Tài liệu Báo cáo khoa học: DNA strand exchange activity of rice recombinase OsDmc1 monitored by fluorescence resonance energy transfer and the role of ATP hydrolysis pptx

DNA strand exchange activity of rice recombinase
OsDmc1 monitored by fluorescence resonance energy
transfer and the role of ATP hydrolysis
Chittela Rajanikant
1
, Manoj Kumbhakar
2
, Haridas Pal
2
, Basuthkar J. Rao
3
and Jayashree K. Sainis
1
1 Molecular Biology Division, Bhabha Atomic Research Center, Mumbai, India
2 Radiation Chemistry and Chemical Dynamics Division, Bhabha Atomic Research Center, Mumbai, India
3 Department of Biological Sciences, Tata Institute of Fundamental Research, Mumbai, India
Homologous recombination is a fundamental process
by which two DNA molecules physically interact with
each other. This process is important for repairing the
double strand breaks (DSBs) induced during mitosis,
meiosis and other stages where chromosomal break-
ages ensue. There are several sequential biochemical
Keywords
Dmc1; FRET; renaturation; rice; strand
exchange
Correspondence
J. K. Sainis, Molecular Biology Division,
Bhabha Atomic Research Centre,
Mumbai 400 085, India
Fax: +91 22 25505326
Tel : +91 22 25595079

E-mail:
(Received 18 October 2005, revised 2
February 2006, accepted 8 February 2006)
doi:10.1111/j.1742-4658.2006.05170.x
Rad51 and disrupted meiotic cDNA1 (Dmc1) are the two eukaryotic DNA
recombinases that participate in homology search and strand exchange
reactions during homologous recombination mediated DNA repair. Rad51
expresses in both mitotic and meiotic tissues whereas Dmc1 is confined to
meiosis. DNA binding and pairing activities of Oryza sativa disrupted mei-
otic cDNA1 (OsDmc1) from rice have been reported earlier. In the present
study, DNA renaturation and strand exchange activities of OsDmc1 have
been studied, in real time and without the steps of deproteinization, using
fluorescence resonance energy transfer (FRET). The extent as well as the
rate of renaturation is the highest in conditions that contain ATP, but sig-
nificantly less when ATP is replaced by slowly hydrolysable analogues of
ATP, namely adenosine 5¢-(b,c-imido) triphosphate (AMP-PNP) or adeno-
sine 5¢-O-(3-thio triphosphate) (ATP-c-S), where the former was substan-
tially poorer than the latter in facilitating the renaturation function. FRET
assay results also revealed OsDmc1 protein concentration dependent strand
exchange function, where the activity was the fastest in the presence of
ATP, whereas in the absence of a nucleotide cofactor it was several fold
( 15-fold) slower. Interestingly, strand exchange, in reactions where ATP
was replaced with AMP-PNP or ATP-c-S, was somewhat slower than that
of even minus nucleotide cofactor control. Notwithstanding the slow rates,
the reactions with no nucleotide cofactor or with ATP-analogues did reach
the same steady state level as seen in ATP reaction. FRET changes were
unaffected by the steps of deproteinization following OsDmc1 reaction,
suggesting that the assay results reflected stable events involving exchanges
of homologous DNA strands. All these results, put together, suggest that
OsDmc1 catalyses homologous renaturation as well as strand exchange

events where ATP hydrolysis seems to critically decide the rates of the reac-
tion system. These studies open up new facets of a plant recombinase func-
tion in relation to the role of ATP hydrolysis.
Abbreviations
AMP-PNP, adenosine 5¢-(b,c-imido) triphosphate; ATP-c-S, adenosine 5¢-O-(3-thio triphosphate); Dmc1, disrupted meiotic cDNA1; DS, double
stranded; DSBs, double strand breaks; FRET, fluorescence resonance energy transfer; OsDmc1, Oryza sativa disrupted meiotic cDNA1;
SS, single stranded; RecA, DNA recombinase A; RPA, replication protein A.
FEBS Journal 273 (2006) 1497–1506 ª 2006 The Authors Journal compilation ª 2006 FEBS 1497
reactions that prepare the DNA molecules for repair
via homologous recombination. These sequential reac-
tions involve identification of DSBs, processing the
broken DNA at the damage site by resecting the ends,
facilitating homology search ⁄ synapses, strand exchange
between the paired chromosomes, followed by resolu-
tion of the Holliday junction. Specific proteins required
for each of these steps have been identified mainly
from Escherichia coli and now also from yeast and
mammalian systems. The proteins implicated in
homology search and pairing activities are called
strand exchange proteins or DNA recombinases.
DNA recombinase A (RecA) from E. coli has been
extensively investigated both at the biochemical and
molecular level [1]. These studies revealed that RecA
protein binds to single strand overhangs generated as a
result of processing at the DSB site. In this presynaptic
complex, RecA protein coats single stranded DNA
(ssDNA) as a helical filament (three nucleotides per
protein monomer) resulting in stretching of DNA by
1.5 times its original length. This conformational
change in DNA is hypothesized to facilitate homology

search in the double stranded DNA (dsDNA). Once
the homologous region is found, RecA protein medi-
ates strand exchange with its duplex partner. This pro-
cess is known to require ATP. E. coli RecA is thus
shown to be a remarkable protein which alone can cat-
alyze the DNA interactions necessary for establishment
of homologous contacts, eventually leading to homo-
logous recombination mediated repair. This feature
stimulated the search for homologues of RecA in euk-
aryotes using classical biochemical techniques, which
did not yield much success. Introduction of molecular
techniques led to identification of two RecA homo-
logues, namely Rad51 and disrupted meiotic cDNA1
(Dmc1) first in yeast and later in mammals and plants.
Rad51 was found to express during mitosis as well as
meiosis, whereas Dmc1 was confined mainly to meiosis
[2]. Rad51 homologues in yeast, mouse, and humans
have been characterized at both the genetic and bio-
chemical levels [3]. The deletion of Rad51 resulted in
embryonic lethality in mice [4]. Using transposon
induced mutagenesis, Bishop et al. [5] identified DMC1
gene in Saccharomyces cereveciae, which had sequence
similarities with recA and RAD51. ScDMC1 mutants
showed defective reciprocal recombination, accumula-
tion of double strand breaks and failure to form syn-
aptonemal complexes, eventually leading to arrest of
the cells in meiotic prophase. DMC1 gene was also
detected in mouse and DMC1
– ⁄ –
mice were viable but

