Houston NL, Fan C, Xiang QY, Schulze JM, Jung R
& Boston RS (2005) Phylogenetic analyses identify 10
classes of the protein disulfide isomerase family in
plants, including single-domain protein disulfide isomer-
ase-related proteins. Plant Physiol 137, 762–778.
14 Goldberg RB, Barker SJ & Perez-Grau L (1989) Regu-

lation of gene expression during plant embryogenesis.
Cell 56, 149–160.
15 Mu
¨
ntz K (1998) Deposition of storage proteins. Plant
Mol Biol 38, 77–99.
16 Kamauchi S, Wadahama H, Iwasaki K, Nakamoto Y,
Nishizawa K, Ishimoto M, Kawada T & Urade R (2008)
Molecular cloning and characterization of two soybean
protein disulfide isomerases as molecular chaperones for
seed storage proteins. FEBS J 275, 2644–2658.
17 Wadahama H, Kamauchi S, Nakamoto Y, Nishizawa
K, Ishimoto M, Kawada T & Urade R (2008) A novel
plant protein disulfide isomerase family homologous to
animal P5 – molecular cloning and characterization as a
functional protein for folding of soybean seed-storage
proteins. FEBS J 275, 399–410.
18 Wadahama H, Kamauchi S, Ishimoto M, Kawada T &
Urade R (2007) Protein disulfide isomerase family pro-
teins involved in soybean protein biogenesis. FEBS J
274, 687–703.
19 Munro S & Pelham HR (1987) A C-terminal signal
prevents secretion of luminal ER proteins. Cell 48,
899–907.
20 Satoh M, Shimada A, Kashiwai A, Saga S &
Hosokawa M (2005) Differential cooperative enzymatic
activities of protein disulfide isomerase family in
protein folding. Cell Stress Chaperones 10, 211–220.
21 Ellgaard L & Frickel EM (2003) Calnexin, calreticulin,
and ERp57: teammates in glycoprotein folding. Cell

Biochem Biophys 39, 223–247.
22 Meunier L, Usherwood YK, Chung KT & Hendershot
LM (2002) A subset of chaperones and folding enzymes
form multiprotein complexes in endoplasmic reticulum
to bind nascent proteins. Mol Biol Cell 13, 4456–4469.
23 Okudo H, Kato H, Arakaki Y & Urade R (2005)
Cooperation of ER-60 and BiP in the oxidative refold-
ing of denatured proteins in vitro. J Biochem (Tokyo)
138
, 773–780.
24 Ceriotti A, Pedrazzini E, Silvestris MD & Vitale A
(1995) Import into the endoplasmic reticulum. Methods
Cell Biol 50, 295–308.
25 Appenzeller-Herzog C & Ellgaard L (2008) The human
PDI family: versatility packed into a single fold. Bio-
chim Biophys Acta 1783, 535–548.
26 Martı
`
nez IM & Chrispeels MJ (2003) Genomic analysis
of the unfolded protein response in Arabidopsis shows
its connection to important cellular processes. Plant Cell
15, 561–576.
27 Kamauchi S, Nakatani H, Nakano C & Urade R
(2005) Gene expression in response to endoplasmic
reticulum stress in Arabidopsis thaliana. FEBS J 272,
3461–3476.
28 Urade R (2007) Cellular response to unfolded proteins
in the endoplasmic reticulum of plants. FEBS J 274,
1152–1171.
29 Maattanen P, Kozlov G, Gehring K & Thomas DY

(2006) ERp57 and PDI: multifunctional protein disul-
fide isomerases with similar domain architectures but
differing substrate–partner associations. Biochem Cell
Biol 84, 881–889.
30 Scha
¨
gger H & von Jagow G (1991) Blue native electro-
phoresis for isolation of membrane protein complexes in
enzymatically active form. Anal Biochem 199, 223–231.
31 Walker KW, Lyles MM & Gilbert HF (1996) Catalysis
of oxidative protein folding by mutants of protein disul-
fide isomerase with a single active-site cysteine. Bio-
chemistry 35, 1972–1980.
32 Laboissiere MC, Sturley SL & Raines RT (1995) The
essential function of protein-disulfide isomerase is to
unscramble non-native disulfide bonds. J Biol Chem
270, 28006–28009.
33 Lappi AK, Lensink MF, Alanen HI, Salo KE, Lobell
M, Juffer AH & Ruddock LW (2004) A conserved argi-
nine plays a role in the catalytic cycle of the protein
disulphide isomerases. J Mol Biol 335, 283–295.
34 van Lith M, Karala A-R, Bown D, Gatehouse JA,
Ruddock LW, Saunders PTK & Benham AM (2007) A
developmentally regulated chaperone complex for the
endoplasmic reticulum of male haploid germ cells. Mol
Biol Cell 18, 2795–2804.
Novel plant PDI family proteins K. Iwasaki et al.
4140 FEBS Journal 276 (2009) 4130–4141 ª 2009 The Authors Journal compilation ª 2009 FEBS
35 Anelli T, Ceppi S, Bergamelli L, Cortini M, Masciarelli
S, Valetti C & Sitia R (2007) Sequential steps and

