Tài liệu Báo cáo khoa học: Modeling of tRNA-assisted mechanism of Arg activation based on a structure of Arg-tRNA synthetase, tRNA, and an ATP analog (ANP) ppt

Modeling of tRNA-assisted mechanism of Arg activation
based on a structure of Arg-tRNA synthetase, tRNA, and
an ATP analog (ANP)
Michiko Konno
1
, Tomomi Sumida
1,
*, Emiko Uchikawa
1
, Yukie Mori
1
, Tatsuo Yanagisawa
2,
*,
Shun-ichi Sekine
2
and Shigeuki Yokoyama
2
1 Department of Chemistry and Biochemistry, Graduate School of Humanities and Sciences, Ochanomizu University, Tokyo, Japan
2 Department of Biophysics and Biochemistry, Graduate School of Science, University of Tokyo, Japan
Introduction
Most aminoacyl-tRNA synthetases (aaRSs) catalyze the
formation of aminoacyl-AMP in the presence of
Mg
2+
[amino acid + ATP fi aminoacyl-AMP +
pyrophosphate (PP
i
)] and the reverse reaction (amino-
acyl-AMP + PP
i

fi amino acid + ATP). Thus, the
amino acid is converted into the reactive intermediate,
Keywords
aminoacyl-AMP formation; Arg-tRNA
synthetase; deacylation reaction;
pyrophosphorolysis; tRNA
Correspondence
M. Konno, Department of Chemistry and
Biochemistry, Graduate School of
Humanities and Sciences, Ochanomizu
University, 2-1-1 Otsuka, Bunkyo-Ku, Tokyo
112-8610, Japan
Fax: +81 359785717
Tel: +81 359875718
E-mail:
*Present address
RIKEN Systems and Structural Biology
Center, 1-7-22 Suehiro-cho, Tsurumi,
Yokohama 230-0045, Japan
Database
The atomic coordinates and the structure
factors have been deposited in the Protein
Data Bank (ID 2ZUE for the ternary complex
of ArgRS, tRNA
Arg
CCU
and ANP, and ID
2ZUF for the binary complex of ArgRS and
tRNA
Arg

CCU
)
(Received 18 March 2009, revisied 11 June
2009, accepted 26 June 2009)
doi:10.1111/j.1742-4658.2009.07178.x
The ATP–pyrophosphate exchange reaction catalyzed by Arg-tRNA, Gln-
tRNA and Glu-tRNA synthetases requires the assistance of the cognate
tRNA. tRNA also assists Arg-tRNA synthetase in catalyzing the pyro-
phosphorolysis of synthetic Arg-AMP at low pH. The mechanism by which
the 3¢-end A76, and in particular its hydroxyl group, of the cognate tRNA
is involved with the exchange reaction catalyzed by those enzymes has yet
to be established. We determined a crystal structure of a complex of Arg-
tRNA synthetase from Pyrococcus horikoshii, tRNA
Arg
CCU
and an ATP
analog with R
factor
= 0.213 ( R
free
= 0.253) at 2.0 A
˚
resolution. On the
basis of newly obtained structural information about the position of ATP
bound on the enzyme, we constructed a structural model for a mechanism
in which the formation of a hydrogen bond between the 2¢-OH group of
A76 of tRNA and the carboxyl group of Arg induces both formation of
Arg-AMP (Arg + ATP fi Arg-AMP + pyrophosphate) and pyrophos-
phorolysis of Arg-AMP (Arg-AMP + pyrophosphate fi Arg + ATP) at
low pH. Furthermore, we obtained a structural model of the molecular

mechanism for the Arg-tRNA synthetase-catalyzed deacylation of Arg-
tRNA (Arg-tRNA + AMP fi Arg-AMP + tRNA at high pH), in which
the deacylation of aminoacyl-tRNA bound on Arg-tRNA synthetase and
Glu-tRNA synthetase is catalyzed by a quite similar mechanism, whereby
the proton-donating group (–NH–C
+
(NH
2
)
2
or –COOH) of Arg and Glu
assists the aminoacyl transfer from the 2¢-OH group of tRNA to the phos-
phate group of AMP at high pH.
Abbreviations
aaRS, aminoacyl-tRNA synthetase; ANP, adenosine-5¢-(b,c-imido)triphosphate; ArgRS, Arg-tRNA synthetase; D, dihydrouridine; GlnRS,
Gln-tRNA synthetase; GluRS, Glu-tRNA synthetase; PP
i
, pyrophosphate.
FEBS Journal 276 (2009) 4763–4779 ª 2009 The Authors Journal compilation ª 2009 FEBS 4763
i.e. aminoacyl-AMP, and then the aminoacyl-AMP
bound on the aaRS may react with the hydroxyl group
of the ribose at the 3¢-end CCA of tRNA to form ami-
noacyl-tRNA. In the aminoacylation reaction of class I
aaRSs with aminoacyl-AMP, the 2¢-OH group of the
ribose of A76 tRNA attacks the carbonyl carbon atom
of the –Ca–(CO)–O– moiety of aminoacyl-AMP. As lit-
tle detailed structural information on the ATP-binding
site of class Ia and class Ib aaRSs has been reported,
clear molecular-scientific understanding of the activated
complex formed between the amino acid and ATP in the

reaction path of aminoacyl-AMP formation on the
aaRSs has not been attained yet.
In particular, the following detailed biochemical
findings on the formation of aminoacyl-AMP and clo-
sely related reactions have been reported for
Arg-tRNA synthetase (ArgRS; EC 6.1.1.19) [1–6]. No
success of consistent understanding has been achieved
for the molecular reaction paths of aminoacyl-AMP
formation and closely related reactions catalyzed by
ArgRS. New models of the reaction paths involved in
the formation of aminoacyl-AMP and closely related
reactions observed for ArgRS will lead to improved
understanding of the activated complex formed
between the amino acid and ATP in the reaction path
of aminoacyl-AMP formation on most aaRSs as well
as ArgRS.
For most aaRSs, the formation of aminoacyl-AMP
does not require tRNA. On the other hand, for ArgRS
from Escherichia coli, Bacillus stearothermophilus, Neu-
rospora crassa, and Saccharomyces cerevisiae [1–5],
Gln-tRNA synthetase (GlnRS) from E. coli W,
S. cerevisiae and porcine liver [7,8] and Glu-tRNA syn-
thetase (GluRS) from E. coli K12 [9,10], the ATP–PP
i
exchange reaction corresponding to the formation of
aminoacyl-AMP and its reverse reaction, amino
acid + ATP = aminoacyl-AMP + PP
i
, has never
been observed without tRNA. In the presence of cog-

nate tRNA, the ATP–PP
i
exchange reaction was
observed for ArgRS, GlnRS, and GluRS.
The cognate tRNA is also necessary for the ArgRS-
catalyzed pyrophosphorolysis of chemically synthesized
Arg-AMP in the presence of PP
i
and Mg
2+
[6]. It has
also been reported that the in vitro ArgRS-catalyzed
deacylation reaction of Arg-tRNA follows good first-
order kinetics in solution at pH 6 containing excess
amount of AMP, PP
i
, and Mg
2+
, whereas in the
absence of PP
i
, the amount of Arg-tRNA decreases to
43% and then remains constant [11].
The detailed mechanism through which the 2¢-OH
group of the ribose of the 3 ¢-end A76 of the cognate
tRNA accelerates the ATP–PP
i
exchange reaction in
the case of ArgRS remained unknown. In order to
gain a clear molecular-scientific understanding of this

mechanism and to clarify the orientation of the dihy-
drouridine (D) loop containing A20 of tRNA
Arg
inter-
acting with ArgRS, we determined crystal structures of
a binary complex of Pyrococcus horikoshii ArgRS and
tRNA
Arg
CCU
and a ternary complex also containing
the ATP analog adenosine-5¢-(b,c-imido)triphosphate
(ANP); we found one reasonable mechanism, based on
newly obtained structural information about the posi-
tion of ATP bound on ArgRS. In order to understand
the function of the N-terminal domain of ArgRS in
relation to the binding mechanism of tRNA
Arg
,we
constructed an ArgRS mutant lacking the N-terminal
domain (DN ArgRS). The experimental results showed
that the DN ArgRS protein retains sufficient catalytic
activity in the aminoacylation reaction for
tRNA
Arg
CCU
. Moreover, modeling of the relative posi-
tions of Arg, A76 of tRNA
Arg
and ATP on ArgRS
was undertaken to find the suitable position for the

tRNA-assisted mechanism of Arg-AMP formation. We
found that the formation of the hydrogen bond
between the 2¢-OH group of A76 of tRNA and O2 of
the carboxyl group induces the ATP–PP
i
exchange
reaction and the pyrophosphorolysis reaction of syn-
thetic Arg-AMP at low pH.
Results
Comparison of P. horikoshii ArgRS with those of
Thermus thermophilus and S. cerevisiae
The structures of the ternary complex (P. horikoshii
ArgRS, tRNA
Arg
CCU
, and the ATP analog ANP) and
the binary complex (P. horikoshii ArgRS and
tRNA
Arg
CCU
) were obtained with R
factor
= 0.213
(R
free
= 0.253) at 2.0 A
˚
resolution, and R
factor
= 0.201