sterile, showing reduced reproductive organ sizes and
asynapsis or random segregation of chromosomes
[6,7]. In the case of plants, the DMC1 knockout in
Arabidopsis resulted in sterile plants and showed
asynapsis in meiosis [8].
As a sequel to identification of recA homologues in
eukaryotes, attempts were made to clone and overex-
press these genes for biochemical characterization. The
biochemical properties of Dmc1 proteins from yeast,
Coprinus and human systems have emerged recently.
Dmc1 proteins from S. cerevisiae and Coprinus cenere-
us were shown to catalyze strand assimilation of radio-
labeled oligonucleotides into homologous duplex DNA
in a reaction promoted by ATP and ATP analogues
[9,10]. Coprinus cenereus Dmc1 protein interacts homo-
typically and mediates a homology dependent strand
exchange reaction [11]. Using fluorescence resonance
energy transfer (FRET), hDmc1 was shown to catalyze
the strand exchange and strand assimilation in a
homology dependent manner [12]. Recent studies on
hDmc1 showed that it was able to mediate the strand
exchange reaction at least up to several kilobase pairs
(5.4 kb) in vitro in cooperation with a heterotrimeric
protein, namely replication protein A (RPA) [13].
Though eukaryotic RecA homologues have been
well characterized from yeast and animal model sys-
tems, the information from plants is still in its infancy.
Previously, homologues of DMC1 and RAD51 have
been reported from Lilium longiflorum [14,15], Arabid-
opsis thaliana [16,17] and Oryza sativa [18–21]. It is

important to gather biochemical information about the
proteins participating in homologous recombination
in plant systems, which are constantly under genetic
improvement programs through conventional or
induced mutation breeding or through new transgenic
manipulations. We have initiated studies on the bio-
chemical characterization of DNA recombinases from
rice. As gametophytic tissue is limited in amount and
also the expression of Oryza sativa disrupted meiotic
cDNA1 (OsDmc1) protein is temporal, we have cloned
and overexpressed OsDmc1 protein in E. coli [21]. The
overexpressed OsDmc1 protein was purified under
denaturing conditions to homogeneity and renatured
to its native state. Renatured protein exhibited all the
important functional hallmarks of a recombinase, as
described below, thereby showing it has attained its
native structure. This purified protein showed single
and double stranded DNA binding activity. Binding to
single stranded DNA stimulated a significant level
of DNA dependent ATPase activity. OsDmc1 also
showed renaturation of complementary strands as well
as assimilation of single strands into homologous
supercoiled duplexes leading to D-loop formation [22].
In the present study, we extend our efforts further and
show that OsDmc1 mediates renaturation as well as
strand exchange activities whose rates are critically
DNA strand exchange activity of OsDmc1 by FRET C. Rajanikant et al.
1498 FEBS Journal 273 (2006) 1497–1506 ª 2006 The Authors Journal compilation ª 2006 FEBS
dependent on the state of ATP hydrolysis. The results,
based on FRET assays conducted in real time, report

that stable changes are associated with homologous
strands in the native state of the reaction and involve
no protein removal steps.
Results
Strand exchange activity of several recombinases have
been investigated in vitro, typically using agarose gel
assays with radiolabeled oligonucleotides as substrates
[1,9,10,12]. Though commonly used because of its sim-
plicity, this assay has drawbacks because it involves
removal of DNA bound proteins and hence does not
score the reaction at its equilibrium state. An assay
using FRET, involving fluorophore labeled oligo-
nucleotides as substrates, is not only sensitive but also
scores the reaction without perturbing its equilibrium
state, as it involves no sample deproteinization and
can be carried out in real time. Therefore, in the pre-
sent study we have used FRET for measuring recombi-
nation activities of OsDmc1 in vitro.
Design of the assay
Two complementary oligonucleotides (Phi-W and Phi-
C, Fig. 1A), were labeled with fluorescein and rhodam-
ine at their 5¢ and 3¢ ends, respectively. The assay is
based on nonradiative fluorescence resonance energy
transfer from fluorescein (donor) to rhodamine (accep-
tor). FRET, being highly distance dependent between
donor and acceptor dyes, will therefore unveil the sta-
tus of physical union and separation of complementary
strands during renaturation and strand exchange,
respectively, and thereby assesses the recombinase
activity of OsDmc1, as has been shown for other rec-

ombinase enzymes previously [12,23]. Fluorescein and
rhodamine are a good FRET pair, where energy trans-
fer from fluorescein results in loss of its emission inten-
sity at 522 nm following excitation at 490 nm. Thus,
renaturation between Phi-W and Phi-C strands can be
assayed through FRET as the decrease in fluorescein
emission intensity at 522 nm (Fig. 1A). Conversely,
strand exchange leads to separation of these duplexed
strands resulting in an increase in the fluorescein emis-
sion intensity (Fig. 1B). In all the experiments des-
cribed below, reactions were performed where the
decrease (renaturation) or increase (strand exchange)
of fluorescein emission intensity at 522 nm is scored as
a function of reaction time. The assays are carried out
in real time, where reproducibly similar trends were
observed in duplicate sets performed together as a set
on a given day. However, the initial rates of a reaction
encompassing the first few seconds of the time course,
performed on different days, showed variation, per-
haps arising from minor differences in reaction condi-
tions. We believe that our readouts being entirely
fluorescence based were very sensitive to reaction con-
ditions, thereby leading to high confidence levels for
comparison within the sets, rather than across the sets.
Because the results within the set were highly reprodu-
cible, the differences in reaction rates were significant,
based on which, we describe below the contrasting
effects of ATP (hydrolyzing versus nonhydrolyzing
conditions) in renaturation and strand exchange reac-
tion kinetics.