checkpoints in the early exocytic compartment during
secretory IgM biogenesis. EMBO J 26, 4177–4188.
36 Wang ZV, Schraw TD, Kim JY, Khan T, Rajala MW,
Follenzi A & Scherer PE (2007) Secretion of the adipo-
cyte-specific secretory protein adiponectin critically
depends on thiol-mediated protein retention. Mol Cell
Biol 27, 3716–3731.
37 Mariappan M, Radhakrishnan K, Dierks T, Schmidt B
& von Figura K (2008) ERp44 mediates a thiol-indepen-
dent retention of formylglycine-generating enzyme in the
endoplasmic reticulum. J Biol Chem 283, 6375–6383.
38 Anelli T, Alessio M, Bachi A, Bergamelli L, Bertoli A,
Camerini S, Mezghrani A, Ruffato E, Simmen T &
Sitia R (2003) Thiol-mediated protein retention in the
endoplasmic reticulum: the role of ERp44. EMBO J 22,
5015–5022.
39 Otsu M, Bertoli G, Fagioli C, Guerini-Rocco E,
Nerini-Molteni S, Ruffato E & Sitia R (2006) Dynamic
retention of Ero1a and Ero1b in the endoplasmic
reticulum by interactions with PDI and ERp44.
Antioxid Redox Signal 8, 274–282.
40 Pace CN, Vajdos F, Fee L, Grimsley G & Gray T
(1995) How to measure and predict the molar absorp-
tion coefficient of a protein. Protein Sci 4, 2411–2423.
41 Creighton TE (1977) Kinetics of refolding of reduced
ribonuclease. J Mol Biol 113, 329–341.
42 Lyles MM & Gilbert HF (1991) Catalysis of the
oxidative folding of ribonuclease A by protein disulfide
isomerase: dependence of the rate on the composition
of the redox buffer. Biochemistry 30, 613–619.

43 Morjana NA & Gilbert HF (1991) Effect of protein and
peptide inhibitors on the activity of protein disulfide-
isomerase. Biochemistry 30, 4985–4990.
44 Alanen HI, Salo KE, Pirneskoski A & Ruddock LW
(2006) pH dependence of the peptide thiol-disulfide oxi-
dase activity of six members of the human protein disul-
fide isomerase family. Antioxid Redox Signal 8, 283–291.
45 Kikuchi M, Doi E, Tsujimoto I, Horibe T & Tsujimoto
Y (2002) Functional analysis of human P5, a protein
disulfide isomerase homologue. J Biochem 132,
451–455.
46 Laemmli UK (1970) Cleavage of structural proteins
during the assembly of the head of bacteriophage T4.
Nature 227, 680–685.
Supporting information
The following supplementary material is available:
Fig. S1. Comparison of intron–exon structures of
GmPDIL-3a, GmPDIL-3b and orthologs of other
plants.
Fig. S2. Multiple amino acid sequence alignment of
GmPDIL-3a, GmPDIL-3b and orthologs of other
plants.
Fig. S3. Expression and CD analysis of recombinant
GmPDIL-3a and GmPDIL-3b.
Table S1. List of primers for ATG-mutagenesis of
GmPDIL-3a and GmPDIL-3b.
This supplementary material can be found in the
online version of this article.
Please note: As a service to our authors and readers,
this journal provides supporting information supplied

by the authors. Such materials are peer-reviewed and
may be re-organized for online delivery, but are not
copy-edited or typeset. Technical support issues arising
from supporting information (other than missing files)
should be addressed to the authors.
K. Iwasaki et al. Novel plant PDI family proteins
FEBS Journal 276 (2009) 4130–4141 ª 2009 The Authors Journal compilation ª 2009 FEBS 4141