Tài liệu Báo cáo khoa học: Inhibition of pea ferredoxin–NADP(H) reductase by Zn-ferrocyanide docx

Inhibition of pea ferredoxin–NADP(H) reductase by Zn-ferrocyanide
Daniela L. Catalano Dupuy, Daniela V. Rial and Eduardo A. Ceccarelli
Molecular Biology Division, IBR (Instituto de Biologı
´
a Molecular y Celular de Rosario), Consejo Nacional de Investigaciones
Cientı
´
ficas y Te
´
cnicas, Facultad de Ciencias Bioquı
´
micas y Farmace
´
uticas, Universidad Nacional de Rosario, Argentina
Ferredoxin–NADP(H) reductases (FNRs) represent a pro-
totype of enzymes involved in numerous metabolic path-
ways. We found that pea FNR ferricyanide d iaphorase
activity was inhibited by Zn
2+
(K
i
1.57 l
M
). Dichloro-
phenolindophenol diaphorase activity w as also inhib ited by
Zn
2+
(K
i
1.80 l
M

), but the addition of ferrocyanide was
required, indicating that the inhibitor is an arrangement of
both ions. Escherichia coli FNR was also inhibited b y
Zn-ferrocyanide, suggesting that inhibition is a consequence
of common s tructural features o f these fl avoenzymes. The
inhibitor behaves in a noncompetitive manner for NADPH
and f or artificial electron acceptors. Analysis of the oxida-
tion state of the flavin during catalysis in the presence of the
inhibitor suggests that the electron-transfer process between
NADPH and the flavin is not significantly altered, and that
the transfer between the flavin and the second substrate is
mainly affected. Zn-ferrocyanide interacts with the reduc-
tase, probably i ncreasing the acce ssibility of the prosthetic
group to the solvent. Ferredo xin reduction was a lso inhib-
ited by Zn-ferrocyanide in a no ncompetitive manner, bu t the
observed K
i
was about nine times h igher t han t hose f or the
diaphorase reactions. The electron transfer to Anabaena
flavodoxin was not affected b y Zn-ferrocyanide. Binding of
the apoflavodoxin to the reductase was sufficient to over-
come the inhibition by Zn-ferrocyanide, suggesting that the
interaction of FNRs with their proteinaceous electron
partners may induce a conformational change in the
reductase that alters or completely prevents the inhibitory
effect.
Keywords: ferredoxin; ferredoxin–NADP(H) reductase;
flavodoxin; flavoproteins; zinc.
Ferredoxin–NADP(H) reductases (FNRs) constitute a
family of hydrophilic and monomeric enzymes that c ontain

noncovanlently bound FAD [1,2]. One of the exceptional
features of FNR is i ts ability to split electrons between
obligatory one-electron a nd two -electron carriers, as a
consequence of the biochemical properties of its prosthetic
group. Flavoproteins with FNR activity have been found in
phototrophic and heterotrophic bacteria, animal and yeast
mitochondria, and apicoplasts of obligate intracellular
parasites. They oper ate as general electronic switches a t
the bifurcation steps of many different electron-transfer
pathways (for review see References [ 1–3]).
In chloroplasts, they catalyze the final step of photosyn-
thetic electron transport, which involves electron transfer
from the iron-sulfur protein ferredoxin (Fd), reduced by
photosystem I, to NADP
+
. At the molecular level, the
reaction proceeds to the reduction of NADP
+
via hydride
transfer from the N5 atom of the flavin prosthetic group.
This reaction provides the NADPH necessary for CO
2
assimilation in plants and cyanobacteria.
Some bacteria and algae possess an FMN-containing
protein, flavodoxin (Fld), which is able to e fficiently replace
Fd as the electron partner of FNR in different metabolic
processes, including photosynthesis. Fld expression is
induced under conditions of iron deficit, when the [2Fe-
2S] cluster of Fd cannot be assembled [4–6].
FNR displays a strong preference for NADP(H) and is a

very poorNAD(H) oxidoreductas e. At variance, the r educed
flavin can donate electrons to a r emarkable variety of
oxidants of very different structure and properties through a
largely irreversible r eaction n amed ÔNADPH diaphoraseÕ [7].
The list of acceptors includes ferricyanide and other
transition metal complexes, substituted phenols such
as 2,6-dichlorophenolindophenol (DCPIP), nitroderivatives,
tetrazolium salts, NAD
+
(transhydrogenase activity), vio-
logens, quinones, and cytochromes (reviewed in [8]). Some
of these artificial reactions may have technological relevance
for bioremediation and the pharmaceutical industry [9,10].
Plant FNRs (% 35 kDa) comprise two structural
domains, each containing % 150 amino acids [11]. The
C-terminal region includes most of the residues i nvolved in
NADP(H) b inding, and the large cleft between the two
domains accommodates the FAD group. A large portion of
the isoalloxazine moiety i s shielded from t he bulk s olution,
but the edge of the dimethyl benzyl ring that participates in
electron transfer remains exposed to solvent in the native
holoenzyme.
The structural determinants involved in the electron-
transfer process, substrate recognition, and the likely
Correspondence to E. A. Ceccarelli, IBR, Facultad de Ciencias Bio-
quı
´
micas y Farmace
´
uticas, Universidad Nacional de Rosario, Suipa-

cha 531 (S2002LRK) Rosario, Argentina. Fax: +54 341 4390465,
Tel.: +54 341 4351235, E-mail:
Abbreviations: FNR, ferredoxin–NADP(H) reductase; Fd, ferredoxin;
Fld, flavodoxin; DCPIP, 2,6-dichlorophenolindophenol; FPR,
Escherichia coli FNR; GST, glutathione S-transferase; DNT,
2,4-dinitrotoluene.
(Received 1 3 August 2004, revised 6 October 2004,
accepted 11 October 2004)
Eur. J. Biochem. 271, 4582–4593 (2004) Ó FEBS 2004 doi:10.1111/j.1432-1033.2004.04430.x
catalytic mechanism h ave been inte nsely a nalysed a nd
debated but aspects of the subject remain to be revealed.
Here, we report the use of Zn
2+
, in conjunction with
ferrocyanide, as a specific inhibitor to analyze the catalytic
process and electron transfer in p ea FNR. Zn
2+
has
catalytic, cocatalytic, and/or structural roles in a myriad of
metalloenzymes [12]. In addition, it inhibits some enzymes
that are not necessarily zinc ones [13–19]. Until now, no
metal-binding site of high affinity has been identified in
FNRs even thou gh there is some evidence of metal-binding
sites in FNR-like enzymes (e.g. NO s ynthase) [13,20], other
flavoproteins [14,15,21,22] and a number of different
enzymes [18,19,23,24]. Our results may also have some
environmental significance in the light of the enormous
amount of metal cyanides released as industrial waste and
recent evidence of ferrocyanide transport by plants [25].
FNRs can efficiently interact with and accommodate two