Renaturation activity of OsDmc1
Renaturation was measured at a fixed concentration of
protein using Phi-C⁄ Phi-W strands tagged with fluores-
cence labels (Fig. 1A) in the presence of ATP, as a func-
tion of time (Fig. 2A). OsDmc1 was presynapsed with
Phi-C oligonucleotide, followed by the addition of com-
plementary strands (Phi-W). As expected, strand anneal-
ing led to a time dependant drop in fluorescein emission
Fig. 1. Schematic representation of the renaturation (A) and strand
exchange (B) reactions mediated by OsDmc1 protein. Phi-C and
Phi-W represent rhodamine and fluorescein carrying strands,
respectively, at their 3¢ and 5¢ ends. The assays were based on
nonradiative energy transfer from fluorescein to rhodamine when
fluorescein was excited at 490 nm, followed by measurement of
emission intensity at 522 nm, due to the two dyes being in close
proximity. Renaturation activity was measured as the decrease in
fluorescein emission intensity and strand exchange was monitored
as the increase in fluorescein emission intensity at 522 nm.
C. Rajanikant et al. DNA strand exchange activity of OsDmc1 by FRET
FEBS Journal 273 (2006) 1497–1506 ª 2006 The Authors Journal compilation ª 2006 FEBS 1499
intensity (Fig. 2). The rate of renaturation catalyzed by
OsDmc1 was rather high; within 200 s the reaction
reached steady state level (Fig. 2A, line 3). Under the
same assay conditions, a control with no protein revealed
much slower spontaneous renaturation reaction (Fig. 2A,
line 2). Even after several minutes of incubation sponta-
neous renaturation did not seem to have reached its
steady state level. The rate of OsDmc1 catalyzed renatur-
ation was much faster at higher concentration of protein
(more than 1.25 lm; data not shown). The protein to

nucleotide ratio (1 : 10–1 : 20) used in these reactions is
close to the reported optimum of ScDmc1, where each
protein molecule was observed to bind about 10–40
nucleotides for its maximum activity [9]. As expected,
another control where only the presynaptic complex (con-
taining Phi-W strand) was incubated in the absence of
Phi-C strand, showed no loss in fluorescence intensity as
a function of time (Fig. 2A, line 1), thereby revealing that
the rapid loss of fluorescence signal catalyzed by OsDmc1
(Fig. 2A, line 3) reflects genuine FRET change associated
with strand renaturation.
Homology dependence of renaturation activity
In the following experiment, we examined the homol-
ogy dependence of the renaturation reaction. FRET
efficiency was assessed as a function of different doses
of unlabeled competitor strand (homologous or
heterologous) premixed with labeled Phi-C oligonucleo-
tide, followed by renaturation for 5 min. FRET effi-
ciency of a reaction was estimated by subtracting the
fluorescence emission intensity measured after renatur-
ation (at 5 min) from the starting value (0 min). There-
fore, the measured efficiencies stem from direct
readouts of fluorescence emission. It was surmised that
the renaturation as measured by FRET is competed
specifically by the homologous unlabeled strand (it
cannot accept FRET because it lacks the label) in
a dose dependent manner, while the heterologous
unlabeled competitor will have no significant effect on
the same. FRET efficiency decreased specifically in the
presence of unlabeled homologous competitor strand

(Phi-C) as a function of its concentration (Fig. 2B, his-
togram 2 and 3). On the other hand, no significant
change in FRET efficiency was observed when unlabe-
led heterologous (M13C) strand was added to the
renaturation mixture (Fig. 2B, histograms 4 and 5). In
these sets, FRET efficiency was highly comparable to
that where no competitor was present (Fig. 2B, histo-
gram 1). This experiment revealed that OsDmc1 cata-
lyzed renaturation as measured by FRET change was
homology dependent.
Effect of ATP and its hydrolysis on renaturation
activity
We also examined the effect of ATP on renaturation
catalyzed by OsDmc1. Interestingly enough, in the
Fig. 2. (A) Time course of renaturation reaction as monitored by
decrease in fluorescein emission intensity at 522 nm expressed as
arbitrary units normalized to one. (1) Reaction containing Phi-W
oligonucleotide with 1.25 l
M of OsDmc1. (2) Reaction containing
Phi-W oligonucleotide and Phi-C oligonucleotide without OsDmc1.
(3) Reaction containing Phi-W oligonucleotide and Phi-C oligonucleo-
tide with 1.25 l
M of OsDmc1. (B) Homology dependent renatura-
tion reaction mediated by OsDmc1. Renaturation reaction of
OsDmc1 (1) without competitor; (2) with 27.5 l
M unlabeled of Phi-
C along with 27.5 l
M of rhodamine labeled Phi-C; (3) with 55.0 lM
unlabeled of Phi-C along with 27.5 lM of rhodamine labeled Phi-C;
(4) with 27.5 l

M unlabeled of M13C along with 27.5 lM of rhodam-
ine labeled Phi-C; and (5) with 55.0 l
M unlabeled of M13C along
with 27.5 l
M of rhodamine labeled Phi-C. Samples 2, 3 and 4, 5
represent renaturation reactions in the presence of homologous
and heterologous unlabeled competitors, respectively. In each reac-
tion, FRET efficiency was measured by the decrease in fluorescein
emission intensity at 522 nm following 5 min of renaturation reac-
tion. The FRET efficiencies are plotted: without any competitor (his-
togram 1); with the competitor (histograms 2–5).
DNA strand exchange activity of OsDmc1 by FRET C. Rajanikant et al.
1500 FEBS Journal 273 (2006) 1497–1506 ª 2006 The Authors Journal compilation ª 2006 FEBS
absence of ATP, OsDmc1 exhibited hardly any rena-
turation activity (Fig. 3, line 1). It is interesting to
note that under these conditions, presence of OsDmc1
seems to attenuate even spontaneous strand anneal-
ing, as evidenced by negligible annealing observed in
this experiment compared to that observed in the
absence of any protein (Fig. 2A, line 2). However,
when the reaction mixture contained slowly hydroly-
sable forms of ATP, namely adenosine 5¢-(b,c-imido)
triphosphate (AMP-PNP) or adenosine 5¢-O-(3-thio
triphosphate) (ATP-c-S), renaturation was augmented
(Fig. 3, line 2 and 3), but still fell short of that
observed in spontaneous annealing (Fig. 2A, line 2).
Moreover, the enhancement in renaturation activity
was most dramatic when ATP was added, where not
only the overall rate but also the total extent of rena-
turation by OsDmc1 was stimulated several fold