(R
free
= 0.262) at 2.3 A
˚
, respectively. In the crystals
grown in the presence of l-Arg, l-Arg was not visible in
the electron density map. The overall structure of a ter-
nary complex of P. horikoshii ArgRS, tRNA
Arg
CCU
and
the ATP analog is shown in Fig. 1, and sequence align-
ments for ArgRSs from P. horikoshii , T. thermophilus
and S. cerevisiae on the basis on three-dimensional
structures are given in Fig. 2.
Structures of S. cerevisiae ArgRS-bound arginine
and tRNA
Arg
ICG
[12] (Protein Data Bank ID: 1F7V)
and ‘tRNA-free’ T. thermophilus ArgRS [13] (Protein
Data Bank ID: 1IQ0), the Rossmann fold and the
anticodon-binding domains of which were superim-
posed onto those of P. horikoshii ArgRS, are shown in
Fig. 3A,B. It has been reported that, in S. cerevisiae
ArgRS, the Asn fi Ala mutation of Asn153, corre-
sponding to Asn129 in P. horikoshii ArgRS (Fig. 2),
Modeling of tRNA-assisted mechanism on ArgRS M. Konno et al.
4764 FEBS Journal 276 (2009) 4763–4779 ª 2009 The Authors Journal compilation ª 2009 FEBS
gives a drastically decreased k

cat
value of 0.01 s
)1
in
the aminoacylation reaction in comparison with the
k
cat
value of 8 s
)1
for the wild-type ArgRS [14]. In
S. cerevisiae ArgRS bound to Arg and tRNA, the
a-NH
2
group of Arg is in close proximity to the car-
bamoyl group of Asn153 in the loop between S5 and
the signature sequence motif ‘HIGH’. In the three
ArgRSs, an Asn with the same conformation was
observed. The large difference found in the catalytic
domain between P. horikoshii ArgRS and S. cerevisiae
ArgRS concerns the relative orientations of the con-
nective polypeptide domain and the inserted domain 1
to the Rossmann fold domain (Fig. 3A). In S. cerevisi-
ae ArgRS, superimposition of ‘tRNA-free’ S. cerevisiae
ArgRS on ‘tRNA-bound’ S. cerevisiae ArgRS reveals
large movements of these domains [12].
Binding site of adenosine of ATP
In Met-tRNA, Ile-tRNA, Val-tRNA and Leu-tRNA
synthetases [15–18] belonging to class Ia, crystal struc-
tures of complexes of aminoacyl-AMP analog bound
mainly through the hydrophobic interaction of the

aminoacyl moiety have been observed, whereas no
ATP-bound protein of class Ia has been observed. In
P. horikoshii ArgRS, the ATP analog (ANP) molecule
was clearly found in the active site (Fig. 4). The obser-
vation of the ANP-bound protein is due to the high
hydrophobicity of ArgRS from the archaebacterium
P. horikoshii living at very high temperature and the
existence of the His417 residue. The adenine base of
ANP with small values of average B-factor is stacked
upon the aromatic ring of His417, which is specific to
P. horikoshii ArgRS. The adenine base is in close prox-
imity to the main chain of Val418 in the S16 strand,
the N1–Val418 N and N6–Val418 O distances being
3.19 A
˚
and 3.47 A
˚
, respectively, and the 2¢-OH of the
ribose is in close proximity to N of Gly384 and O
e1
of
Glu386 in the S14–H14 turn (Gly384–Ala385–Glu386–
Gln387 turn), the distances being 2.71 A
˚
and 2.77 A
˚
,
respectively. The distance between Ca of Glu386, the
third residue in the S14–H14 turn, and Ca of Val418
in the S16 strand is 12.8 A

˚
, and the adenosine moiety
is fitted into this hydrophobic groove. The Ala372–
Ser373–Gln374–Gln375 turn in S. cerevisiae ArgRS
and the Asp354–Val355–Arg356–Gln357 turn in
T. thermophilus ArgRS have very similar backbone
forms to that of the S14–H14 turn in P. horikoshii
ArgRS.
In aaRSs belonging to class I, the turn correspond-
ing to the S14–H14 turn is almost conserved, as
Gly ⁄ Ala-Xaa-Asp ⁄ Glu-Xaa (Xaa stands for any amino
acid) and NH and C@O of the main chain of the resi-
due corresponding to Val418 in the S16 strand are
directed inside. In free E. coli Met-tRNA synthetase
(Protein Data Bank ID: 1QQT) [19], the distance
between Ca of the third residue, Asp296, in the S14–
H14 turn and Ca of Val326 in the S16 strand is
12.7 A
˚
, in free T. thermophilus Ile-tRNA synthetase
(Protein Data Bank ID: 1ILE) [20], the distance
between the Ca atoms of the corresponding Asp553
and Ile584 is 13.4 A
˚
, in free P. horikoshii Leu-tRNA
synthetase (Protein Data Bank ID: 1WKB) [21], the
distance between Asp612 and Gly644 is 12.5 A
˚
, and in
free T. thermophilus Val-tRNA synthetase (Protein

Data Bank ID: 1IYW) [22], the distance between
Asp490 and Val521 is 11.9 A
˚
. These distances within
0.9 A
˚
of the distance of 12.8 A
˚
in ArgRS indicate that,
in these aaRSs, this space is the binding site of the
adenosine moiety of ATP, and in E. coli Cys-tRNA
synthetase bound to tRNA
Cys
(Protein Data Bank ID:
1U0B) [23], the distance between Asp229 and Val260
is 11.4 A
˚
. AMP weakly inhibits the binding of ATP in
a competitive manner in the aminoacylation reaction
[24].
The position of the Mg
2+
located between PbO
(2.45 A
˚
and 3.01 A
˚
) and PaO (2.97 A
˚
) of ANP is not

catalytic
domain
'Stem contact
fold' domain
Anticodon-binding domain
N-terminal
domain
ANP
Fig. 1. Overview of the structure of P. horikoshii ArgRS complexed
with tRNA
Arg
CCU
and ATP analog (ANP). P. horikoshii ArgRS con-
tains the N-terminal domain (residues 2–118; yellow), the catalytic
domain [the Rossmann fold domain (residues 119–169, 238–269,
331–345, and 378–417; orange], the inserted domain 1 (residues
170–237; cyan), the connective polypeptide domain (residues 270–
330; blue), the inserted domain 2 (residues 346–377; green), the
‘stem contact fold’ domain (residues 418–503; red), and the antico-
don-binding domain (residues 504–629; magenta). The tRNA back-
bone is drawn with its phosphate chain traced as a thick green line,
and ANP is shown in ball-and-stick representation.
M. Konno et al. Modeling of tRNA-assisted mechanism on ArgRS
FEBS Journal 276 (2009) 4763–4779 ª 2009 The Authors Journal compilation ª 2009 FEBS 4765
within 3.5 A
˚
of protein residues. The observed electron
density for the Mg
2+
in this conformation is about

half of the electron density expected for an occupancy
of 1.0 for Mg
2+
. The presence of different orientations
for the PbNPc moiety of ANP attached and not
attached to Mg
2+
is manifested as low electron densi-
ties in the regions of Mg
2+
and the PbNPc moiety.
The salt bridge formed by Mg
2+
between PbO and
PaO may retard the conformational inversion at Pa of
ATP in the reversible process of the ATP–PP
i
exchange reaction, whereas the salt bridge formed by
Mg
2+
between PbO and PcO does not, by any means,
retard the conformational inversion at Pa of ATP.
The reported aminoacyl-AMP analogs have sulfa-
moyl (–NH–SO
2
–O–) or diaminosulfone (–NH–SO
2
–
NH–) in place of Pa [–O–PO(OH)–O–] of AMP.
Furthermore, the reported aminoacyl-AMP analogs

are bound mainly through the interaction of the ami-
noacyl moiety with the aminoacyl-tRNA synthetase.
Therefore, the location of the adenosine moiety of the
reported aminoacyl-AMP analogs may be somewhat
perturbed by the strong binding of the aminoacyl
moiety on the aminoacyl-tRNA synthetase. The con-
formation of the sulfamoyl or diaminosulfone of the
reported aminoacyl-AMP analogs may be also some-
what perturbed by the strong binding of the aminoacyl
moiety. For instance, the torsional angles of C3¢–C4¢–
C5¢–O5¢⁄N¢ around the C4¢–C5¢ bond in ribose moie-
ties of Ile-AMP analog [N-(isoleucinyl)-N¢-(adenosyl)-
diaminosufone] (Protein Data Bank ID: 1JZQ) and
Val-AMP analog [N-(valinyl)-N¢-(adenosyl)-diamino-
sufone] (Protein Data Bank ID: 1GAX) are 52° and
)169°, respectively.
In contrast, the newly found location of the adeno-
sine moiety of the ATP analog (ANP) is considered to
be free from any perturbation. The conformation of
Pa [–O–PO(OH)–O–] of ANP is also considered to be
substantially free from any perturbation. Thus, the
conformation of Pa [–O–PO(OH)–O–] of ANP is very
suitable for use in constructing the model of the
tRNA
Arg
-assisted ATP–PP
i
exchange reaction.
The N of the side chain of Lys132, located three res-
idues upstream from the signature sequence motif

‘HIGH’, is close to PaO, PbO and PcO of ANP, with
Fig. 2. Sequence alignment of P. horikoshii ArgRS (PhRRS), T. thermophilus ArgRS (TtRRS) and S. cerevisiae ArgRS (ScRRS) on the basis
of three-dimensional structures. The residues exposed on the surface of a-helices (colored in red) and b-strands (colored in blue) are aligned
among the three ArgRSs. The Asn corresponding to Asn153 (ScRRS) is indicated by a green letter.
Modeling of tRNA-assisted mechanism on ArgRS M. Konno et al.
4766 FEBS Journal 276 (2009) 4763–4779 ª 2009 The Authors Journal compilation ª 2009 FEBS
distances of 2.67 A
˚
, 2.81 A
˚
, and 2.91 A
˚
, respectively.
The fact that in P. horikoshii ArgRS, where the
‘KMSK’ motif is replaced by Lys424-Phe425-Ser426-
Gly427, the first Lys424 of the current structure under-
goes no interaction with the PbNPc moiety of ANP
proves that, in P. horikoshii ArgRS, the ‘KFSG’ por-
tion does not contribute to the ATP–PP
i
exchange
reaction.
The 3¢-terminus of tRNA
In the 3¢-terminal G73–C74–C75–A76 sequence of
tRNA
Arg
CCU
, two transient forms were observed in
the ternary complex (Fig. 5A) as well in the binary
complex, depending on crystallization conditions; in

the first stage, the base of G73 is stacked upon a
G1ÆC72 base pair, and the conformation of the phos-
phodiester bridge of C5¢–O–P–O–C3¢ between C72 and
G73 is normal. This unusual structure was first
observed by NMR analysis in the tRNA
Ala
acceptor
end microhelix [25]. The C74–C75–A76 sequence is
invisible in the electron density map, which indicates
clearly that increased conformational flexibility around
G73 is provided in the first stage. In another confor-
mation of the 3¢-terminal end of tRNA
Arg
CCU
in the
second stage, the base of G73 is not stacked upon a
G1ÆC72 base pair, and the conformation of the phos-
phodiester bridge of C5¢–O–P–O–C3¢ between C72–
G73 and G73–C74 is not of the normal helix type.
This local conformation of C72–G73–C74 of the
second stage is quite similar to the final stage confor-
mation observed for tRNA
Arg
ICG
bound to S. cerevisiae
ArgRS in the tertiary complex [12]. The ribose of G73
and the bases of C75–A76 are invisible in the electron
density map. Therefore, this newly observed transient
form is the intermediate form, through which the con-
formation of the 3¢-terminal end changes from the first

stage to the final stage. The base of C74 is found near
the surface of the connective polypeptide domain,
which is a transient position, i.e. the hydrophobic cleft
constructed by the side chains of Tyr300, Ala303,
Val321, Arg324 and Ser325 in the connective polypep-
tide domain. The relative orientation of G73 and C74
to the connective polypeptide domain is similar to that
N-terminal
domain
Anticodon-binding domain
'Stem contact fold'
domain
Catalytic
domain
Inserted domain 1
Connective polypeptide domain
Rossmann fold domain
A
B
N-terminal
domain
Anticodon-binding domain
'Stem contact fold'
domain
Catalytic
domain
Inserted domain 1
Connective polypeptide domain
Rossmann fold domain
Fig. 3. (A) Comparison between two overall structures of P. horiko-