completely different protein p artners, i.e. Fd a nd Fld.
Contacts between Fd and FNR occur through ionic
interactions including acidic and basic residues present in
each protein, respectively. These interactions determine the
initial relative orientation between both proteins, which is
finally tuned for electron exchange [3,26,27]. We f ound that
pea FNR diaphorase activities were inhibited in a n oncom-
petitive manner by Zn
2+
when equimolar concentrations of
this metal and ferrocyanide were present. Escherichia coli
FNR ( FPR) behaves similarly to the pea enzyme with
respect to the inhibitor. In c ontrast, to obtain a compara ble
inhibition of the Fd reduction catalyzed by pea FNR, $9
times higher inhibitor concentration is needed. We observed
that Fld from Anabaena is able to accept electrons from
pea FNR, a nd that this reaction was not affected by
Zn-ferrocyanide. Moreover, the addition of apoFld was
sufficient to avoid enzyme inhibition by Zn-ferrocyanide,
indicating that a conformational c hange is probably
produced in the reductase upon binding of Fld. In addition,
our data show that electron transfer from the reduced flavin
to an oxidant can be inhibited without affecting the electron
transfer between the NADPH a nd the prosthetic group.
These r esults provide insights into enzyme catalysis and are
discussed in the light of current knowledge.
Experimental procedures
Protein expression and purification
Pea FNR, Y308 [28] and C266 FNR mutants were
overexpressed in E. coli as reported [28] using vector

pGF205+ [29]. Vector pGF205+ [29] was obtained by
inserting an adapter formed from oligonucleotides 1
(TTGGTTCCGCGTGGATCCCGAGCT) and 2 (AGTT
CCAGTTCCCAACATGATGATGACAGTAGC) at the
SacI s ite of plasmid pGF105 [30]. The insertion generates a
fusion protein GST-FNR+ containing the amino acid
sequence LVPRGSRA, which includes a thrombin recog-
nition site between the C-terminus of glutathione
S-transferase (GST) and the first amino a cid of the mature
FNR. Purification of pea FNR from E. coli JM109 was
carried out as described [30], except that the gel-filtration
step was replaced by anion-exchange chromatography usin g
a DEAE Macroprep column (1.5 · 15 cm; Bio-Rad,
Hercules, CA, USA) equilibrated in 50 m
M
Tris/HCl,
pH 8 (buffer A). The resin was e xtensively washed with
the same buffer, and FNR eluted using a linear gradient
from 0 to 0.3
M
NaCl in buffer A. T he fractions containing
theenzymeweredialyzedagainst50m
M
Tris/HCl, pH 8,
and concentrated on a D EAE M acroprep column
(1 · 3 cm, equilibrated in 50 m
M
Tris/HCl) e luted with
250 m
M

NaCl in buffer A.
Recombinant pea Fd was obtained by expression in
E. coli. B riefly, a pET28-Fd expression vector was con-
structed by inserting the cDNA corresponding to the
mature pea Fd i nto the pET28a vector (Novagen Inc.,
Madison, WI, USA). The coding sequence for the mature
Fd was amplified by PCR u sing as primers the oligonucle-
otides Fdup 5 ¢-GCAACACCATGGCTTCTTACAAAG
TGAAA-3¢ and Fdlw 5¢-CCACAAGCTTGATATCATA
TCATAGCATAGCAGT-3¢ and the full length p ea Fd
precursor cDNA as template. To facilitate the cloning
process, NcoIandHindIII restriction sites were introduced
in primers Fdup and Fdlw, respectively. After amplification,
the product was digested with NcoIandHindIII, and the
fragment (%350 bp) was ligated t o the pET28a vector
digested with the same enzymes, obtaining the plasmid
pET28-Fd. This vector allows the expression of pea Fd i n
E. coli as a soluble protein with high yield. Fd purification
was performed essentially as described [31].
The E. coli Fd-NADP
+
reductase was purified according
to published procedures [32].
Fld from Anabaena was k indly provided by M. Medina
(University of Zaragoza, Zaragoza, Spain). ApoFld from
Anabaena Fld was obtained by treatment with trichloro-
acetic acid [33].
Spectral analyses
Absorption spectra were recorded on a Shimadzu UV-2450
spectrophotometer. To study the inh ibition by Zn-ferro-

cyanide of the flavin reduction, the FNR samples were
dilutedin50m
M
HEPES, pH 7.5 (at 25 °C) to a final
concentration of % 20 l
M
. Absorption spectra were recor-
ded both before and after the addition o f 2.5 m
M
NADPH
(donor electron substrate), in either the absence or p resence
of 20 l
M
Zn-ferrocyanide. This procedure was also carried
out with 1 m
M
potassium ferricyanide (electron acceptor
substrate) in the solution.
Protein and flavin fluorescence was monitored using a
Kontron SFM 25A spectrofluorimeter (Zu
¨
rich, Switzer-
land) interfaced with a personal computer. Solution for
fluorescence measurements contained % 1 l
M
protein in
50 m
M
HEPES, pH 8. Assays were performed in either
the absence or pr esence of 15 l

M
Zn-ferrocyanide, at
25 °C.
Activity measurements
FNR-dependent diaphorase activity was determined by a
published method [34]. The reaction mixture (1 mL)
contained 50 m
M
HEPES, pH 7.5, 3 m
M
glucose 6-phos-
phate, 0.3 m
M
NADP
+
, 1 U glucose-6-phosphate dehy-
drogenase, and e ither 1 m
M
potassium ferricyanide or
0.033 m
M
DCPIP. After the addition of % 20 n
M
pea FNR
(or 150 n
M
E. coli FPR), reactions were monitored spec-
trophotometrically by following ferricyanide reduction at
Ó FEBS 2004 Inhibition of FNR by Zn-ferrocyanide (Eur. J. Biochem. 271) 4583
420 nm (e