(Fig. 3, line 4). However, it is intriguing to note that
the initial rate of renaturation in the presence of
ATP-c-S was similar to that of ATP, but the reaction
rate suddenly plummeted after about 50 s of the reac-
tion. There is no simple explanation for this observa-
tion. These results demonstrated that in contrast to
ScDmc1, where renaturation was not dependent on
ATP [9], OsDmc1 protein requires not only the pres-
ence of ATP, but also perhaps its hydrolysis, for
mediating the maximum renaturation activity (see
below).
Strand exchange activity of OsDmc1
Protein concentration dependence
OsDmc1 was shown to have the ability to mediate
homology dependent D-loop formation activity [22]. In
the present study, we extended our analyses further,
and the strand exchange property of OsDmc1 was
monitored by pairing an unlabeled Phi-C single strand
with duplex oligonucleotide formed by complementary
annealing of FRET dye labeled strands (Phi-W and
Phi-C; Fig. 1B). Interestingly enough, the three stran-
ded pairing reaction exhibited OsDmc1 concentration
dependent increase in fluorescein emission intensity at
522 nm as a function of reaction time (Fig. 4A). This
was in stark contrast to the renaturation reaction,
where the emission intensity at the same wavelength
had decreased as a function of time (Figs 2 and 3).
The observed increase in fluorescein emission intensity
is consistent with strand exchange as detected by
FRET. It should be noted that no emission increase

(indicative of lack of strand exchange) was detected in
the absence of OsDmc1 protein (Fig. 4A, line 1). Inter-
estingly, the rate as well as the steady state levels of
strand exchange increased as a function of OsDmc1
protein concentration (Fig. 4A, lines 2 and 3). How-
ever, at concentrations higher than 2.5 lm OsDmc1,
there was only an increase in the rate, but no further
increase in the steady state levels of the reaction
(Fig. 4A, lines 3–6). At high enough concentrations
of protein, presumably reflecting a binding saturation,
both rate as well as the steady state level of the reac-
tion reached a maximum (Fig. 4A, lines 5 and 6); at
this condition the ratio of protein to ssDNA nucleo-
tides approached a value close to 1 : 3, implying a
binding stoichiometry similar to that reported for
other recombinase enzymes [1,9,12,23].
FRET changes versus deproteinization of
strand exchange products
In order to establish that the observed FRET changes
are related to strand exchange, as depicted in Fig. 1B,
and not due simply to the transient pairing events dur-
ing homology search, we performed the following
experiment. We inferred that because strand exchange
related changes, unlike that of transient pairing events,
are more stable to the steps of protein removal, the
observed FRET changes, if related to strand exchange,
must be stable even after deproteinization treatment.
Strand exchange was performed in the presence and
absence of OsDmc1 for 15 min, where expected FRET
changes were observed specifically in the protein con-

taining reaction (Fig. 4B, lines 2 and 3). At this point,
Fig. 3. Renaturation activity mediated by OsDmc1 protein in the
presence of ATP and slowly hydrolysable ATP analogues as monit-
ored by the decrease in fluorescein emission intensity at 522 nm
expressed as arbitrary units normalized to one. Reaction contained
fluorescein labeled Phi-W and rhodamine labeled Phi-C (1) with
1.25 l
M of OsDmc1 in absence of ATP; (2) with 1.25 lM of
OsDmc1 in presence of 2.0 m
M of AMP-PNP; (3) with 1.25 lM
of OsDmc1 in presence of 2.0 mM ATP-c-S; (4) with 1.25 lM of
OsDmc1 in presence of 2.0 m
M of ATP.
C. Rajanikant et al. DNA strand exchange activity of OsDmc1 by FRET
FEBS Journal 273 (2006) 1497–1506 ª 2006 The Authors Journal compilation ª 2006 FEBS 1501
one of the sets was treated with deproteinization steps
(shown by arrow in Fig. 4B, line 3) and the other reac-
tion set continued with OsDmc1 action (Fig. 4B, line
2). The fluorescence emission changes remained stable
to deproteinization treatment. This was evidenced by
fluorescence values that were similar in deproteinized
and nondeproteinized samples, suggesting that the
steady state changes were stable (Fig. 4B, lines 2 and
3). Under the conditions of the assay, deproteinizing
agents SDS, EDTA and proteinase K had no effect on
the emission intensity of fluorescein as evidenced by
the set where OsDmc1 was omitted in the sample
(Fig. 4B, line 1). In order to confirm that the increase
in the fluorescence signal is specific to the emission
maximum of fluorescein, the donor dye in the FRET

pair, we compared the emission spectra of the strand
exchange reaction mixture with that where OsDmc1
protein was not added (no strand exchange control).
Emission scan revealed that enhancement of emission
at 522 nm was specific and related to strand exchange
reaction conditions (Fig. 5). The results indicated that
the FRET changes, observed in real time, reflected
changes consistent with strand exchange reaction.
Effect of homology dependence and ATP
hydrolysis on strand exchange activity
Strand exchange was monitored as a function of reac-
tion time, at a fixed concentration of protein, by varying
nucleotide cofactor conditions. The reaction was the
fastest when it contained ATP, where within about
100–150 s the reaction essentially reached completion
(Fig. 6, line 2). On the other hand, when ATP was omit-
ted (no nucleotide cofactor condition) the same reaction
took about 1700 s, a drop in the reaction rate by
 15-fold (Fig. 6, line 3). Most interestingly, the pres-
ence of slowly hydrolyzing nucleotide cofactors (AMP-
PNP or ATP-c-S) appears to further slow down the
reaction as compared to that where no nucleotide cofac-
tor was added (Fig. 6, compare lines 4 and 5 with 3). As
Fig. 5. Fluorescence emission spectra of fluorescein in strand
exchange reaction mediated by OsDmc1 protein (12.5 l
M). Fluor-
escein was excited at 490 nm and emission was monitored from
500 to 550 nm. Spectrum obtained in absence of OsDmc1 protein
(1), and in presence of OsDmc1 protein (2). Fluorescein emission
intensity is expressed as arbitrary units.