shii ArgRS and S. cerevisiae ArgRS (white) bound to tRNA
Arg
ICG
and arginine. The backbones of P. horikoshii tRNA and S. cerevisiae
tRNA are drawn with the phosphate chain traced as a thick green
line and a thick blue line, respectively. (B) Comparison between
two overall structures of P. horikoshii ArgRS and ‘tRNA-free’
T. thermophilus ArgRS (white).
V418
V418
H417 H417
Y415
Y415
E386
E386
G384
G384
H135
H138
K132
S127
N129
H138
H135
K132
N129
S127
Q837
Q837
Fig. 4. A final (2F

obs
) F
calc
) cross-validated
r
A
-weighted omit map contoured at level
1.5r. The map was produced using the
complex model without ANP and all the
data from 40 A
˚
to 2.0 A
˚
resolution. A green
sphere shows the Mg
2+
.
M. Konno et al. Modeling of tRNA-assisted mechanism on ArgRS
FEBS Journal 276 (2009) 4763–4779 ª 2009 The Authors Journal compilation ª 2009 FEBS 4767
observed in tRNA
Arg
ICG
bound to S. cerevisiae
ArgRS in the tertiary complex. It is predicted that
the conformational change from the first stage to the
final stage takes place in the absence of Arg, and the
hydrophobic circumstance changes the hydration state
around the phosphodiester bridges in C72–G73–C74–
C75–A76. In T. thermophilus Val-tRNA synthetase
bound to tRNA

Val
(Protein Data Bank ID: 1GAX)
[17] and T. thermophilus Leu-tRNA synthetase bound
to tRNA
Leu
(Protein Data Bank ID: 2BYT) [26],
tRNA is left in the first stage, where the base of A73
is stacked on a G1ÆC72 base pair. Moreover, in Aqui-
fex aeolicus Met-tRNA synthetase bound to tRNA
Met
(Protein Data Bank ID: 2CSX) [27], the base of A73
is still stacked on a G1ÆC72 base pair; that is, the
change of the conformation of the 3¢-terminal end of
tRNA
Met
does not progress. On the other hand, in
E. coli Cys-tRNA synthetase bound to tRNA
Cys
(Protein Data Bank ID: 1U0B) [23], the structure
such that the base of U73 is no longer stacked on a
G1ÆC72 base pair allows the 3¢-terminal CCA end to
enter into the active site.
The D-loop of tRNA
Arg
Among all tRNA species specific to each of the 20
amino acids, only tRNA
Arg
isoacceptors have A at posi-
tion 20 on the D-loop, with the exception that four
tRNA

Arg
isoacceptors from S. cerevisiae have D or C.
Detailed experiments with E. coli and T. thermophilus
ArgRSs apparently suggested that the interaction with
the middle base of the anticodon (C35) and A20 of
tRNA
Arg
play an important role in tRNA
Arg
binding on
ArgRS [13,28,29]. Crystal structures of binary and
ternary complexes of ArgRS and tRNA
Arg
ICG
from
S. cerevisiae and Arg revealed that a base of D20 in the
D-loop, which is specific to S. cerevisiae tRNA
Arg
ICG
,is
positioned in close proximity to the side chains of
Asn106, Phe109, and Gln111, which are included in
the characteristic N-terminal domain of ArgRS [12].
A
C
B
Fig. 5. The structure of tRNA
Arg
CCU
on P. horikoshii ArgRS. (A) Two transient forms in the 3¢-terminal end of P. horikoshii tRNA

Arg
CCU
. In the
first stage (left side), the base of G73 is stacked upon a G1ÆC72 base pair, and C74–C75–A76 is invisible in the electron density map. In
another conformation (right side), the base of G73 is not stacked, and the conformation of C72–G73–C74 is similar to that of the final stage
of tRNA
Arg
ICU
bound to S. cerevisiae ArgRS. (B) Packing arrangement of the bases of G19, A20 and C20
a
of the D-loop of tRNA (green), and
the side chains of Pro44, Phe47, Pro34, Leu38, Val82, Tyr85 and Asn87 in the N-terminal domain. (C) Packing arrangement of the bases of
the anticodon loop (C32–U33–C34–C35–U36–A37–A38) of tRNA
Arg
CCU
(green) and the anticodon-binding domain.
Modeling of tRNA-assisted mechanism on ArgRS M. Konno et al.
4768 FEBS Journal 276 (2009) 4763–4779 ª 2009 The Authors Journal compilation ª 2009 FEBS
However, it was reported that, in the aminoacylation
reaction, the k
cat
and K
m
values for tRNA
Arg
ICG
and
tRNA
Arg
UCU

on the Asn106 fi Ala, Phe109 fi Ala
and Gln111 fi Ala mutant proteins of S. cerevisiae
ArgRS are the same as those on the wild-type ArgRS
[14]. This shows that the interaction between the N-ter-
minal domain of S. cerevisiae ArgRS and D20 of the
D-loop of tRNA
Arg
are not important for the binding
of tRNA
Arg
on ArgRS in the aminoacylation reaction.
The crystal structure of free ArgRS from T. thermophi-
lus has been determined, but that of the complex with
tRNA
Arg
has not been determined yet [13]. In T. ther-
mophilus ArgRS, the Tyr77 fi Ala and Asn79 fi Ala
mutants (Tyr77 and Asn79 correspond to Phe109 and
Gln111 of S. cerevisiae ArgRS, on the basis of struc-
tural comparison between S. cerevisiae ArgRS and
T. thermophilus ArgRS) showed a notable increase in
K
m
for tRNA
Arg
and a large decrease in V
max
in the am-
inoacylation reaction at pH 7.5. On the other hand, it is
very noticeable that the Asn79 fi Lys mutant, which

is expected to be unable to form a hydrogen bond, has
the same K
m
value for tRNA
Arg
as that of the wild type
and does not affect the affinity of tRNA
Arg
.
The additional N-terminal domain characteristic
for ArgRS contains the core structure consisting of
the b-sheet of four antiparallel b-strands and three
helices on the N-terminal side and a long H4 helix
and a loop continuing to the catalytic domain
(Fig. 1). The core structure interacts weakly with the
anticodon-binding domain. The hydrophobic interac-
tions between the N-terminal domain and the bases
of G19 and A20 in the complex of P. horikoshii
ArgRS are shown in Fig. 5B. The bases of G18 and
G19 of the D-loop form hydrogen bonds with the
bases of U55 and C56 of the T-loop, respectively.
The base of G19 interacts with the hydrophobic side
chains of Pro44 and Phe47 in the N-terminal
domain. The bases of A20 and C20
a
(extra nucleo-
tide inserted between nucleotides 20 and 21) of the
D-loop are splayed out. The base of A20 is packed
into the hydrophobic space surrounded by the side
chains of Val82 and Tyr85 in the turn (Val82-Asn83-

Gly84-Tyr85) between the S3 and S4 strands and the
hydrophobic side chains of Pro34 and Leu38. N1
and N6 of the base of A20 lie close to N
d2
and O
d1
of the side chain of Asn87 in the S4 strand, with
distances of 2.82 A
˚
and 2.97 A
˚
, respectively. The
plane of the base of A20 and the end plane of the
carbamoyl group of Asn87 are out of coplanar ori-
entation, and the dihedral angle between these two
planes was about 25°. In particular, O
d1
of the car-
bamoyl group of Asn87 is positioned far out of the
base plane. Large values of average B-factor of resi-
dues in the N-terminal domain (average B-factors of
residues 2–118 in the N-terminal domain and resi-
dues 119–629 in other domains are 49.9 A
˚
2
and
29.5 A
˚
2
, respectively) indicate that the D-loop does

not have stable contact with the N-terminal domain.
The relative orientation of the core structure of the
N-terminal domain to the Rossmann fold domain and
the anticodon-binding domain is substantially different
among P. horikoshii ArgRS, S. cerevisiae ArgRS, and
T. thermophilus ArgRS (Fig. 3A,B). In S. cerevisiae
ArgRS, the base of D20 is surrounded by hydrophobic
side chains of Phe109 in the turn (Asn106-Gly107-
Pro108-Phe109) and Val70. O4 and N3 of D20 interact
with N
e2
of Gln111 and O
d1
of Asn106, with distances
of 2.75 A
˚
and 2.74 A
˚
, respectively [12]. The solution at
pH 7.5 of crystallization drops from which crystals of
the ternary complex of S. cerevisiae ArgRS, Arg and
tRNA
Arg
ICG
grow contains tRNA, l-Arg, ATP and
Mg
2+
at sufficient concentrations for the aminoacyla-
tion reaction, and (NH
4

)
2
SO
4
and 1,6-hexanediol are
used as precipitating agents [30]. This fact indicates
that, even though all of the substrates required for the
aminoacylation reaction are present at sufficient con-
centration in the crystallization solution, the aminoacy-
lation reaction does not occur during the long time
needed for crystal growth, which suggests that tRNA-
bound S. cerevisiae ArgRS observed in the ternary
complex is by no means in a conformation that is fit
to activate. The fact that k
cat
and K
m
for tRNA
Arg
in
the aminoacylation reaction do not change in the
Asn106 fi Ala, Gln111 fi Ala and Phe109 fi Ala
mutants of S. cerevisiae ArgRS [14] indicates that
those mutations have no influence on the orientation
of tRNA
Arg
in wild-type ArgRS.
When the Rossmann fold domain and the anticodon-
binding domain in P. horikoshii ArgRS were superim-
posed onto those of S. cerevisiae ArgRS, the C1s of A20

and C72 in P. horikoshii tRNA
Arg
were not within
4.0 A
˚
of those of D20 and A72 in S. cerevisiae
tRNA
Arg
, respectively. The main chains of the phospho-
diester bridge of C5¢–O5–P–O3–C3¢ of G18–G19–A20–
C20
a
in the D-loop in P. horikoshii tRNA
Arg
have no
common conformation with those of G18–G19–D20–
C20
a
in S. cerevisiae tRNA
Arg
ICG
.
Distances between C1¢ of C72 of the 1Æ72 pair in the
acceptor stem, C1¢ of G18 forming a hydrogen bond
to U55 of the T-loop and C1¢ of C31 or G39 of 31Æ39
of the anticodon stem of tRNA were compared to con-
firm the similarity of the three-dimensional structures
of tRNAs. The C72 C1¢–G18 C1¢, C72 C1¢–C31 C1¢,
C72 C1¢–G39 C1¢ and G18 C1¢–G39 C1¢ distances,
except for G18 C1¢–C31 C1¢ in P. horikoshii

tRNA
Arg
CCU
, are within 1.3 A
˚
of the corresponding
M. Konno et al. Modeling of tRNA-assisted mechanism on ArgRS
FEBS Journal 276 (2009) 4763–4779 ª 2009 The Authors Journal compilation ª 2009 FEBS 4769
distances in S. cerevisiae tRNA
Arg
ICG
. These facts indi-
cate that the framework of tRNA
Arg
of the L-shape is
conserved in these two cases.
The anticodon loop of tRNA
In the complex of P. horikoshii ArgRS, the base of
C35 of tRNA
Arg
CCU
is located in the hydrophobic
pocket formed by the aromatic ring of Tyr587 at the
C-terminal end of H23 and the hydrophobic side
chains of Ile517 of H19 and Pro591, Val592 and
Leu593 of the loop between H23 and H24 (Fig. 5C).
N4H
2
and O2 of C35 are found within the distance of
the hydrogen bonds with the main chain CO of