420
¼ 1m
M
)1
Æcm
)1
) or DCPIP reduction at
600 nm (e
600
¼ 21 m
M
)1
Æcm
)1
).
Ferredoxin reductase activity of FNR was assayed
in reaction medium (0.5 mL) containing 50 m
M
HEPES,
pH 7.5, 0.3 m
M
NADPH and 25 l
M
Fd. After addition
of % 75 n
M
FNR, the reaction was monitored spectro-
photometrically by following the decrease in A
340
(e

340
¼
6.22 m
M
)1
Æcm
)1
). Diff erent FNR and Fd concentrations
were tested to ensure linearity of the reaction.
Fld-dependent oxidase activity of FNR was determined
using Ana baena Fld. The r eaction mixture (0.6 mL)
contained 50 m
M
HEPES, pH 7.5, 0.25 m
M
NADPH,
12.5 l
M
Fld and 100 n
M
FNR. The reaction was monitored
by following NADPH oxidation at 340 nm. This activity
was also assayed in the presence of 0.25 m
M
2,4-dinitro-
toluene (DNT). All kinetic experiments were performed at
30 °C.
Inhibition assays
Inhibition studies were performed by adding equimolar
quantities o f ZnSO

4
and pot assium ferrocyanide (0–20 l
M
)
to the reaction medium, except for the f erricyanide diapho-
rase re actions, in w h ich only ZnSO
4
was added. The
inhibition reversibility was studied by adding 1 m
M
EDTA,
pH 8.0, to the reaction medium.
The inhibition by Zn-ferrocyanide of d ifferent FNR
variants was studied by assaying ferricyanide diaphorase
activity in the absence and presence of 5 l
M
ZnSO
4
in the
reaction medium after the addition of FNR as follows: wild-
type, 0.021 l
M
; Y308G, 0.27 l
M
; Y308F, 0.026 l
M
; Y308S,
0.10 l
M
; Y308W, 0.06 l

M
; or C266A, 0.12 l
M
. The data
obtained are presented as the percentage of the r emaining
activity observed in the presence of Zn-ferrocyanide in each
case.
Determination of kinetic parameters
To determine the kinetic parameters of the diaphorase and
Fd reduction reactions, measurements were carried out at
different NADPH, potassium ferricyanide, DCPIP or Fd
concentrations, at a fixed saturating concentration of the
other substrate, in both the absence and presence of
inhibitor (0, 1.5, 3 a nd 5 l
M
Zn-ferrocyanide). Steady-state
kinetic data were fitted to the t heoretical curves using
SIGMAPLOT
software (Jandel Scientific, San Rafael, CA,
USA). Inhibition constants ( K
i
) for the different substrates
were determined by Dixon plots of 1/v plotted against
inhibitor concentration (0, 1.5, 3 and 5 l
M
), at different
concentrations of NADPH (5, 10, 25, 50, 100 and 300 l
M
),
DCPIP (5, 10, 15, 25, 35 and 50 l

M
), ferricyanide (100, 250,
500, 750 and 1000 l
M
) and Fd (10, 15, 25, 40 and 50 l
M
).
Determination of the dissociation constants of the
FNRÆNADP
+
, FNRÆFd and FNRÆFld complexes
To determine the K
d
values of the c omplexes between FNR
and NADP
+
or Fd, 0.6 l
M
flavoprotein in 50 m
M
HEPES,
pH 8, was titrated at 25 °C with the corresponding
substrate. After each addition, the flavin fluorescence
(excitation at 456 nm; emission at 526 nm in the case of
NADP
+
) o r t he flavoprotein fluorescence quen ching
(excitation at 270 nm; e mission at 340 nm for the FNRÆFd
complex) were monitored using a Kontron SFM 25A
spectrofluorimeter. The fluorescence data were fitted to a

theoretical e quation as described in [35] for a 1 : 1 complex
using t he nonlinear regression program included in the
SIGMAPLOT
software package (Jandel Scientific) t o optimize
the value of K
d
[36]. The effect of Zn-ferrocyanide on the
K
d
values of these complexes was also determined.
The experimental setup was as above, except that 15 l
M
Zn-ferrocyanide was included in the solution.
Difference absorption spectroscopy was used to evaluate
the dissociation constant of the FNRÆFld complex [37]. The
experiment was performed essentially as described [37] on a
solution containing 6.55 l
M
FNR in 50 m
M
HEPES, pH 8,
at room temperature, to which aliquots of Anabaena Fld
were added. The absorbance differences (DA)at465nm
were registered and fitted to the theoretical equation [38]:
DA ¼ 0:5Defð½P
t
þ½L
t
þ K
d

Þ À ðð½P
t
þ½L
t
þ K
d
Þ
2
À 4½P
t
½L
t
Þ
0:5
g
for a 1 : 1 c omplex using a nonlinear regression, where [P]
t
and [L]
t
are the total concentration o f FNR and Fld,
respectively, and, De the molar abso rtivity of the complex
[37]. T his procedure does n ot require the determination of
the titration endpoint [38].
Protection against inhibition by Fld
The inhibition of DCPIP diaphorase activity was assayed in
the presence of Fld, apoFld or Fld p reviously treated with
1 : 100 (w/w) trypsin (15 h, at 24 °C). After the addition of
% 20 n
M
FNR, the reaction was monitored spectrophoto-

metrically by following DCPIP reduction at 600 nm. The
inhibition protection profile was made in the presence of
20 l
M
Zn-ferrocyanide and varying either Fld or apoFld
concentrations (0–8 l
M
).
Inactivation of FNR by Zn-ferrocyanide
The DCPIP diaphorase activity of FNR was assayed using
FNR samples previously treated with 3 l
M
Zn-ferrocyanide
during different periods of time (0–80 min).
Results
Inhibition of FNR activities by Zn-ferrocyanide
TheeffectofthepresenceofZn
2+
during FNR c atalysis is
shown in Fig. 1A. Ferricyanide diaphorase activity was
inhibited by the addition of increasing concentrations of
ZnSO
4
,withanI
0.5
, the concentration that produces 50%
inhibition, of about 1 l
M
Zn
2+