Fig. 4. (A) Time course and OsDmc1 protein concentration depend-
ence of strand exchange reaction monitored by increase in fluo-
rescein emission intensity at 522 nm in arbitrary units. (1) Without
OsDmc1 protein; (2) 1.25 l
M; (3) 2.5 lM; (4) 5.0 lM; (5) 10.0 lM;
and (6) 12.5 l
M of OsDmc1 protein. (B) Effect of deproteinization
on strand exchange reaction mediated by OsDmc1. Fluorescence
was monitored at 522 nm in arbitrary units. Reaction mixture (1)
without OsDmc1 deproteinized after 15 min; (2) with 5.0 l
M
OsDmc1 protein without deproteinization; and (3) with 5.0 lM
OsDmc1 protein with deproteinization after 15 min as indicated in
figure with arrow.
DNA strand exchange activity of OsDmc1 by FRET C. Rajanikant et al.
1502 FEBS Journal 273 (2006) 1497–1506 ª 2006 The Authors Journal compilation ª 2006 FEBS
expected, when OsDmc1 was omitted or homologous
single strand oligonucleotide was replaced with non-
complementary sequence M13C as heterologous con-
trol, no increase in fluorescence intensity was observed,
re-establishing the veracity of the assay to an ongoing
homologous strand exchange activity dependent on
OsDmc1 function (Fig. 6, lines 1 and 6). The results
indicated that the strand exchange activity catalyzed by
OsDmc1 is homology dependent and is facilitated by
ATP and its hydrolysis at kinetic level.
Discussion
We have been studying the biochemistry of OsDmc1
where we have shown earlier [22] that the rice enzyme
exhibits many hallmarks typical of recombinases. In

the present study, we extend our analyses further and
show that the rice recombinase exhibits strand
exchange function and that its rates are critically ATP
hydrolysis dependent.
We have used a fluorimetric assay to monitor the
time course of renaturation and strand exchange activ-
ities of OsDmc1. The renaturation activity was found
to be stimulated in the presence of ATP and was satur-
ated at 1.25 lm of OsDmc1. In the competition assay,
renaturation activity was observed to be dependent on
the presence of homologous sequence partner in the
reaction mixture (Fig. 2). The calculated protein : nuc-
leotide ratio is 1 : 10–1 : 20, which compares well with
the reported values (1 : 10–1 : 40) for ScDmc1 [9]. In
contrast to ScDmc1, renaturation activity by OsDmc1
was more efficient in the presence of ATP, though
the slowly hydrolysable analogues of ATP partially
promoted the renaturation activity (Fig. 3). This prop-
erty appears to be more similar to RecA and Rad51,
which were shown to promote efficient renaturation
even in the absence of ATP hydrolysis [23]. However,
ATP-c-S was more efficient in promoting renaturation
when compared to AMP-PNP, consistent with the
property that the former is a little more hydrolysable
than the latter. Interestingly, it appears that protein
binding to ssDNA in the absence of any nucleotide
cofactor results in attenuation of spontaneous anneal-
ing (compare line 1, Fig. 3 with line 2, Fig. 2A); this
attenuation is undone only in the presence of nucleo-
tide cofactors where the effect by non- or slowly

hydrolysable analogues is much weaker compared to
ATP (lines 2 and 3 versus 4, Fig. 3). This result seems
to suggest that the protein binding mode ⁄ dynamics are
significantly different in these diverse conditions.
OsDmc1 was found to promote strand exchange in a
protein concentration dependent manner. The rate of
strand exchange was highest in ATP and lowest in
conditions that had either no nucleotide cofactor or
had slowly hydrolysable analogues of ATP. The rate
enhancement by the presence of ATP was in the order
of about 15-fold (Fig. 6), strongly suggesting that the
hydrolysis of ATP somehow overcomes the rate limit-
ing barriers in the reaction pathway. The FRET chan-
ges observed were indeed related to stable changes
associated with DNA in the strand exchange reaction
as they were stable to the steps of protein removal
(Fig. 4B). OsDmc1 mediated strand transfer was not
observed when homologous ssDNA oligonucleotide
was replaced with a heterologous sequence oligonucleo-
tide in the assay mixture. From this result we conclu-
ded that the OsDmc1 mediated strand exchange
reaction is homology dependent and is not related to
any contaminating helicase activity spuriously associ-
ated with the purified OsDmc1 preparation. It is rele-
vant to point out that OsDmc1 protein is somewhat
distinct as compared to either human or yeast Dmc1
proteins: while human protein requires ATP to
promote pairing and strand exchange [12] the same is
not true with either OsDmc1 (this study) or yeast
Dmc1 [9]. However, unlike yeast Dmc1 which does not