Tyr587 (N4–O distance 2.69 A
˚
) and with the main
chain NH of Leu593 (O2–N distance 3.02 A
˚
) of the
turn of the loop, respectively. The base of C34 under-
goes no interaction with the protein. The base of U36
is surrounded by the side chains of Tyr509, Ala512
and Ser516 on H19, and the C-terminal carboxyl
group of Met629 in the C-terminal end; and O4 of
U36 is in close proximity to NH of Met629 (O4–N dis-
tance 3.02 A
˚
). The base of A37 is stacked on a
C31ÆG39 base pair, and the base of C32 is stacked on
the base of A37. The base of A38 lies between the
hydrophobic side chains of Leu451, Lys455 and
Val471 in the ‘stem contact fold’ domain and the side
chains of Pro505 and Met629. In S. cerevisiae ArgRS,
the base of C35 of tRNA
Arg
ICG
is also located in the
hydrophobic pocket formed by the aromatic ring of
the conserved Tyr565. On the other hand, the report
that the K
m
value for tRNA
Arg

ICG
on S. cerevisiae
ArgRS with Tyr565 replaced by Ala is identical to
that on the wild-type ArgRS [14] indicates that this
conserved Tyr makes little contribution to the recog-
nition of the base of C35. The report that a few
tRNA
Met
CAU
molecules are aminoacylated by Arg
with E. coli ArgRS [29] suggests that when the back-
bone of the anticodon stem is superimposed, the
anticodon bases of tRNA
Met
CAU
and tRNA
Arg
CCG
should be oriented in the same direction and bind to
almost the same region in the helix bundle structure
of E. coli ArgRS.
The reported structure of T. thermophilus ArgRS
also has a quite similar hydrophobic pocket to the
hydrophobic pocket accepting C35 of tRNA
Arg
CCU
in
the complex of P. horikoshii ArgRS and the hydro-
phobic pocket accepting C35 of tRNA
Arg

ICG
in the
complex of S. cerevisiae ArgRS. The local structure
accepting G36 of tRNA
Arg
ICG
in the complex of
S. cerevisiae ArgRS is substantially equivalent to the
local structure accepting U36 of tRNA
Arg
CCU
in the
complex of P. horikoshii ArgRS. The reported struc-
ture of T. thermophilus ArgRS also has a local struc-
ture that is quite similar to the local structure
accepting U36 of tRNA
Arg
CCU
in the complex of
P. horikoshii ArgRS.
The relative orientation between A35 and U36 of
tRNA
Met
CAU
bound on A. aeolicus Met-tRNA synthe-
tase (Protein Data Bank ID: 2CSX) [27] is appropriate
to be accepted by the hydrophobic pocket and the
local structure that are commonly found in the three
ArgRSs. Thus, E. coli ArgRS is expected to have a
similar hydrophobic pocket and local structure, which

may successfully accept C35 and G36 of the mutated
tRNA
Met
CCG
in the formation of Arg-tRNA
Met
CCG
on
E. coli ArgRS [29].
On the other hand, in tRNA
Met
CAU
bound on
A. aeolicus Met-tRNA synthetase, the conformation of
the anticodon loop of C32–U33–C34–A35–U36–A37–
A38 of tRNA
Met
CAU
is largely different from that of
C32–U33–C34–C35–U36–A37–A38 of tRNA
Arg
CCU
bound on P. horikoshii ArgRS. It is worth noting that
the base of C32 is stacked on a C31ÆG39 base pair in
tRNA
Met
CAU
, but the base of A37 is stacked on a
C31ÆG39 base pair in the case of the observed complex
of P. horikoshii ArgRS and tRNA

Arg
CCU
which
caught its D-loop on the N-terminal domain of the
ArgRS.
The region from Asp456 to Glu466 in the superim-
posed T. thermophilus ArgRS is not within 2.5 A
˚
of
the corresponding region of S17, H18 and the X-loop
from Ile490 to Glu500 in P. horikoshii ArgRS, whereas
the C-terminal side from Gly467 in the X-loop in
T. thermophilus ArgRS is within 1 A
˚
of that in P. hori-
koshii ArgRS (Fig. 6). The structural difference of this
region is due to difference of crystallization conditions.
It was reported that structural difference in this region
was observed in S. cerevisiae ArgRS proteins crystal-
lized under different crystallization conditions
[12,30,31].
The aminoacylation reaction for tRNA
Arg
CCU
on
wild-type ArgRS and ArgRS lacking the
N-terminal domain (DN ArgRS)
In order to clarify whether or not the binding of the
D-loop of tRNA
Arg

CCU
to the N-terminal domain
contributes to the activation effect of tRNA on tRNA-
assisted Arg-AMP formation reaction or the amino-
acylation reaction, we constructed P. horikoshii ArgRS
(residues 92–629; DN ArgRS) lacking the core region
of the N-terminal domain from residue 1 to residue 91
in order to completely eliminate interactions between
the N-terminal domain and the D-loop of tRNA
Arg
,
and measured the kinetic parameters of the amino-
Modeling of tRNA-assisted mechanism on ArgRS M. Konno et al.
4770 FEBS Journal 276 (2009) 4763–4779 ª 2009 The Authors Journal compilation ª 2009 FEBS
acylation reaction for wild-type ArgRS and DN Ar-
gRS. For wild-type ArgRS and DN ArgRS, the K
m
values for tRNA
Arg
CCU
were 2.6 lm and 3.8 lm in
100 mm Hepes ⁄ NaOH buffer (pH 7.5), respectively,
and the measured ratio of the V-value of DN ArgRS
to that of wild-type ArgRS was [(8 ± 2) · 10
)2
]. This
indicates that the fixing of the D-loop of tRNA
Arg
with the N-terminal domain makes a minor contribu-
tion to the aminoacylation reaction, but is not essen-

tial, and that DN ArgRS facilitates the aminoacylation
reaction of tRNA
Arg
CCU
well enough. In particular,
the proper acceptance of C35 and U36 of tRNA
Arg
CCU
on the plausible accepting structures may be predomi-
nantly contributory to the aminoacylation reaction of
tRNA
Arg
CCU
on P. horikoshii ArgRS.
Model building
Newly obtained structural information about the posi-
tion of ATP analog (ANP) in the ternary complexes of
P. horikoshii ArgRS was successfully used for the mod-
eling of Arg, ATP and A76 of tRNA on P. horikoshii
ArgRS for the tRNA-assisted ATP–PP
i
exchange reac-
tion. In P. horikoshii ArgRS, the positions of the aden-
osine and a-phosphate moieties of ATP bound thereon
were assumed to be equivalent to those of ANP
observed. The Arg-binding region in the complex of
S. cerevisiae ArgRS, Arg and tRNA
Arg
corresponds to
the region surrounded by the S5 strand, the HIGH

loop, the H13 helix, the S14–H14 turn and the H14
helix in the Rossmann fold domain in P. horikoshii
ArgRS. Referring to the distances between the a-NH
2
group of Arg and the main chain C@O of Ser151 and
O of the side chain of Asn153, and the distances
between the guanidinium moiety and the side chains of
Glu148 and Asp351 in S. cerevisiae ArgRS, we pre-
dicted the possible site for Arg in P. horikoshii ArgRS.
In the predicted site, the distances between the a-NH
2
group of Arg and the main chain C@O of Ser127 and
O of the side chain of Asn129 are set at 3.15 A
˚
and
3.04 A
˚
, and the distances between the guanidinium
moiety and the side chain of Glu124 (S5) and Asp335
(H13) are set at 4.33 A
˚
and 3.66 A
˚
. Its carboxyl group
is located at the proper position relative to Pa of ANP
(ATP analog). In the ternary complex of S. cerevisiae
ArgRS, the base of A76 is stacked on the side chain of
Tyr347 on the helix corresponding to H13 in P. hori-
koshii ArgRS, whereas in P. horikoshii ArgRS, the
H13 helix deviates largely from that of S. cerevisiae

ArgRS (Fig. 3A), and the conformation of the side
chain of the corresponding Tyr331 is similar to that in
the binary complex of S. cerevisiae ArgRS and
tRNA
Arg
, the 3¢-terminal CCA of which is not visible
in the electron density map. When A76 was moved
within 2.5 A
˚
of the position of S. cerevisiae tRNA
Arg
bound to S. cerevisiae ArgRS superimposed on P. hor-
ikoshii ArgRS, the 2¢-OH group of the ribose moiety
was located in close proximity to the carboxyl group
of the Arg. The Mg
2+
was coordinated to Pb@O and
Pc@O of ATP, with a distance of 2.1 A
˚
. Figure 7A
shows a model of Arg, ATP coordinated by Mg
2+
and
A76 of tRNA
Arg
assisting the Arg-AMP formation
reaction. A model of NH
2
OH, enzymatically synthe-
sized Arg-AMP and A76 of tRNA