. In contrast, no e ffect was
observed by Zn
2+
addition on the DCPIP diaphorase
activity (Fig. 1A). NADPH oxidation catalyzed by FNR in
the presence of Fd or F ld was not affected by the presence of
up to 1 m
M
ZnSO
4
.
The effect of equimolar concentrations of Zn
2+
and
ferrocyanide on diaphorase activities with different sub-
strates and Fd reduction were then investigated. In all cases,
the addition of metal ion and ferrocyanide to the reaction
medium produced strong enzyme inhibition (Fig. 1B).
4584 D. L. Catalano Dupuy et al.(Eur. J. Biochem. 271) Ó FEBS 2004
Zn-ferrocyanide w as about six times more effective a t
inhibiting diaphorase a ctivities t han Fd reduction. However,
in all c ases total inhibition was obtained. At pH 7.5, a 50%
inhibition was observed for the ferricyanide diaphorase
activity with % 1 l
M
Zn
2+
, meanwhile 6 l
M
Zn-ferrocyanide

was necessary to obtain the same inhibition of the Fd
reduction. Likewise, when the FPR from E. coli was
investigated, inhibition of diaphorase activity was obtained
with Zn-ferrocyanide (Fig. 1C). Neither FNR nor FPR
activity was inhibited by sodium sulfate or ferrocyanide alone
using D CPIP or ferricyanide as electron acceptors. Similarly,
no enzyme inhibition was d etected using ferrous sulfate.
Co
2+
, whic h is able to replace Zn
2+
in metaloenz ymes,
also inhibited the diaphorase reaction of pea FNR only if
ferrocyanide was added with a I
0.5
of 25 l
M
.Cu
2+
and
Ni
2+
were also tested, and no inhibition was observed up to
100 l
M
for the ferricyanide diaphorase activity using any of
the m etals on pea reductase. Higher concentrations h ad
some effect on the pea enzyme, but, in all cases, much lower
inhibition was observed (not shown). I n all cases, the
addition of 1 m

M
EDTA final concentration after 2 min
of r eaction reversed the enzyme inhibitio n instantly and
completely (not shown). This observation suggests that the
Zn-ferrocyanide is accessible to the solvent. Incubation of
the enzyme with Zn-ferrocyanide f or longer periods of time
resulted in inactivation of % 57% in 60 min without the
release of the prosthetic group (not shown).
To evaluate this inhibitor in more detail, the steady-state
kinetics of th e F NR for the different s ubstrates were
examined at pH 7.5. Plots for the inhibitions of FNR
diaphorase a ctivities with i ncreasing concentration o f
Zn-ferrocyanide (range 0–5 l
M
of inhibitor) showed that
Fig. 1. In hibition of FNR activities by Zn-fer-
rocyanide. Resi dual FNR activity as a func-
tion of ZnSO
4
concentration (A) or ZnSO
4
and potassium ferrocyanide equimolar con-
centrations (B) using ferricyanide (d), DCPIP
(s) and f erredoxin (m) as electron acceptors.
(C) Inhibition of ferricyanide (d)and
DCPIP (s) diaphorase activities of E. coli
FPR as a function of Zn -ferrocyanide con-
centration. In all cases, activity measurements
were performed at pH 7.5. (D) A typical
steady-state kinetics experiment o f the FNR

diaphorase activity for different D CPIP con-
centrations at a fixed NADPH concentration
of 300 l
M
, performed at increasing concen-
trations of inhibitor [0 (s), 1.5 (d), 3 (m)and
5(j) l
M
]. Inset: a typical K
i
determination by
Dixonplotof1/v (B) vs. inhibitor concentra-
tion(A)atdifferentDCPIPconcentrations.
Table 1. Kinetic, inhibition a nd binding parame ters for va ri ous activities of FNR. The k inetics parameters were determined as d escribe in E xperi-
mental procedures. Each parameter value represents the average of three independent experiments. K
i
values were calculated from Dixon plots of
Zn-ferrocyanide n oncompetitive inhibition with r espect to the indicated substrate at a fixed saturating concentration of the other substrate. ND,
Not determined.
Substrate
K
m
(l
M
)
(no inhibitor)
k
cat
(s
)1

)
(no inhibitor) K
i
(l
M
)
K
d
(l
M
, NADP
+
)
(no inhibitor)
K
d
(l
M
, NADP
+
)
(15 l
M
Zn-ferrocyanide) Type of inhibition
NADPH
a
19.7 ± 2.3 302.3 ± 7.8 1.16 ± 0.1 31.6 ± 2.3 33.0 ± 2.3 Noncompetitive
Ferricyanide
b
106.0 ± 15.9 321.0 ± 11.86 1.57 ± 0.1 ND ND Noncompetitive

DCPIP
c
43.3 ± 4.9 87.8 ± 4.3 1.8 ± 0.2 ND ND Noncompetitive
Ferredoxin
d
42.1 ± 12.0 3.3 ± 0.4 13.8 ± 0.9 1.1 ± 0.1 1.4 ± 0.1 Noncompetitive
a,b
NADPH-ferricyanide diaphorase activity.
c
NADPH-DCPIP diaphorase activity.
d
NADPH-Fd reduction.
Ó FEBS 2004 Inhibition of FNR by Zn-ferrocyanide (Eur. J. Biochem. 271) 4585
the compound was a noncompetitive inhibitor of the
enzyme for NADPH and ferricyanide. Similar results were
obtained when DCPIP diaphorase activity and Fd reduc-
tion were analysed for the substrates DCPIP and Fd,
respectively (Table 1). In all cases a linear noncompetitive
inhibition was observed, indicating that the inhibitor
binding to the enzyme p roduces a nonproductive enzyme–
substrate–inhibitor c omplex. D ixon plots were used t o
calculate the K
i
values (Table 1), which were consistent with
the I
0,5
values extracted from Fig. 1. Calculation of enzyme
activity at infinitive inhibitor concentration showed that
total inhibition was obtained in all cases.
The dissociation constants of t he FNRÆNADP

+
and
FNRÆFd comp lexes were estimated in the absence or
presence of 15 l
M
inhibitor by m easuring flavin fluores-
cence and flavoprotein fluorescence quenching, respectively,
after addition of each substrate. As shown in Table 1, the
presence of the inhibitor d id not change the enzyme affinity
for its substrates. This is in agreement with the inhibition
kinetic data presented above.
Zn-ferrocyanide inhibition of the reduction and oxidation
of the flavin
We have analyzed the spectral properties o f FNR, and no
differences were observed on addition of Zn-ferrocyanide
(Fig. 2A, compare thick and thin solid lines). Then, w e
studied the spectral changes of the enzyme by addition of an
excess amount of NADPH. The oxidation state o f flavins
can be distinguished by spectrophotometric means. They
can exist in three different redox states: oxidized, one-
electron reduced (semiquinone) radical, and fully reduced
hydroquinone. The isolated FNR in solution contains
mostly oxidized FAD. The neutral flavin radical absorbs
light of long wavelength with a maximum at 570 nm, which
is only detectable in FNR when the enzyme is anaerobically
reduced. In aerobic conditions, when 2.5 m
M
NADPH was
added to the enzyme solution and the spectral changes were
recorded after 5 s, a decrease in absorbance was observed at