require nucleotide cofactor for renaturation activity,
OsDmc1 requires ATP hydrolysis for efficient renatur-
ation reaction. Sequence comparison between OsDmc1
and that of human and yeast proteins reveals no signi-
Fig. 6. Strand exchange reaction mediated by OsDmc1 in presence
of ATP or slowly hydrolysable ATP analogues monitored by
increase in fluorescein emission intensity at 522 nm in arbitrary
units. Reactions contained OsDmc1 (5.0 l
M) and ATP or slowly
hydrolysable ATP analogues (2.0 m
M). (1) Without OsDmc1 protein
in presence of ATP; (2) with OsDmc1 protein with ATP; (3) with
OsDmc1 protein without ATP; (4) with OsDmc1 protein with ATP-
c-S; (5) with OsDmc1 protein with AMP-PNP; and (6) with OsDmc1
protein and ATP in presence of heterologous sequence M13C oligo-
nucleotide.
C. Rajanikant et al. DNA strand exchange activity of OsDmc1 by FRET
FEBS Journal 273 (2006) 1497–1506 ª 2006 The Authors Journal compilation ª 2006 FEBS 1503
ficant changes either in ATPase or in DNA binding
domains of OsDmc1 [22]. The only discernible change
in OsDmc1 is an insertion of seven amino acid residues
at the N-terminal region, a change also observed in
Arabidopsis protein [22]. We do not know the struc-
tural consequence of such an insertion because there is
no structure available for this region due to its highly
flexible nature [24]. If the Dmc1 oligomeric protein
uses this flexible region for regulating ring to helix
transformation steps, the dynamics of the same are
likely to be different in OsDmc1 protein system
compared to that of human and yeast proteins.

Our results on renaturation and strand exchange
activities of OsDmc1 showed interesting differences in
protein requirement for optimal activity. As renatura-
tion is an inherent property of complementary strands,
it may not require complete coating of ssDNA with
OsDmc1. Therefore, a protein to nucleotide ratio of as
low as 1 : 20 promoted the complete renaturation. In
contrast, the strand exchange reaction required one
monomer of OsDmc1 for two to three nucleotides,
suggesting that strand exchange probably needs
ssDNA filament saturated with OsDmc1 whereas for
renaturation partially coated ssDNA was sufficient for
optimal activity. These results are in agreement with
the results reported for ScDmc1 [9].
Passy et al. [25] and Masson et al. [26] have demon-
strated that human Dmc1 forms octameric ring like
structures on ssDNA. Recent atomic force microscopy
studies have shown that ScDmc1 forms 90% octameric
ring-like structures as well as 10% helical filaments
upon binding to ssDNA. The helical forms were hypo-
thesized to represent the active form responsible for
recombination reactions [27]. The presence of ATP
was found to result in the formation of helical fila-
ments on ssDNA, whereas in the absence of ATP there
was a preponderance of octameric rings [13]. Recent
studies showed that Ca
2+
enhances the strand
exchange activity of human Dmc1 protein by increas-
ing the affinity of Dmc1 protein to ATP, mediated by

a conformational change [28]. In our strand exchange
assays, the presence of ATP significantly enhanced the
reaction rate of strand exchanges as compared to that
of no nucleotide control or that containing slowly
hydrolysable analogues of ATP. Put together, these
observations suggest that perhaps the ATP hydrolysis
function of the protein may be related to some critical
steps in the conversion of inactive forms of protein to
that of active forms. It is interesting and intriguing to
note that in the absence of any nucleotide cofactor,
OsDmc1 leads to a slow process of strand exchange
essentially going to completion (line 3, Fig. 6), but
under the same conditions, the renaturation reaction is
strongly suppressed (line 1, Fig. 3) even as compared
to that of spontaneous annealing (line 2, Fig. 2A). The
results are best rationalized by invoking better binding
of protein to ssDNA compared to dsDNA under these
conditions, thereby leading to suppression of ssDNA
renaturation, as two interacting protein–ssDNA com-
plexes are unlikely to pair. Conversely, the protein–
ssDNA complex might facilitate ATP independent,
kinetically slow steps of pairing and exchange with rel-
atively naked duplex DNA. Fine structural studies are
required on OsDmc1 to explain the structure–function
relationship of the recombinase from rice. It will fur-
ther enhance our understanding of the homologous
recombination and DNA repair in plant systems. It is
relevant to point out that the real time assay employed
here enabled us to distinguish the kinetic differences in
ATP containing reaction sets versus those containing

no nucleotide control or slowly hydrolysable analogues
of ATP. The assays that simply measure the steady
state levels of products formed after several minutes of
the reaction will fail to detect these important changes,
which sometimes contribute to conflicting results on
strand exchange versus nucleotide cofactor effects.
Nevertheless, the kinetic assay described here is a sim-
ple and generally applicable one that will be used in
our future studies to understand the mechanistic
details of OsDmc1 function compared to ATP hydro-
lysis rates as well as OsDmc1 changes in the presence
of its functional interactors.
Experimental procedures
Materials
Oligonucleotides (55-mers) for strand exchange assay were
synthesized by Metabion (Martinsreid, Germany) with the
following sequences: PhiC: 5¢-CGATACGCTCAAAGTCA
AAATAATCAGCGTGACATTCAGAAGGGTAATAAG
AACG-3¢;, PhiW: 5¢-CGTTCTTATTACCCTTCTGAA
TGTCACGCTGATTATTTTGACTTTGAGCGTATCG-3¢
and M13C: 5¢-CTACAACGCCTGTAGCATTCCACAGA
CAGCCCTCATAGTTAGCGTAACGAGATCG-3¢. Phi-C
and Phi-W were complementary to each other. Phi-C was
labeled with rhodamine at the 3¢ end and Phi-W was labe-
led with fluorescein at the 5¢ end. M13C was used as the
heterologous strand in the strand exchange assay.
cDNA for OsDmc1 protein was obtained from rice anthers
by RT-PCR and was cloned previously in pET28a, intro-
duced into E. coli BL21(DE3) expression cells. Protein was
overexpressed by 1.0 mm isopropyl thio-b-d-galactoside [21].