Arg
in the Arg-
NHOH formation reaction in the presence of tRNA
Arg
is shown in Fig. 7B.
In the case of modeling the deacylation reaction of
Arg-tRNA
Arg
, coordinations of NH
2
–Ca–C and Cb of
the Arg moiety of Arg-tRNA
Arg
were assumed to be
essentially identical to those of the Arg predicted
above, and the Arg moiety in the cyclic form was fitted
in the space that is provided by the rearrangement of
the side chain of Gln387 (Fig. 7C). We built a model
for the Glu-dependent ATP–PP
i
exchange reaction at
pH 6.0 in the absence of tRNA
Glu
on the basis of the
crystal structure of T. thermophilus GluRS (Protein
Data Bank IDs: 1N77, 1N78, and 2CV0) [32]. Coordi-
nations of NH
2
–Ca–C and Cb of the Glu moiety of
the intermediate of formed Glu-AMP were assumed to

be identical to those of the observed Glu bound on
GluRS (Fig. 7D).
Ωloop
Fig. 6. Comparison between regions of S17, H18 and the X-loop
of P. horikoshii ArgRS and T. thermophilus ArgRS. Asn498, Phe499
and Glu500 in P. horikoshii ArgRS and Ser464, Phe465 and
Glu466 in T. thermophilus ArgRS are shown in ball-and-stick repre-
sentation.
M. Konno et al. Modeling of tRNA-assisted mechanism on ArgRS
FEBS Journal 276 (2009) 4763–4779 ª 2009 The Authors Journal compilation ª 2009 FEBS 4771
Discussion
ATP–PP
i
exchange reaction and
pyrophosphorolysis reaction at low pH
In the cases of ArgRS from E. coli, B. stearothermophi-
lus, N. crassa, and S. cerevisiae [1–5], GlnRS from
E. coli W, S. cerevisiae, and porcine liver [7,8], and
GluRS from E. coli K12 [9,10], the tRNA-assisted
ATP–PP
i
exchange reaction has been observed, but no
tRNA-independent ATP–PP
i
exchange reaction has
ever been observed. In the cases of GluRS from E. coli
W, S. cerevisiae, porcine liver, and rat liver, the
tRNA-independent ATP–PP
i
exchange reaction was

observed at much higher concentrations of Glu,
whereas the tRNA-assisted ATP–PP
i
exchange reaction
was observed at lower concentrations of Glu. For
instance, the K
m
value for Glu measured in the tRNA-
assisted ATP–PP
i
exchange reaction decreases signifi-
cantly by 10
2
)10
3
-fold in comparison with that in the
tRNA-independent ATP–PP
i
exchange reaction (the
K
m
values for Glu are 0.4 m in the absence of tRNA
and 6.6 · 10
)4
m in the presence of tRNA at pH 7.7
for E. coli W, 0.2 m and 7 · 10
)3
m at pH 7.7 for
S. cerevisiae, 0.4 m and 4 · 10
)3

m at pH 7.7 for
porcine liver, and 0.2 m and 6.7 · 10
)4
at pH 7.6 for
rat liver, respectively [7,8,33]). In the absence of tRNA,
any Arg-AMP and Gln-AMP are not detectable as
intermediates formed by ArgRS and GlnRS, respec-
tively [4,34–36]. As phosphodiesterase-treated tRNA
and mutated tRNA containing C instead of A at the
3¢-end eliminate catalytic activity for the ATP–PP
i
exchange reaction on ArgRS [3], the ATP–PP
i
exchange reaction on ArgRS requires A at the 3¢-end
of tRNA. In the presence of the tRNA treated with
periodate, which oxidizes the 2¢-OH and 3¢-OH groups
of the ribose of A at the 3¢-end to convert them into
dialdehyde groups, the ArgRS, GlnRS and GluRS
enzymes were incapable of catalyzing the ATP–PP
i
exchange reaction [1,4,5,7,33]. These facts indicate that
the hydroxyl group of the ribose of the 3¢-terminal
A76 of tRNA is essential for the ATP–PP
i
exchange
reaction on ArgRS, GlnRS, and GluRS.
The cognate tRNA is also necessary for the ArgRS-
catalyzed pyrophosphorolysis of chemically synthesized
Arg-AMP in the presence of PP
i

and Mg
2+
[6]. Further-
more, the pyrophosphorolysis of chemically synthesized
Arg-AMP and the ATP–PP
i
exchange reaction cata-
lyzed by ArgRS in the presence of tRNA have pH
optima of 6.2 and 6.5, respectively. The presence of PP
i
AB
CD
Fig. 7. Modeled intermediates on P. horikoshii ArgRS or T. thermophilus GluRS in the ATP–PP
i
exchange reaction, the Arg-NHOH formation
reaction, and the deacylation reaction. (A) Arg (cyan), ATP (orange) coordinated by Mg
2+
and A76 (green) of tRNA assisting the Arg-AMP for-
mation reaction on P. horikoshii ArgRS. The Mg
2+
is indicated by a green sphere. (B) HN
2
OH (cyan), enzymatically synthesized Arg-AMP
(orange) and A76 (green) of tRNA in P. horikoshii ArgRS in the Arg-NHOH formation reaction in the presence of tRNA. (C) Arg-A76 (green) of
Arg-tRNA with the Arg moiety with the cyclic configuration and AMP (orange) on P. horikoshii ArgRS in the deacylation reaction of Arg-tRNA.
The torsional angles of the side chain of Gln387 (cyan) were changed from the original structure. (D) A Glu with the cyclic configuration
(cyan) in the C–O
c)
–H–O2 form and ATP (orange) on T. thermophilus GluRS in the Glu-AMP formation reaction in the absence of tRNA.
Modeling of tRNA-assisted mechanism on ArgRS M. Konno et al.

4772 FEBS Journal 276 (2009) 4763–4779 ª 2009 The Authors Journal compilation ª 2009 FEBS
at high concentrations was reported to inhibit the
ArgRS-catalyzed formation reaction of Arg-tRNA at
pH 7.0, and more strongly at pH 6.4 [3,4,6].
At low pH, the 2¢-OH group of the ribose moiety of
A76 of the cognate tRNA assists the ATP–PP
i
exchange reactions on ArgRS, GlnRS, and GluRS. In
the pyrophosphorolysis reaction of synthetic Arg-AMP
at low pH in the presence of PP
i
and Mg
2+
, which is
the reverse reaction to the formation of Arg-AMP, the
ribose moiety of A76 is also required. The fact that, in
GluRS, the K
m
value of Glu for the ATP–PP
i
exchange reaction decreases substantially in the pres-
ence of tRNA as compared with that in the absence of
tRNA [7,8,33] indicates that the 2¢-OH group of tRNA
interacts with Glu directly. As the 2¢-OH group of
tRNA is close to the a-carboxyl group of Glu, an
interaction between the 2¢-OH group and the a-car-
boxyl group occurs, which is an interaction with the O
of the a-carboxyl group rather than the C. On the
other hand, the interaction with C results in the
aminoacylation reaction. It is expected that the direct

interaction between the the 2¢-OH group of tRNA and
the a-carboxyl group of Arg ⁄ Gln will also take place
in the ATP–PP
i
exchange reaction on ArgRS and
GlnRS. The interaction between the 2¢-OH group
and the O of the a-carboxyl group of Arg is thought
to accelerate the pyrophosphorolysis reaction on Arg-
RS. In a ternary complex of S. cerevisiae ArgRS,
tRNA
Arg
ICG
, and Arg (Protein Data Bank ID: 1F7V)
[12], the O of the 2¢-OH group in the 3¢-end A76 of
tRNA
Arg
ICG
is 3.18 A
˚
, 3.71 A
˚
and 3.57 A
˚
distant
from the C, O1, and O2 (the O contacting Pa of
ATP is defined as O1 and the other as O2), respec-
tively, of the a-carboxyl group of Arg. The move-
ment of O2 by a rotation of 45° around the Ca–C
bond causes a decreased distance of 2.77 A
˚

between
O2 and the O of the 2¢-OH group, which is a suit-
able distance for a hydrogen bond to form between
them, whereas the C is not moved by this rotation.
Such a slight rotation induces the formation of a
hydrogen bond between O2 and the 2¢-OH group of
the 3¢-end ribose moiety of tRNA, and thereby the
anionic form of the C)O1 is converted into the
C@O1 form. Hence, the intermolecular rearrangement
reaction for Arg-AMP formation is considered to
take place through a pathway such as that shown in
Fig. 8. The O1 orbital of the double bond C@O1
changes initially from an sp
2
to an sp
3
hybrid orbital,
and a bond is formed between O1 and Pa of ATP
through formation of the trigonal bipyramid coordi-
nation around P a. At the same time, the H–O2 bond
of H–O2–C of the a-carboxyl group of Arg is trans-
ferred to the O2–C bond to form the double bond
O2@C, and a proton is transferred to a water mole-
cule. Successively, the C @O1 bond is transferred to
the O1–Pa bond, the Pa–O bond is transferred to
the O–Pb bond, and thereby the O–Pb bond is con-
verted into O@Pb. Finally, PP
i
is released in the
form of Mg-PP

i
. As O1 of the amino acid binds to
Pa, and PP
i
is released from Pa on the reverse
side, this reaction of Arg-AMP formation is an S
N
2
reaction.
The modeling of Arg, ATP and A76 of tRNA on
P. horikoshii ArgRS for the Arg-AMP formation reac-
tion at low pH indicates that when the straight side
chain of an Arg molecule is inserted into the hydro-
phobic pocket as in the Arg molecule bound to S. cere-
visiae ArgRS, its carboxyl group can locate in close
proximity to Pa of ATP (Fig. 7A). The a-carboxyl
group of the Arg molecule can assume such a confor-
mation that O2 forms a hydrogen bond with the
2¢-OH group of the ribose moiety of A76 of tRNA
Arg
by rotation around Ca–C. When Pa of ATP gains
access to O1 of C@O1 of the a-carboxyl group of Arg,
and two oxygen atoms of Pb and Pc are coordinated
by Mg
2+
on two parallel P@O bonds rather than
P–O
)
, as observed in the acetylacetonato [CH
3

C(@O)–
C
)
H–C(@O)CH
3
] complex, the intermolecular rear-
rangement reaction occurs.
In the pyrophosphorolysis reaction of synthetic Arg-
AMP in the presence of PP
i
and Mg
2+
, the 2¢-OH
group of tRNA
Arg
can never be placed in the proper
Arginine
A76
A76
Arg-AMP
ATP
'
'
'
'
'
'
'
'
'

'
Fig. 8. Reaction scheme of formation of Arg-AMP from Arg and
ATP in the presence of tRNA at low pH. The rotation of the a-car-
boxyl group around Ca–C induces the formation of a hydrogen bond
between the 2¢-OH group of the ribose of A76 and O2H of the
a-carboxyl group of Arg. Arrows indicate the sequential transfer of
the bond in the intermediate.
M. Konno et al. Modeling of tRNA-assisted mechanism on ArgRS
FEBS Journal 276 (2009) 4763–4779 ª 2009 The Authors Journal compilation ª 2009 FEBS 4773
configuration for the aminoacylation reaction without
a conformational rearrangement, but should be in a
much more preferable configuration to form a hydro-
gen bond with C@O2 of the Ca–(C@O2)–O1–Pa moi-
ety. Even though the pyrophosphorolysis reaction is
also an S
N
2 reaction, the hydrogen bond between the
2¢-OH group of tRNA and C@O2 is also required for
the pyrophosphorolysis reaction. The cleavage of
the bond between CO1 and Pa of Arg-AMP is acceler-
ated by this hydrogen bond. The formation of this
hydrogen bond leads to a double bond between C and
O1, and the intermolecular rearrangement reaction
proceeds in the reverse direction of the Arg-AMP for-
mation reaction shown in Fig. 8. Indeed, the amount
of neutral PP
i
, in which the lone pairs of double bonds
of Pb@O and Pc@O are coordinated by Mg
2+