459 nm with a concomitant increase with a maximum at
% 590 nm. Similar results were obtained when reduction of
theenzymebyNADPHwasperformedinthepresenceof
Zn-ferrocyanide (Fig. 2A, thick and thin dashed lines).
These results indicate that, i n both cases under a erobic
conditions and with an excess of NADPH, the neutral
semiquinone of FAD appeared, with its typical a bsorption
band which usually expands from 520 to 680 nm.
The same experiment was then performed in the presence
of the e lectron a cceptor potassium ferricyanide in the
absence of the inhibitor, recording the spectral changes 5 s
after the addition of the substrates. Under these conditions,
the enzyme c ontaining a r educed flavin f orm was spectro-
photometrically undetectable (Fig. 2B). The addition of
20 l
M
Zn-ferrocyanide in the reaction medium from the
beginning of the measurement leads to the appearance of
the reduced form of the enzyme, even in the presence of
the electron acceptor (Fig. 2B). These results allow us to
conclude that the electron-transfer process between
NADPH and the flavin was not sign ificantly altered by
the presence of the inhibitor, and disrupting the electron
transfer between the flavin and the second substrate mainly
causes enzyme inhibition by Zn-ferrocyanide.
Effect of Fld on the inhibition of FNR activities
by Zn-ferrocyanide
In some photosynthetic systems, such as that of certain
algae and cyanobacteria, the FMN-co ntaining protein Fld
Fig. 2. Reduction and oxidation of the flavin. Optical spectra of FNR

FAD reduction, 5 s after mixing, measured as the decrease in
absorbance at 459 nm, and the increase at 550 nm to 650 nm range.
All r eactions were performed under aerobic conditions an d contain
50 m
M
HEPES, pH 7 .5, 20 l
M
FNR and the following additions. (A)
In the absence of an electron acceptor: thick solid line, no addition;
thick dashed line, 2.5 m
M
NADPH; thin solid line, 20 l
M
Zn-ferro-
cyanide; thin dashed line, 20 l
M
Zn-ferrocyanide and 2.5 m
M
NADPH. (B) In the presence of an electron acceptor: thick solid line,
no addition; thick dotted line, 1 m
M
potassium ferricyanide; thick
dashed line, 1 m
M
potassium ferricyanide and 2.5 m
M
NADPH; thin
solid line, 20 l
M
Zn-ferrocyanide; th in d otted line, 20 l

M
Zn-ferro-
cyanide and 1 m
M
potassium ferricyanide; thin dashed line, 20 l
M
Zn-ferrocyanide, 1 m
M
potassium ferricyanide and 2.5 m
M
NADPH.
Insets: amplified view of the region between 500 and 700 nm of the
corresponding figures.
4586 D. L. Catalano Dupuy et al.(Eur. J. Biochem. 271) Ó FEBS 2004
can efficiently replace Fd in the protein–protein electron-
transfer process catalyzed by FNR. Fld and Fd bind to the
same FNR site for catalysis, and, despite t he difference in
size, they seem to be equally oriented during binding to
FNR and electron transfer [27]. A lthough there is no Fld in
plants, Fld is able to efficiently accept electrons from plant
FNR ([39] and this work).
Surprisingly, Zn-ferrocyanide was unable to inhibit the
electron transfer from NADPH to Fld catalyzed by pea
FNR. We tested concentrations up to 20 l
M
Zn-ferro-
cyanide without any apparent loss of enzyme activity.
NADPH oxidation by FNR using Fld as electron
acceptor proceeds at a low r ate. This rate can be e nhanced
by the addition of the electron acceptor DNT. The

interpretation of this observation is that Fld mediates the
electron transfer between the reductase and DNT, as FNRs
catalyze the reduction of DNT very slowly. This system can
be used to better estimate the e lectron-transfer rate between
the reductase and the Fld. Flavodoxin oxidase activity both
in the absence and presence of DNT as artificial electron
acceptor was insensitive to the addition of the metal
ferrocyanide (Fig. 3A). Addition of Fld at saturating
concentrations produced an increase of about 100% in the
NADPH oxidation (Fig. 3A), which was not obtained
by the addition of apoFld (not shown). Interestingly,
Zn-ferrocyanide did not inhibit the reduction of DNT
mediated by Fld, bu t completely prevented th e direct
transfer to DNT (Fig. 3A).
We also investigated the oxidase activity of FNR in the
absence o f add ed electron acceptors and, unexpecte dly we
found that it was completely insensitive to Zn-ferrocyanide
(v ¼ 0.28 lmolÆmg
)1
Æmin
)1
in the presence of 15 l
M
Zn-ferrocyanide vs v ¼ 0.2 9 lmolÆmg
)1
Æmin
)1
in the
absence of the inhibitor) (Fig. 3A).
We then decided to investigate if Fld protects FNR

against Zn-ferrocyanide inhibition. When the F NR DCPIP
diaphorase activity was measured in the presence of 20 l
M
Zn-ferrocyanide and 12.5 l
M
Fld, no inhibition was
observed (Fig. 3A,B). Under identical conditions, the reduc-
tion of DCPIP was inhibited % 98% by Zn-ferrocyanide.
Two possible explanations for the unexpected protection
displayed can be envisaged. Fld may bypass the pathway
that is inhibited by Zn-ferrocyanide, transferring the
electron to DCPIP or, the binding of the carrier protein to
the FNR directly affects the interaction of the inhibitor with
the enzyme. As shown in Fig. 3B the apoprotein protects
FNR against Zn-ferrocyanide inhibition. As a control, a
sample containing Fld previously treated with trypsin did
not display any protection (Fig. 3B), indicating that the
effect was a result of the presence of the polypeptide itself.
Figure 4 shows a protection assay of the inhibition by Zn-
ferrocyanide of the DCPIP diaphorase activity at different
Fld concentrations. It can be observed that flavoprotein and
its apoform displayed similar abilities to protect the enzyme.
Moreover, the protection profile obtain ed can be correlated
with the affinity of the FNRÆFld complex (13.4 l
M
)as
obtained from the binding experiment depicted in Fig. 5.
Interaction of Zn-ferrocyanide with the FNR reductase
To furth er investigate the interaction of Zn-ferrocyanide
with FNR, the prosthetic group environment w as analyzed