The OsDmc1 was purified and stored at )20 °C as described
previously [22]. ATP, AMP-PNP and ATP-c-S were pur-
chased form Sigma Chemical Company (St Louis, MO,
DNA strand exchange activity of OsDmc1 by FRET C. Rajanikant et al.
1504 FEBS Journal 273 (2006) 1497–1506 ª 2006 The Authors Journal compilation ª 2006 FEBS
USA). Duplex oligonucleotide was prepared by mixing equal
amounts of rhodamine labeled Phi-C and fluorescein labeled
Phi-W followed by thermal denaturation at 92 °C for
10 min. The mixture was subjected to a slow renaturation
step by bringing the temperature to 25 °C over a period of
2 h [29].
Renaturation assay
The renaturation activity was carried out according to
Gupta et al. [23] with the following modifications. A
reaction mixture (100 lL) containing 20 mm HEPES
(pH 7.9), 2 mm ATP, 10.0 mm MgCl
2
, 3.0% (w ⁄ v) glycerol,
1.0 mm dithiothreitol and 1.25 lm of OsDmc1 was preincu-
bated at 37 °C for 5 min with Phi-C oligonucleotide
(27.5 lm of nucleotides) labeled with rhodamine at the 3¢
end. Complementary oligonucleotide Phi-W (27.5 lm of
nucleotides) labeled with fluorescein at the 5¢ end was added,
and the decrease in fluorescein emission intensity as a result
of FRET was measured at 522 nm after excitation at 490 nm
using a F-4010 Hitachi fluorescence spectrophotometer
(Hitachi Ltd, Tokyo, Japan). The decrease in fluorescence
emission intensity of fluorescein at 522 nm after excitation at
490 nm was measured at 20 s intervals for 15 min. ATP was
omitted or replaced with 2.0 mm AMP-PNP or ATP-c-S in

some assays as mentioned in figure legends.
To show that the observed renaturation activity was
homology dependent, we carried out the following compet-
itive FRET assay. In the standard renaturation assay,
oligonucleotide Phi-W (27.5 lm of nucleotides) labeled with
fluorescein at the 5¢ end was preincubated with 1.25 lm of
OsDmc1 at 37 °C for 5 min. Phi-C oligonucleotide
(27.5 lm of nucleotides) labeled with rhodamine at the 3¢
end was premixed with either unlabelled Phi-C as homolog-
ous competitor (0, 27.5, 55.0 lm of nucleotides) or unla-
belled M13C as heterologous competitor (27.5, 55.0 lm),
followed by its addition to the reaction mixture. The extent
of homologous versus heterologous competition in FRET
was monitored by the decrease in the fluorescein emission
intensity at 522 nm after 5 min. FRET efficiencies were cal-
culated by subtracting the fluorescence value obtained at
5 min from that of 0 min. Therefore the measured efficien-
cies stem from direct readouts of fluorescence emission.
Strand exchange assay
Strand exchange activity was monitored essentially accord-
ing to the procedure mentioned by Gupta et al. [12]. A
reaction mixture (100 lL) containing 20 mm HEPES
(pH 7.9), 2 mm ATP, 10.0 mm MgCl
2
, 3.0% (w ⁄ v) gly-
cerol, 1.0 mm dithiothreitol and different concentration of
OsDmc1 was preincubated with unlabeled Phi-C oligo-
nucleotide (27.5 l m of nucleotides) for 5 min at 37 °C.
Duplex 55-mer made from fluorescein labeled Phi-W and
rhodamine labeled Phi-C was added (27.5 lm of nucleo-

tides) as homologous duplex. Increase in fluorescence
emission intensity of fluorescein at 522 nm after excitation
at 490 nm was measured at 20 s intervals for the first
15 min and at 1 min intervals for the next 15 min due to
the loss of FRET as a result of strand exchange. Oligonu-
cleotide M13C was used as heterologous control in strand
exchange assay. ATP was omitted or replaced with
2.0 mm AMP-PNP or ATP-c-S in some assays as men-
tioned in figure legends.
Effect of deproteinazation on strand exchange
activity
To check whether the strand exchange activity of OsDmc1
is due to complete strand exchange or is due to transient
pairing events leading to partial local separation of strands,
unlabeled Phi-C oligonucleotide (27.5 lm of nucleotides)
was preincubated with 5.0 lm of OsDmc1 protein for
5 min at 37 °C followed by the addition duplex 55-mer
made from fluorescein labeled Phi-W and rhodamine labe-
led Phi-C. Increase in the fluorescence was measured at
522 nm for 15 min. The same reaction mixture was subse-
quently deproteinized with 20 mm EDTA, 1.0% SDS and
100 lgÆmL
)1
of freshly prepared proteinase K. Fluorescence
emission was measured for a further 15 min.
Acknowledgements
We would like to acknowledge Dr S.K. Apte and Dr
A.S. Bhagwat, Molecular Biology Division, BARC,
Mumbai, India for critical reviewing of this manu-
script.

References
1 Kowalczykowski SC, Dixon DA, Eggleston AK,
Lauder SD & Rehrauer WM (1994) Biochemistry of
homologous recombination E. coli. Microbiol Rev 58,
401–465.
2 Masson JY & West SC (2001) The Rad51 and Dmc1
recombinases: a non-identical twin relationship. Trends
Biochem Sci 26, 131–136.
3 Sung P, Krejci L, Van Komen S & Sehorn MG (2003)
Rad51 recombinase and recombination mediators.
J Biol Chem 278, 42729–42732.
4 Tsuzuki T, Fujii Y, Sakumi K, Tominaga Y, Nakao K,
Sekiguchi M, Matsushiro A, Yoshimura Y & Morita T
(1996) Targeted disruption of the Rad51 gene leads to
lethality in embryonic mice. Proc Natl Acad Sci USA
93, 6236–6240.
5 Bishop DK, Park D, Xu L & Kleckner N (1992)
DMC1: a meiosis-specific yeast homolog of E. coli recA
required for recombination, synaptonemal complex for-
mation, and cell cycle progression. Cell 69, 439–456.
C. Rajanikant et al. DNA strand exchange activity of OsDmc1 by FRET
FEBS Journal 273 (2006) 1497–1506 ª 2006 The Authors Journal compilation ª 2006 FEBS 1505
6 Yoshida K, Kondoh G, Matsuda Y, Habu T, Nishi-
mune Y & Morita T (1998) The mouse RecA-like gene
Dmc1 is required for homologous chromosome synopsis
during meiosis. Mol Cell 1, 707–718.
7 Pittman DL, Cobb J, Schimenti KJ, Wilson LA, Cooper
DM, Brignull E, Handel MA & Schimenti JC (1998)
Meiotic prophase arrest with failure of chromosome
synapsis in mice deficient for Dmc1, a germline-specific