,
increases at lower pH in the hydrophobic circumstance
of the reaction region of ArgRS. PP
i
is involved in the
pyrophosphorolysis reaction in the form of Mg-PP
i
.
This fact explains why the pyrophosphorolysis reaction
of synthetic Arg-AMP has an optimum at pH 6.2 in
the presence of tRNA and its optimum pH is a little
lower than that for the ATP–PP
i
exchange reaction [6].
It was reported that, in the presence of tRNA
Arg
,in
parallel with the Arg-tRNA formation reaction on
ArgRS, addition of hydroxylamine (NH
2
OH) gives rise
to increased hydrolysis of ATP at pH 8.0, whereas in
the absence of tRNA
Arg
, addition of NH
2
OH induces
no increase in the hydrolysis of ATP [3]. After PP
i
is

released, the 2¢-OH group of the ribose moiety of
tRNA forms a hydrogen bond with O2 of C@O2 of
Arg-AMP (Fig. 7B), and the sp
2
hybrid orbital on the
C therefore changes to an sp
3
hybrid orbital. The C
with an sp
3
hybrid orbital has the ability to react with
NH
2
OH. Therefore, by an S
N
2 reaction, Arg-NHOH
is formed and AMP is released. The fact that Arg-
AMP reacts with NH
2
OH rather than with tRNA
shows that, in the ATP–PP
i
exchange reaction, tRNA
stays preferentially in the position suitable for the
formation of a hydrogen bond with O2 of C@O2.
If, in the ternary complex of S. cerevisiae ArgRS,
tRNA, and Arg, the carboxyl group of the Arg was
rotated by 45° around Ca–C, its O2 would come into
close proximity, with a distance of 2.77 A
˚

, to the O of
the 2¢-OH group of A76. As, in the ternary complex of
GlnRS, tRNA and Gln-AMP analog (5¢-O-[N-(l-glu-
taminyl)sulfamonyl]adenosine) [37], the 2¢-OH group
of the 3¢-end ribose moiety of tRNA
Gln
is 3.00 A
˚
and
3.60 A
˚
distant from the C and O2, respectively, of the
carbonyl group of Ca–(C@O2)–NH– in the Gln-AMP
analog. The Gln can assume such a conformation that
O2H of the carboxyl group forms a hydrogen bond
with the 2¢-OH group of A76 by the rotation of the
carboxyl group and a little movement. The observation
that the ATP–PP
i
exchange reaction requires tRNA at
low pH in ArgRS, GlnRS and GluRS is explained by
the mechanism that the formation of the hydrogen
bond between O2 of the carboxyl group of the cognate
amino acid and the 2¢-OH group of the ribose moiety
of A76 maintains the appropriate orientation of the
carboxyl group of the amino acid for Pa.
On GluRS, in the absence of tRNA, the K
m
value of
Glu in the ATP–PP

i
exchange reaction increases to up
to 10
2
)10
3
-fold that in the presence of tRNA at a pH
of 7.7 or 7.6 [7,8,33]. In the absence of tRNA, the
activity increases up to pH 8.0 as pH increases, and
decreases when the pH reaches over 8.0, whereas in the
presence of tRNA, the activity decreases when the pH
reaches over 6.2 [33]. The reported large difference in
the K
m
value is related to a difference in the form of
the bound Glu. In the presence of tRNA, the a-car-
boxyl group of the Glu interacts with the 2¢-OH group
of the ribose moiety of tRNA, and the side chain
assumes the straight form, with the alkyl group in the
all-trans form, allowing the ribose moiety to approach.
In the case of the ATP–PP
i
exchange reaction in the
absence of tRNA, the most likely candidate for the
form of the Glu is a rotational isomer in the cyclic
form, which contains a cis-alkyl group. In the cyclic
form, instead of the 2¢-OH group of tRNA, the c-car-
boxyl group of the side chain can form a hydrogen
bond with the a-carboxyl group in the C–O
c)

–H–O2
form (Fig. 7D), which results in preferential rotation of
the carboxyl group around Ca–C. Such rotational
isomerization of Asp and Glu is used in the phenomena
that amide bond is sometimes transferred from the
a-carboxyl of an Asp or Glu to the side chain b-car-
boxyl or c-carboxyl under hydrophobic conditions [38].
In GlnRS, the ATP–PP
i
exchange reaction has not
been yet observed in the absence of tRNA, even in the
presence of a high concentration of Gln. This is
explained by the fact that, even if Gln assumed a cyclic
form, no hydrogen bond could be formed between the
side chain and the a-carboxyl group.
Deacylation reaction at high pH
The deacylation reaction consists of the following two
steps: the first step is the formation of Arg-AMP from
Arg-tRNA and AMP; the second step is the formation
of Arg and ATP from Arg-AMP and PP
i
through a
pyrophosphorolysis reaction. Because the first step is
an S
N
2 reaction, in the reaction intermediate, C of the
Ca–(C@O)–O moiety of Arg-tRNA has an sp
3
hybrid
orbital. The conversion from an sp

2
to an sp
3
hybrid
orbital requires the transfer of a proton to C@Oor
Modeling of tRNA-assisted mechanism on ArgRS M. Konno et al.
4774 FEBS Journal 276 (2009) 4763–4779 ª 2009 The Authors Journal compilation ª 2009 FEBS
the formation of a hydrogen bond. At pH 8, the find-
ing that, as no residue of the protein can donate a pro-
ton in the pyrophosphorolysis reaction, even though,
at low pH, the 2¢-OH group of tRNA is used, indicates
that there is, of course, no residue to donate a proton
in the first step at high pH. The guanidinium group of
Arg also forms the rotational isomer in a quite similar
manner to the side chain of Glu. The transfer of a pro-
ton from N
e
Hof–N
e+
H@C–(NH
2
)
2
to the C@Oof
the ester bond of Arg-tRNA converts the sp
2
hybrid
orbital of the C to an sp
3
hybrid orbital. A bond is

then formed between this C and the O of Pa@O, and
the intermolecular rearrangement reaction occurs as
shown in Fig. 9. The Arg moiety in the cyclic form
can, indeed, occupy the active site on ArgRS by a
change in the torsional angles of the side chain of
Gln387 (Fig. 7C). Arg-tRNA with such a rotational
isomer is decomposed by the deacylation reaction. The
deacylation reaction of Arg-tRNA occurs slowly at pH
7.2, and this reaction becomes much slower as the pH
decreases. This pH dependence shows that, at the
lower pH, a lower reaction rate is observed for the first
step, whereas a higher reaction rate is observed for the
pyrophosphorolysis reaction of Arg-AMP. It has been
observed that, under conditions of excess enzyme, in
the presence of AMP but in the absence of PP
i
at pH
6.0, the decrease in the concentration of Arg-tRNA
takes place with a first-order rate constant, but such a
reaction at pH 6.0 leaves 43% of the Arg-tRNA unre-
acted [11]. From this result, the ratio of Arg-tRNA
without the cyclic form of the Arg moiety and with
the cyclic form is estimated to be 43 : 57 at pH 6.0.
The reaction at such a high pH of 7.2 was reported to
have a much higher rate, so that a considerable
amount of Arg-tRNA was not left unreacted. The
ratio of Arg-tRNA with the cyclic form of the Arg
moiety to total Arg-tRNA is strongly dependent on
pH. The Arg-AMP formed from Arg-tRNA with the
cyclic form of the Arg moiety maintains a suitable

conformation for the formation of an intramolecular
hydrogen bond. The intramolecular hydrogen bond,
instead of tRNA, accelerates the pyrophosphorolysis
step of this deacylation reaction.
The reported results of the deacylation reaction indi-
cate that ArgRS has a binding affinity for Arg-tRNA
with the cyclic form of the Arg moiety that is compa-
rable to that for Arg-tRNA without the cyclic form.
Furthermore, as suggested above, ArgRS has a binding
affinity for Arg-AMP with the cyclic form of the Arg
moiety that is comparable to that for Arg-AMP with-
out the cyclic form.
The rate of transfer of the Arg moiety from the
chemically synthesized Arg-AMP to tRNA has an
optimum at pH 8.1 [6]. If the guanidium moiety of
Arg-AMP can donate a proton from N
e
H of the cyclic
form instead of the 2¢-OH group of tRNA to C@Oof
the Ca–(C@O)–O–Pa moiety of Arg-AMP, the 2¢-OH
group of tRNA becomes free. The acceptance of a
proton by the –(C@O)–O– moiety changes the C orbi-
tal from an sp
2
hybrid orbital to an sp
3
hybrid orbital,
and the bond is formed between this C and the 2¢-OH
group of tRNA. As Arg-AMP has the ionic guanidi-
nium group and the neutral amino group at pH 8, the

rate of transfer from Arg-AMP to tRNA has an opti-
mum at pH 8.1. In the ATP–PP
i
exchange reaction at
low pH, the C of the a-carboxyl group of the Arg
assumes an sp
2
configuration, whereas in the transfer
reaction of the Arg moiety, the 2¢-OH group of tRNA
forms a bond with the C with an sp
3
hybrid orbital of
Arg-AMP, through an S
N
2 reaction at high pH. From
the point of view of the stereo structural understanding
in the reaction pathway of the transfer of the Arg moi-
ety from the enzymatically synthesized Arg-AMP to
tRNA, the facts that the K
m
values for the cognate
amino acids in the aminoacylation reaction on ArgRS,
GlnRS and GluRS are not the same as but are less
than that in the ATP–PP
i
exchange reaction should be
noted (for S. cerevisiae ArgRS, the K
m
values for Arg
Arg-tRNA