by fluorescence spectroscopy. Figure 6 shows t hat
Zn-ferrocyanide interacts with the enzyme in the absence
of its substrates. Addition of the metal complex ind uces an
increase in FAD fluorescence with a concomitant shift of
emission maximum to a lower wavelength resembling the
one obtained with FAD in solution. This observation can be
considered to indicate that the prosthetic group undergoes a
Fig. 3. In hibition by Zn -ferroc yani de in the presence of Fld. (A) The
inhibition of fl avodoxin oxidase a ctivity was assayed in a DNT i nde-
pendent or dependent manner. The inhibition of DCPIP diaphorase
activity was measured in the absence or presence of 12.5 l
M
Fld. Pure
oxidase and DNT oxidase activities of FNR were assayed as controls.
Activity was measured i n the ab senc e (hatche d bars) or p resence (so lid
bars) of Zn-ferrocyanide. Reactions were monitored by following
NADPH oxidation at 340 nm. (B) The inhibition of DCPIP diapho-
rase activity was measured in the absence or presence of 12.5 l
M
Fld,
apoFld, or F ld digested with trypsin. DCPIP reduction was followed at
600 nm.
Ó FEBS 2004 Inhibition of FNR by Zn-ferrocyanide (Eur. J. Biochem. 271) 4587
rearrangement or that its exposure to the environment is
increased.
A putative Zn
2+
-binding site within the FNR structure
The crystal structure of pea FNR (PDB entry 1QG0 [40]),
was analyzed searching for structures that could be a ble to

bind Zn
2+
. All residues potentially able to co-ordinate
Zn
2+
were ide ntified, and distances and geometries within
the surrounding residues were determined using the SWISS-
PDBVIEWER 3.7. The FAD was also took into account in
the analysis because it has long been known that flavins
interact specifically with metals [41,42]. We found a serine, a
glutamic acid, a cysteine and a tyrosine residue near the
isoalloxazine in a spatial orientation suitable for the
interaction with metals (Fig. 7A). We also observed that
the space available to accommodate Zn
2+
is enough for
appropriate binding of the metal ion, which remains
accessible from the exterior (Fig. 7B). Distances between
the N5 and O4 of the flavin, O of Ser90, S of Cys266, O of
Glu306 and O of Tyr308 indicate that almost all of them are
at bond distances between each other and nearly o riented
correctly to participate in Z n
2+
co-ordination (Fig. 7C).
This amino acid a rrangement around FAD is conserved in
FPR and in the neuronal NO synthase (Fig. 7D,E).
To obtain supporting evidence for the proposed b inding
site and to investigate the participation of the a bove amino
acids, several FNR mutants were a nalyzed. Table 2 shows
the FNR inhibition by Zn-ferrocyanide obtained under

identical experimental conditions with FNR mutants of
Cys266 or Tyr308. Cysteine i s one of the amino acids most
commonly observed after histidine as a Zn
2+
ligand in
metalloproteins [12]. However, Cys266 does not appear to
have a central role in the interaction with Zn-ferrocyanid e as
its replacement by alanine generates an enzyme t hat is still
affected by the inhibitor (Table 2). Similarly, replacing
Tyr308 with other aromatic amino acids only slightly affects
the inhibition by Zn-ferrocyanide on the enzyme. In
contrast, replacing Tyr308 with glycine or serine consider-
ably reduced the inhibition. Table 2 also shows the degree
of nicotinamide ring occupancy of the binding site of Tyr
mutants, as calculated by Piubelli et al. [ 43]. We found an
inverse correlation between the extent of Zn
2+
inhibition
and nicotinamide ring o ccupancy in the FNR v ariants.
These observations indicate that the binding of NADP
+
to
the enzyme either reduces the accessibility of the isoallox-
azine itself to Zn
2+
and/or ferrocyanide or partially impairs
the entry of the inhibitor to the proposed b inding site.
Although a binding site for ferrocyanide, an octahedral
Fig. 4. Protection of DCPIP diaphorase activity by Fld. DCPIP
diaphorase a ctivity was assayed in the presence of 20 l

M
Zn-ferrocy-
anide and different concentrations of either Anabaena Fld (solid bars)
or apoFld (hatched bars).
Fig. 5. Determination of the dissociation constant of FNRÆFld complex.
(A) Difference absorption spectra obtained during the titration of pea
FNR (6.55 l
M
)withAnabaena Fld. (B) Absorbance difference data at
465 n m fitted to the theoretical equation for a 1 : 1 stoichiometric
complex by means of nonlinear regression. The K
d
value obtained was
13.4 l
M
.
4588 D. L. Catalano Dupuy et al.(Eur. J. Biochem. 271) Ó FEBS 2004
complex anion with a diameter of about 6 A
˚
, has never been
mapped within the structure of FNR, it could b e possible
that this anion collides with the Zn
2+
-containing protein
structure, interacting strongly and filling the open space
near the isoalloxazine.
Discussion
The data presented in this work clearly show that the pea
Fd-NADP(H) reductase is inhibited by Zn-ferrocyanide as
a result of a specific combined interaction of both i ons with

the enzyme. The inhibition was also observed on t he E. coli
enzyme, a member of the same protein family, e ven though
FPR is structurally distanced from the plant flavoprotein
[44]. I nhibition by Zn
2+
has b een r eported for other flavin-
containing en zymes. Cu
2+
and Z n
2+
inhibit all NADPH-
dependent reactions catalyzed by the neuronal NO synthase
[13]. The authors of this work have concluded that
inhibition is produced by th e interaction of the metal with
a unique site present in t he reductase domain of the enzyme
[13]. This domain binds one equivalent of FMN and one of
FAD and, members of t he Fd–NADP(H) reductase family
share its structural features [45]. Similarly, it has been
observed that Zn
2+
inhibits the isolated a-oxoglutarate
dehydrogenase mitochondrial complex [14]. A more de-
tailed study has shown that the dihydrolipoyl dehydro-
genase component of the complex is responsible for the
observed Zn
2+
inhibition [15]. T his enzyme is a homo-
dimeric molecule which contains FAD and belongs to the
NAD-disulphide oxidoreductases class I group, which is led
by the glutathione reductase as the model protein [46]. The