RecA homolog. Mol Cell 1, 697–705.
8 Couteau F, Belzile F, Horlow C, Grandjean O, Vezon
D & Doutriaux MP (1999) Random chromosome
segregation without meiotic arrest in both male and
female meiocytes of a dmc1 mutant of Arabidopsis.
Plant Cell 11, 1623–1634.
9 Hong EL, Shinohara A & Bishop DK (2001) Saccharo-
myces cerevisiae Dmc1 protein promotes renaturation of
single-strand DNA (ssDNA) and assimilation of ssDNA
into homologous super-coiled duplex DNA. J Biol
Chem 276, 41906–41912.
10 Nara T, Hamada F, Namekawa S & Sakaguchi K (2001)
Strand exchange reaction in vitro and DNA-dependent
ATPase activity of recombinant LIM15 ⁄ DMC1 and
RAD51 proteins from Coprinus cinereus. Biochem
Biophys Res Commun 285, 92–97.
11 Nara T, Yamamoto T & Sakaguchi K (2000) Characteri-
zation of interaction of C- and N-terminal domains in
LIM15 ⁄ DMC1 and RAD51 from a basidiomycetes,
Coprinus cinereus. Biochem Biophys Res Commun 275,
97–102.
12 Gupta RC, Golub E, Bi B & Radding CM (2001) The
synaptic activity of HsDmc1, a human recombination
protein specific to meiosis. Proc Natl Acad Sci USA 98,
8433–8439.
13 Sehorn MG, Sigurdsson S, Bussen W, Unger VM &
Sung P (2004) Human meiotic recombinase Dmc1 pro-
motes ATP-dependent homologous DNA strand
exchange. Nature 429, 433–437.
14 Kobayashi T, Hotta Y & Tabata S (1993) Isolation and

characterization of a yeast gene that is homologous with
a meiosis specific cDNA from a plant. Mol Gen Genet
237, 225–232.
15 Kobayashi T, Kobayashi E, Sato S, Hotta Y, Miyajima
N, Tanaka A & Tabata S (1994) Characterization of
cDNAs induced in meiotic prophase in lily microsporo-
cytes. DNA Res 1, 15–26.
16 Sato S, Hotta Y & Tabata S (1995) Structural analysis
of a recA-like gene in the genome of Arabidopsis thali-
ana. DNA Res 2, 89–93.
17 Doutriaux MP, Couteau F, Bergounioux C & White C
(1998) Isolation and characterisation of the RAD51 and
DMC1 homologues from Arabidopsis thaliana. Mol Gen
Genet 257, 283–291.
18 Shimazu JC, Matsukura M, Senda R, Ishikawa S,
Akada T, Harada T & Niizeki M (2001) Characteriza-
tion of a DMC1 homologue, RiLIM15, in meiotic pani-
cles, mitotic cultured cells and mature leaves of rice
(Oryza sativa L.). Theor Appl Genet 102, 1159–1163.
19 Ding Z, Wang T, Chong K & Bai S (2001) Isolation
and characterization of OsDMC1, the rice homologue
of the yeast DMC1 gene essential for meiosis. Sex Plant
Reprod 13, 285–288.
20 Kathiresan A, Khush GS & Bennett J (2002) Two rice
DMC1 genes are differentially expressed during meiosis
and during haploid and diploid mitosis. Sex Plant
Reprod 14, 257–267.
21 Metkar SS, Sainis JK & Mahajan SK (2004) Cloning
and characterization of the DMC1 genes in Oryza
sativa. Curr Sci 87, 353–357.

22 Kant CR, Rao BJ & Sainis JK (2005) DNA binding
and pairing activity of OsDmc1, a recombinase from
rice. Plant Mol Biol 57, 1–11.
23 Gupta RC, Bazemore LR, Golub EI & Radding CM
(1997) Activities of human recombination protein
Rad51. Proc Natl Acad Sci USA 94, 463–468.
24 Kinebuchi T, Kagawa W, Enomoto R, Tanaka K,
Miyagawa K, Shibata T, Kurumizaka H & Yokoyama
S (2004) Structural basis for octameric ring formation
and DNA interaction of the human homologous-pairing
protein Dmc1. Mol Cell 14, 363–374.
25 Passy SI, Yu X, Li Z, Radding CM, Masson JY, West
SC & Egelman EH (1999) Human Dmc1 protein binds
DNA as octameric ring. Proc Natl Acad Sci USA 96,
10684–10688.
26 Masson JY, Davies AA, Hajibagheri N, Van Dyck E,
Benson FE, Stasiak AZ, Stasiak A & West SC (1999)
The meiosis-specific recombinase hDmc1 forms ring
structures and interacts with hRad51. EMBO J 18,
6552–6560.
27 Chang Lo YH, Lee MH, Leng CH, Hu SM, Chang CS
& Wang TF (2005) Molecular Visualization of the Yeast
Dmc1 Protein Ring and Dmc1-sDNA Nucleoprotein
Complex. Biochemistry 44, 6052–6058.
28 Bugreev DV, Golub EI, Stasiak AZ, Stasiak A & Mazin
AV (2005) Activation of human meiosis-specific recom-
binase Dmc1 by Ca
2+
. J Biol Chem 280, 26886–26895.
29 Rao BJ, Chiu SK & Radding CM (1993) Homologous

recognition and triplex formation promoted by RecA
protein between duplex oligonucleotides and single-
stranded DNA. J Mol Biol 229, 328–343.
DNA strand exchange activity of OsDmc1 by FRET C. Rajanikant et al.
1506 FEBS Journal 273 (2006) 1497–1506 ª 2006 The Authors Journal compilation ª 2006 FEBS