AMP
Arg-AMP
'
'
'
'
'
'
'
'
'
'
'
'
'
'
'
tRNA
Fig. 9. Reaction scheme of Arg transfer from Arg-tRNA to AMP in the deacylation reaction at pH 8.0. A proton of N
e
Hof–N
e+
H@C–(NH
2
)
2
of the Arg moiety with the cyclic configuration of Arg-tRNA is transferred to C@O of the ester bond of Arg-tRNA. The adenosine moiety of
AMP is omitted.
M. Konno et al. Modeling of tRNA-assisted mechanism on ArgRS
FEBS Journal 276 (2009) 4763–4779 ª 2009 The Authors Journal compilation ª 2009 FEBS 4775

in the aminoacylation reaction at pH 7.5 and in the
ATP–PP
i
exchange reaction at pH 7.0 are 1.5 lm and
2.5 lm, respectively [39]. For B. stearothermophilus
ArgRS, those for Arg at pH 8.0 are 5.7 lm and
7.4 lm, respectively [40], and for E. coli K12 ArgRS,
those in the aminoacylation reaction at pH 7.4 and in
the ATP–PP
i
exchange reaction at pH 7.2 are 12 lm
and 110 lm, respectively [41]. For E. coli W GluRS
and GlnRS, the K
m
values for Glu and for Gln in the
aminoacylation reaction at pH 7.7 are 1.2 · 10
)4
m and
1.8 · 10
)4
m, and those in the ATP–PP
i
exchange reac-
tion in the presence of cognate tRNA are 6.6 · 10
)4
m
and 8.0 · 10
)4
m, respectively [7]. For rat liver GluRS,
the K

m
values for Glu in the aminoacylation reaction
and in the ATP–PP
i
exchange reaction at pH 6.8 are
1.3 · 10
)4
m and 6.7 · 10
)4
m, respectively [33].
The newly determined structure of the ATP analog
(ANP) bound on P. horikoshii ArgRS has been used to
construct a model of the tRNA-assisted ATP–PP
i
exchange reaction and a model of the tRNA-assisted
pyrophosphorolysis reaction of Arg-AMP at low pH.
Modeling of the ArgRS-catalyzed deacylation of Arg-
tRNA at high pH has also been performed on the
basis of the common binding site of ATP and AMP
on P. horikoshii ArgRS. The newly determin ed struc-
ture of the tRNA
Arg
CCU
bound on P. horikoshii
ArgRS provides further information on the plausible
accepting structures for C35 and U36 of tRNA
Arg
CCU
.
In addition, the comparison of the reactivities of wild-

type ArgRS and ArgRS lacking the N-terminal
domain (DN ArgRS) provides good evidence that the
proper acceptance of C35 and U36 of tRNA
Arg
CCU
on
the plausible accepting structures may be predomi-
nantly contributory to the aminoacylation reaction of
tRNA
Arg
CCU
on P. horikoshii ArgRS.
Experimental procedures
Gene expression and purification
The gene encoding ArgRS was isolated from the genome of
P. horikoshii by PCR amplification, and inserted into the
TOPO vector (Invitrogen); TOPO ⁄ ArgRS was then ligated
with pET28c. E. coli BL21(DE3)codon+ cells were trans-
formed with plasmid pET28c ⁄ ArgRS, and the crude protein
was purified on an Ni
2+
–nitrilotriacetic acid superflow
column and further purified with an A
¨
KTA purifier FPLC
system through Resource Q (GE Healthcare, Chalfont
St Giles, UK), Hitrap heparin (GE Healthcare) and hydroxy-
apatite (BioScale, Inc., Cambridge, MA, USA) columns.
The gene encoding the protein lacking the N-terminal
side from the 91st residue (DN ArgRS) was amplified

by PCR using plasmid pET28c ⁄ ArgRS as template. A
constructed plasmid (pET28c ⁄ DN ArgRS) was expressed in
E. coli BL21(DE3)codon+, and the crude protein was puri-
fied in the same way as the wild-type protein.
In P. horikoshii, codon usages for AGA and AGG co-
dons are 19 and 34, respectively, and they amount to 98%
among six codons for Arg. The D-loops of isoacceptor
tRNA
UCU
and tRNA
CCU
contain nine (AGCAGGAC
20a
A)
and 10 nucleotides (AGCCA
17a
GGAC
20a
A), respectively.
The P. horikoshii tRNA
Arg
CCU
gene (5¢-GGACCGGTAG
CCTAGCCA
17a
GGAC
20a
AGGG CGGCGGCCTCCTAAG
CCGCAGGTCCGGGGTTCAAATCCCCGCCGGTCCG
CCA-3¢) was cloned with the T7 promoter into the vector

pUC119. In vitro transcription of the template DNA was
carried out with T7 RNA polymerase, and the crude tran-
script was charged on a Resource Q column. Elution with
20 mm Tris ⁄ HCl (pH 7.5) containing 10 mm MgCl
2
under
a linear gradient of NaCl from 0 to 2 m gave a pure
tRNA
Arg
transcript, which was precipitated by addition of
ethanol.
Aminoacylation reaction
The aminoacylation reaction of tRNA was measured at
65 °C in 100 mm Hepes ⁄ NaOH buffer (pH 7.5) containing
30 mm KCl, 0.1 lgÆmL
)1
BSA, 10 mm MgCl
2
,4mm
ATP, 50 lml-[
14
C]Arg (100 lCiÆmL
)1
Moravek, Lane
Brea, CA, USA), 0.2 lm wild-type ArgRS or 2 lm DN
ArgRS, and various concentrations of tRNA
Arg
CCU
(0.5–
16 lm). Aliquots of 9 lL at varying time intervals were

quenched with 5 lL of 1% trichloroacetic acid and spot-
ted onto Whatman 3 MM disks. Radioactivity was quan-
tified in a scintillation counter. The kinetic constants were
derived from a Lineweaver plot.
Crystallization, data collection, and structure
determination
A solution of 10 mm Tris ⁄ HCl buffer (pH 7.5) containing
5mm MgCl
2
and 5–6 mgÆ mL
)1
tRNA
Arg
transcript was
heated at 80 °C for 5 min and then slowly cooled to room
temperature. Then, 10 mm Hepes ⁄ NaOH buffer (pH 7.5)
containing 5 m m MgCl
2
and 2 mgÆmL
)1
ArgRS was added,
so that the ArgRS ⁄ tRNA
Arg
molar ratio was 1 : 1.1. The
resulting mixture was heated at 80 °C for 5 min, and slowly
cooled to room temperature. In the case of the ternary com-
plex, ANP tetralithium salt hydrate (Sigma, St Louis, MO,
USA) was added to a final concentration of 5 mm. Crystals of
the complexes were grown at 20 °C by vapor diffusion in
hanging drops. A 2 lL drop of the above solution containing

ArgRS and tRNA
Arg
and the reservoir solution (1 lL each)
was equilibrated with reservoir containing 30% poly(ethylene
glycol) 4000, 0.2 m ammonium sulfate, and 100 mm Tris ⁄ HCl
buffer (pH 8.0). Thin, plate-like crystals with dimension of
0.4 · 0.07 · < 0.05 mm were obtained in 3–7 days.
Modeling of tRNA-assisted mechanism on ArgRS M. Konno et al.
4776 FEBS Journal 276 (2009) 4763–4779 ª 2009 The Authors Journal compilation ª 2009 FEBS
The intensity data were collected at 100 K on beamline
BL41 at SPring-8 (Hyogo, Japan) and beamline AR-NM12
at the Photon Factory (Tsukuba, Japan). The dataset was
processed with the hkl2000 suite [42]. The structure of a
protein was solved by the molecular replacement method
with the molrep program in ccp4 [43] by using T. thermo-
philus ArgRS (Protein Data Bank ID: 1IQ0) as a search
model. As for the tRNA
Arg
molecule, tRNA
Arg
ICG
in the
S. cerevisiae ArgRS–tRNA
Arg
ICG
complex (Protein Data
Bank ID: 1F7V) was used as an initial model. Refinements
of this structure gave an R-factor of about 40%, but the
low electron density maps in the N-terminal domain and
tRNA region revealed large deviations of this domain of

P. horikoshii ArgRS from T. thermophilus ArgRS and
S. cerevisiae ArgRS, a large conformational change of the
anticodon loop, the D-loop, and the T-loop, and deviation
of the inclination of base planes of the acceptor stem and
the anticodon-binding stem of tRNA
Arg
CCU
from S. cerevi-
siae tRNA
Arg
ICG
. The repeats of the model building and
refinements using the o program [44] and the cns program
[45] gave a better electron density map, and an ANP mole-
cule was finally identified from the map. Crystallographic
statistics are summarized in Table 1. The final model for
the tertiary and binary complexes has good stereochemistry,
with 92.3% and 91.1% of residues, respectively, in the most
favored regions of the Ramachandran plot [46]. molscript
[47] and raster3d [48] were used for drawing Figs 1 and
3–7, and bobscript also [49] for Fig. 4.
Acknowledgements
This work was supported in part by a grant from the
National Project on Protein Structural and Functional
Analyses to M. Konno.
References
1 Mitra SK & Mehler AH (1966) The role of transfer
ribonucleic acid in the pyrophosphate exchange reaction
of arginine-transfer ribonucleic acid synthetase. J Biol
Chem 241, 5161–5162.

2 Mitra SK & Mehler AH (1967) The arginyl transfer
ribonucleic acid synthetase of Escherichia coli. J Biol
Chem 242, 5490–5494.
3 Mehler AH & Mitra SK (1967) The activation of argi-
nyl transfer ribonucleic acid synthetase by transfer ribo-
nucleic acid. J Biol Chem 242, 5495–5499.
4 Parfait R & Grosjean H (1972) Arginyl-transfer ribo-
nucleic-acid synthetase from Bacillus stearothermophilus.
Eur J Biochem 30, 242–249.
5 Nazario M & Evans JA (1974) Physical and kinetic
studies of arginyl transfer ribonucleic acid ligase of
Neurospora. J Biol Chem 249 , 4934–4942.
6 Lui M, Chakraburtty K & Mehler AH (1978) Partial
reaction of aminoacyl-tRNA synthetases as functions of
pH. J Biol Chem 253, 8061–8964.
Table 1. Crystallographic statistics. R
merge
¼ 100 Â
P
I
i
À <I>
jj
=
P
I
i
. R
factor
¼ 100 Â

P
jj
F
obs
À
jj
F
calc
jj
=
P
F
obs
jj
, where F
obs
and F
calc
are the
observed and calculated structure factors, respectively (F
obs
> 0.01r). R
free
was calculated with 10% of randomly selected data. Ramachan-
dran plots analysis is performed using
PROCHECK [46].
Ternary complex Binary complex
Data sets ArgRS–tRNA
Arg
–ATP analog (ANP) ArgRS-tRNA

Arg
Space group P2
1
P2
1
Unit cell a, b and c (A
˚
), and b (°) 76.27, 60.00, 110.66, 106.94 76.21, 60.14, 110.33, 107.06
Wavelength (A
˚
) 1.0 1.0
Resolution (A
˚
)40)2.0 (2.07)2.0)
a
40)2.3 (2.38)2.3)
a
Number of observations 171 288 105 487
Number of unique reflections 60 238 38 820
R
merge
(%) 5.6 (25.3)
a
6.4 (21.0)
a
<I> ⁄ <r> 24.1 (1.9)
a
17.2 (2.5)
a
Completeness (%) 92.7 (77.9)

a
90.7 (79.3)
a
Refinement
R
factor
, R
free
(%) 21.3 (27.7)
a
, 25.3 (31.0)
a
20.1 (27.5)
a
, 26.2 (35.3)
a
Number of atoms
Protein, tRNA, ANP, water 5097
b
, 1626, 31, 362 5097
b
, 1626, none, 248
Averaged B-factor (A
˚
2
)
Overall 36.3 37.4
Protein, tRNA, ANP, waters 33.2, 46.5, 34.9, 35.3 35.2, 44.9, none, 33.4
rmsd from ideal geometry
Bonds (A