latter group does not contain either the well-defined
conserved sequences or displayed sequence similarity with
the chloroplast-type FNRs. Taken together, these results
may support the idea that the flavin itself may be involved in
the interaction of the flavoproteins with the metal.
The kinetic analysis of all FNR activities inhibited by
Zn-ferrocyanide r evealed noncompetitive behavior for
NADPH, for a rtificial electron acceptors and, for Fd. The
FAD fluorescence of FNR showed a slight increase due to
the addition of the inhibitor ( 10–15%), together with a shift
of the maximum emission wavelength to 526 nm, closer to
that of the free flavin. These rather small perturbations
could be caused by changes in the microenvironment of the
isoalloxazine ring, which is probably more exposed to the
solvent after binding of the metal ferrocyanide. Changes
may also be produced by the interaction of the m etal itself
with the isoalloxazine. However, the effect was only
observed when Zn
2+
and ferrocyanide were added, indica-
ting that the combination of the two ions, a nd not each one
separately, was responsible for the observed change.
Another hypothesis to explain the observed inhibition
proposes that Zn
2+
and ferrocyanide interact directly with
the prosthetic group and/or with amino acid residues
involved in the electron-transfer process. S earching for
structures that may be able to bind Zn
2+

on the crystal
structure of FNR, we found a serine, a glutamic acid, a
cysteine, and a tyrosine residue near the isoalloxazine in a
spatial orientation suitable for the interaction with metals
(Fig. 7 A), although n o definite sites were identified. It was
also observed that t he space available to a ccommodate
Zn
2+
is enough for appropriate binding of the metal ion.
Interestingly, these amino acids are conserved in FPR and in
the neuronal NO synthase ( Fig. 7D,E). The residue homo-
logous to FNR Tyr308 is a Phe in the NO synthase.
Consequently, it may be suggested that Tyr308 may not be
directly involved in the Zn-ferrocyanide inhibition of the
reductase. Cysteine, histidine and glutamic acid are com-
mon Zn
2+
ligands in metalloproteins [12]. Although serine
and tyrosine are less common Zn
2+
ligands, they can
interact with ions such as Zn
2+
especially in proteins with
more than one metal center such as alkaline phosphatase
from E. coli [47].
We suggest that a p artially or totally co-o rdinated Zn
2+
interacting with the bulky ferrocyanide, which can also
interact with other amino acids, represents the true inhib-

itor. T he binding of ferricyanide and ferrocyanide has been
detected in some enzymes [48,49]. Moreover, this interaction
was proposed to occur v ia positively charged amino acids
[49]. Indeed, the solubility of salts is a consequence of a large
energy gain during hydration of ions that is surplus to the
lattice energy. At the concentration of Zn-ferrocyanide used
(0–30 l
M
), the salt is soluble but near its solubility product.
Thus, a small change in the availability of water, as would
occur with the inclusion of both ions in a protein
hydrophobic pocket, may i nduce a stable ionic interaction
between Zn
2+
and ferrocyanide. We are not able to give an
explanation for the participation of ferrocyanide as an
obligate partner in the interaction of Zn
2+
with the enzyme.
However, it may be suggested that binding of ferrocyanide,
an octahedral complex a nion with a diameter of about 6 A
˚
,
throughout the interaction with the bound Zn
2+
near the
isoalloxazine could produce the observed inhibitory effect
on FNR activity. This hypothesis i s also s upported by the
finding that mutants with a catalytic site greatly occupied by
the NADP

+
nicotinamide displayed a reduced susceptibility
to Zn-ferrocyanide inhibition (Table 2). It is worth men-
tioning that the c rystal structures of these m utants have
Fig. 6. Interaction o f Zn-ferrocyanide with FNR. Fluorescence emis-
sion spectra of FNR (k
exc.
¼ 459 nm) in the absence (thick solid line)
or presence of 15 l
M
Zn-ferrocyanide (thin solid line). Fluorescence
emission of free FAD (th in dashed line).
Ó FEBS 2004 Inhibition of FNR by Zn-ferrocyanide (Eur. J. Biochem. 271) 4589
been obtained and that the overall conformations are
equivalent to those of wild-type spinach and pea leaf FNRs,
with no significant changes in the relative orientation of
amino acids, t he FAD o r the conformation and binding of
the 2¢-P-AMP portion of NADP
+
[40].
It has been observed that A -type monoamine oxidase
is inhibited by the zinc benzoate salt [16]. Similarly,
a-chymotryp sin may be inhibited by a substrate analog
that interacts w ith a Zn
2+
ion t hat is partially co-ordinated
at the active site [17].
The K
i
for the inhibition of Fd reduction is 8.8 times

higher than those f or diaphorase activity inhibition
(Table 1). T hese results may be explained by the observa-
tion that binding of Fd to FNR leads to structural changes
in the reductase. After complex formation, the entire
NADP(H) domain is displaced sligh tly as a single unit,
and Glu306, which is located n ear the isoalloxazine, moves
to within hydrogen-bonding distance of the hydroxy group
of Ser90, as observed by Kurisu et al. [ 50] i n c rystals o f the
Table 2. Inhibition of wild-type and mutant FNR diaphorase activity by
Zn-ferrocyanide. ND, N ot determined.
FNR variant
Remaining activity
(% of control)
a
Nicotinamide
ring occupancy of
the binding site (%)
b
WT 1.8 14
C266A 15.0 ND
Y308S 79.5 100
Y308G 41.0 84
Y308F 23.2 85
Y308W 5.9 40
a
Remaining ferricyanide diaphorase activity in the presence of
5 l
M
Zn-ferrocyanide with respect to the control.
b

Taken from Ref
[43], calculated from the absorption coefficients at the peak near
510 nm of the difference spectra elicited by nicotinamide nucleotide
binding to the various pea FNR forms; 100% refers to NADP
+
occupancy of FNR-Y308S.
Fig. 7. Puta tive Zn
2+
-binding site in FNR-like enzymes. Detail view of the spatial distribution o f residues putatively involved in the interaction with
Zn
2+
in (A) pea FNR, (D) E. c oli FPR and (E) rat neuronal NO synthase. Nitrogen 5 (N5) and oxygen 4 (O4) from FAD isoalloxazine are
indicated. (B) Ribbon diagram of the putative Zn
2+
-binding site in pea FNR. (C) Distances between the atoms of pea FNR probably involved in
the interaction with Zn
2+
were measured in A
˚
. The schemes were drawn using
SWISS
-
PDBVIEWER
3.7 and rendered with
POV
-
RAY
from the
tridimensional structures as determined by X-ray diffraction (Protein Data Bank entries 1QG0, 1FDR, 1TLL) [40].
4590 D. L. Catalano Dupuy et al.(Eur. J. Biochem. 271) Ó FEBS 2004