˚
), angles (°) 0.006, 1.16 0.006, 1.18
Ramachandran plot analysis (%)
Core, allowed and generous regions 92.3, 7.3, 0.2 91.1, 8.2, 0.5
a
The values for the highest shell are shown in parentheses.
b
The first methionine is not included.
M. Konno et al. Modeling of tRNA-assisted mechanism on ArgRS
FEBS Journal 276 (2009) 4763–4779 ª 2009 The Authors Journal compilation ª 2009 FEBS 4777
7 Ravel JM, Wang SF, Heinemeyer C & Shive W
(1965) Glutamyl and glutaminyl ribonucleic acid syn-
thetases of Escherichia coli W. J Biol Chem 240, 432–
438.
8 Lee LW, Ravel JM & Shive W (1967) A general
involvement of acceptor ribonucleic acid in the initial
activation step of glutamic acid and glutamine. Arch
Biochem Biophy 121, 614–618.
9 Lapointe J & So
¨
ll D (1972) Glutamyl transfer ribonu-
cleic acid synthetase of Escherichia coli I. Purification
and properties. J Biol Chem 247, 4966–4974.
10 Lapointe J & So
¨
ll D (1972) Glutamyl transfer ribonu-
cleic acid synthetase of Escherichia coli II. Interaction
with intact glutamyl transfer ribonucleic acid. J Biol
Chem 247, 4975–4981.
11 Fersht AR, Gangloff J & Dirheimer G (1978)

Reaction pathway and rate-determining step in the
aminoacylation of tRNA
Arg
catalyzed by the arginyl-
tRNA synthetase from yeast. Biochemistry 17, 3740–
3746.
12 Delagoutte B, Moras D & Cavarelli J (2000) tRNA
aminoacylation by arginyl-tRNA synthetase: induced
conformations during substrate binding. EMBO J 21,
5599–5610.
13 Shimada A, Nureki O, Goto M, Takahashi S & Yokoy-
ama S (2001) Structural and mutational studies of the
recognition of the arginine tRNA-specific major identity
element, A20, by arginyl-tRNA synthetase. Proc Natl
Acad Sci USA 98, 13537–13542.
14 Geslain R, Bey G, Cavarelli J & Eriani G (2003)
Limited set of amino acid residues in a class Ia amino-
acyl-tRNA synthetase is crucial for tRNA binding. Bio-
chemistry 42, 15092–15101.
15 Crepin T, Schmitt E, Mechulam Y, Sampson PB,
Vaughan MD, Honek JF & Blanquet S (2003) Use of
analogues of methionine and methionyl adenylate to
sample conformational changes during catalysis in
Escherichia coli methionyl-tRNA synthetase. J Mol Biol
332, 59–72.
16 Nakama T, Nureki O & Yokoyama S (2001) Structural
basis for the recognition of isoleucyl-adenylate and an
antibiotic, mupirocin, by isoleucyl-tRNA synthetase.
J Biol Chem 276, 47387–47393.
17 Fukai S, Nureki O, Sekine S, Shimada A, Tao J, Vass-

ylyev DG & Yokoyama S (2000) Structural basis for
double-sieve discrimination of l-valine from l-isoleucine
and l-threonine by the complex of tRNA(Val) and
valyl-tRNA synthetase. Cell 103, 793–803.
18 Cusack S, Yaremchuk A & Tukalo M (2000) The 2 A
˚
crystal structure of leucyl-tRNA synthetase and its
complex with a leucyl-adenylate analogue. EMBO J 19,
2351–2361.
19 Mechulam Y, Schmitt E, Maveyraud L, Zelwer C,
Nureki O, Yokoyama S, Konno M & Blanquet S
(1999) Crystal structure of Escherichia coli methionyl-
tRNA synthetase highlights species-specific features.
J Mol Biol 294, 1287–1297.
20 Nureki O, Vassylyev DG, Tateno M, Shimada A, Nak-
ama T, Fukai S, Konno M, Hendrickson TL, Schimmel
P & Yokoyama S (1998) Enzyme structure with two
catalytic sites for double-sieve selection of substrate.
Science 280, 578–582.
21 Fukunaga R & Yokoyama S (2005) Crystal structure of
leucyl-tRNA synthetase from the archaeon Pyrococcus
horikoshii reveals a novel editing domain orientation.
J Mol Biol 346, 57–71.
22 Fukai S, Nureki O, Sekine S, Shimada A, Vassylyev
DG & Yokoyama S (2003) Mechanism of molecular
interactions for tRNA(Val) recognition by valyl-tRNA
synthetase. RNA 9, 100–111.
23 Hauenstein S, Zhang CM, Hou YM & Perona JJ (2004)
Shape-selective RNA recognition by cysteinyl-tRNA
synthetase. Nat Struct Mol Biol 11, 1134–1141.

24 Freist W, Sternbach H & Cramer F (1981) Arginyl-
tRNA synthetase from baker’s yeast. Eur J Biochem
119, 477–482.
25 Ramos A & Varani G (1997) Structure of the acceptor
stem of Escherichia coli tRNA
Ala
: role of the G3ÆU70
base pair in synthetase recognition. Nucleic Acids Res
25, 2083–2090.
26 Tukalo M, Yaremchuk A, Fukunaga R, Yokoyama S
& Cusack S (2005) The crystal structure of leucyl-tRNA
synthetase complexed with tRNA
Leu
in the post-trans-
fer-editing conformation. Nat Struct Mol Biol 12, 923–
930.
27 Nakanishi K, Ogiso Y, Nakama T, Fukai S & Nureki
O (2005) Structural basis for anticodon recognition by
methionyl-tRNA synthetase. Nat Struct Mol Biol 12,
931–932.
28 McClain WH & Foss K (1988) Changing the acceptor
identity of a transfer RNA by altering nucleotides in a
‘variable pocket’. Science 241, 1804–1807.
29 Schulman LH & Pelka H (1989) The anticodon con-
tains a major element of the identity of arginine transfer
RNAs. Science 246, 1595–1597.
30 Delagoutte B, Keith G, Moras D & Cavarelli J
(2000) Crystallization and preliminary X-ray crystallo-
graphic analysis of yeast arginyl-tRNA synthetase–
yeast tRNA

Arg
complexes. Acta Crystallogr D 56,
492–494.
31 Cavarelli J, Delagoutte B, Eriani G, Gangloff J &
Moras D (1998) l-arginine recognition by yeast arginyl-
tRNA synthetase. EMBO J 17, 5438–5448.
32 Sekine S, Nureki O, Dubois DY, Bernier S, Cheˆ nevert
R, Lapointe J, Vassylyev DG & Yokoyama S (2003)
ATP binding by glutamyl-tRNA synthetase is switched
to the productive mode by tRNA binding. EMBO J 22,
676–688.
33 Deutscher MP (1967) Rat liver glutamyl ribonucleic
acid synthetase. J Biol Chem 242, 1132–1138.
Modeling of tRNA-assisted mechanism on ArgRS M. Konno et al.
4778 FEBS Journal 276 (2009) 4763–4779 ª 2009 The Authors Journal compilation ª 2009 FEBS
34 Craine J & Peterkofsky A (1975) Evidence that arginyl-
adenylate is not an intermediate in the arginyl-tRNA
synthetase reaction. Arch Biochem Biophys 168, 343–
350.
35 Thiebe R (1983) No arginyl adenylate is detectable as
an intermediate in the aminoacylation of tRNA
Arg
. Eur
J Biochem 130, 525–528.
36 Folk WR (1971) Molecular weight of Escherichia coli
glutaminyl transfer ribonucleic acid synthetase, and iso-
lation of its complex with glutamine transfer ribonucleic
acid. Biochemistry 10, 1728–1732.
37 Rath VL, Silvian LF, Beijer B, Sproat BS & Steitz TA
(1998) How glutaminyl-tRNA synthetase selects gluta-

mine. Structure 6, 439–449.
38 Geiger T & Clarke S (1987) Deamidation, isomeriza-
tion, and racemization at asparaginyl and aspartyl resi-
dues in peptides. J Biol Chem 262, 785–794.
39 Gangloff J, Schutz A & Dirheimer G (1976) Arginyl-
tRNA synthetase from baker’s yeast: purification and
some properties. Eur J Biochem 65, 177–182.
40 Li J, Yao Y, Liu M & Wang E (2003) Arginyl-tRNA
synthetase with signature sequence KMSK from Bacil-
lus stearothermophilus. Biochem J 376, 773–779.
41 Lin SX, Shi JP, Cheng XD & Wang YL (1988) Arginyl-
tRNA synthetase from Escherichia coli, purification by
affinity chromatography, properties, and steady-state
kinetics. Biochemistry 27, 6343–6348.
42 Otwinowski Z & Minor W (1997) Processing of X-ray
diffraction data collected in oscillation mode. Methods
Enzymol 276, 307–326.
43 CCP4 (1994) The CCP4 Suites: program for protein
crystallography. Acta Crystallogr D 50, 760–763.
44 Jones TA, Zou J-Y, Cowan SW & Kjeldgaard M (1991)
Improved methods for building protein models in elec-
tron density maps and the location of errors in these
models. Acta Crystallogr A 47, 110–119.
45 Bru
¨
nger AT, Adams PD, Clore GM, DeLano WL, Gros
P, Grosse-Kunstleve RW, Jiang J-S, Kuszewski J, Nilges
M, Pannu NS et al. (1998) Crystallography and NMR
system: a new software suite for macromolecular struc-
ture determination. Acta Crystallogr D 54, 905–921.

46 Laskowski RA, MacArthur MW, Moss DS & Thornton
JM (1993) PROCHECK: a program to check the ste-
reochemical quality of protein structure. J Appl Crystal-
logr 26, 228–291.
47 Kraulis PJ (1991) MOLSCRIPT: a program to produce
both detailed and schematic plots of protein structures.
J Appl Crystallogr 24, 946–950.
48 Mettitt EA & Murphy EP (1994) Raster 3D version
2.0: a program for photorealistic molecular graphics.
Acta Crystallogr D 50, 869–873.
49 Esnouf RM (1999) Further additions to MolScript ver-
sion 1.4, including reading and contouring of electron
density maps. Acta Crystallogr D 55, 938–940.
M. Konno et al. Modeling of tRNA-assisted mechanism on ArgRS
FEBS Journal 276 (2009) 4763–4779 ª 2009 The Authors Journal compilation ª 2009 FEBS 4779