FNRÆFd complex from maize. This glutamic acid is
sufficiently exposed and r eadily available for the i nteraction
with Zn
2+
(Fig. 7A,B). In the Anabaena FdÆFNR crystal-
lographic association resolved by Morales et al.[26]the
carboxy group of the homologous Glu301 is no more
exposed to solvent but is hydrogen-bonded to the hydroxy
group of Fd Ser64.
The role o f these re sidues has b een thoroughly i nves-
tigated by site-directed mutagenesis. When the homo log
Glu301 from Anabaena FNR was mutated to Ala, the
altered enzyme obtained was only 1% as active as the
wild-typeenzymeinelectrontransfertoFd[51].As
the photoreduction of NADP
+
was not affected to the
same degree as the Fd reduction, the authors suggested
that the r ate-determining step during c atalysis involves
other p rocesses in addition to the electron-transfer process
between the two prosthetic groups [51]. The semiquinone
state o f FAD was significantly destabilized in the FNR
mutant in which G lu301 was changed to Ala, and this was
probably the main reason for the electron-transfer alter-
ation observed in this mutant. Similarly, four different
spinach FNR m utants of the equivalent Glu312 were
obtained and analyzed [52]. The authors concluded that
this residue is directly involved in the electron transfer
between FNR and Fd. T hey also hypoth esized that the
residue may c ontribute to the tuning of the redox potential

of the flavin semiquinone to enhance efficient electron
transfer and/or may be acting as a proto n donor/acceptor
to FAD [51,52].
The O of Ser90 and the S of Cys266 of pea FNR are close
to N5 and O4 of the isoalloxazine, which are involved in
hydride transfer. The hydroxy group of Ser90 could accept a
hydrogen bond and thus help to stabilize the reduced flavin.
Meanwhile its interaction probably affects the transition
state of hydride transfer. The Ser96Val mutant of FNR
displayed a k
cat
nearly 2000 times lower than that of the
wild-type enzyme [53]. Analysis of the crystal structure of
wild-type pea FNR shows that the Zn
2+
ion can easily
access Ser90. Moreover, serine is among the amino acids
that could, although infrequently, co-ordinate Zn
2+
[12].
Thus, it may be one of the amino acid residues involved i n
the inhibition of FNR by Zn-ferrocyanide.
Our results (Fig. 2) allow us to suggest that Zn-ferro-
cyanide mainly causes an i nterruption of the oxid ative half
reaction in the diaphorase activity and the electron transfer
between FNR
red
and Fd. It has been observed that
electrophilic metal ions such as Zn
2+

prefer co-ordination
with the one-electron reduced semiquinone state of flavin
[42]. Thus, Zn-ferrocyanide may interact after reduction of
the enzyme by NADPH with the semiquinone state of the
flavoprotein, producing the observed inactive form or
altering the proton e xchange between the flavin a nd the
surrounding amino acid residues, in particular Glu306 and
Ser90. Both residues have been proposed to participate in
the proton-transfer pathway between the exterior and
isoalloxazine [26,45,51–55].
It is interesting that Zn-ferrocyanide was unable to inhibit
the electron t ransfer from NADPH to Fld catalyzed by pea
FNR. At present, no crystal structures of the complex
between FNR and Fld have been obtained. Using several
charge-reversal mutants, it has been possible to infer that
FNR uses the same site for the interaction with both
electron partners, Fd and Fld [27]. Moreover, it has been
shown that Fd and Fld could be completely overlapped on
the basis of their surface electrostatic potentials [56], but the
interaction with Fld has been proposed to involve a larger
FNR surface [57]. Although the interaction of FNR with its
substrates exhibits co-operativity [58,59], modifications of
the structure that should lead to the observed effects have
remained elusive or hard to detect [11,40,60].
Changes i n hydrophobic p atches of Anabaena FNR
influenced the rates of electron transfer to and from Fld and
Fd. However, the observed effects were more dramatic in
the processes involving Fld than those involving Fd,
suggesting that these Anabaena FNR residues do not
participate to the same extent in the processes for the two

proteins [61]. Recently, electron transfer was obtained with
the hybrid system bovine adrenodoxin reductase/Anabaena
Fld, indicating that a highly specific interaction is not
essential and that the process may proceed through multiple
weak interactions. So f ar no residue on the Fld surface has
been identified to b e c ritical for the interaction and the
electron-transfer processes between Fld and FNR [62]. It
has t herefore been suggested that there is a lower specificity
for the FNR–Fld interaction than for the FNR–Fd one [62].
Therefore a dynamic assembly of the former complex in
which multiple orientations may exist can be proposed. The
fact that Zn-ferrocyanide was unable to inhibit the pea
FNR electron transfer to Fld may not only be related to the
protein size o r a specific residue but also to the m echanisms
of interaction between the reductase and Fld. The very short
distance predicted b etween the two redox centers [62] may
also account for our observations.
On the other hand, interaction of FNR with Fd does lead
to structural changes in both electron carriers relative to the
free protein c onformations [26,50]. The protein–protein
interaction also affects the microenvironments of the two
prosthetic groups. In the case of the Fd and FNR, their
redox poten tials (E
m
) w ere shifted by )25 mV and
+20 m V, respectively, reflecting theses changes [63].
We have observed that both F ld and its apoprotein are
able to impede the inhibition of FNR by Zn-ferrocyanide.
More remark able, the solely polypeptide interaction
between FNR a nd apoFld is su fficient to p revent the

inhibition, indicating that no participation of the Fld
electronic transfer is involved in the observed protection.
In addition, we observed that t he Fld c oncentration needed
to protect FNR from Zn-ferrocyanide inhibition is similar
to the K
d
for the pea FNRÆFld complex (13.4 l
M
). It is
worth mentioning that it ha s been determined that the
structure of apoFld is virtually equivalent to that of the
holoprotein, the only exception being that the isoalloxazine-
binding site closed [64].
In summary, our results indicate that determinants on the
FNR polypeptide are essential for electron transfer between
the reduced flavin and the substrate and, that this process
can be c ompletely inhibited by Zn
2+
in the p resence of
ferrocyanide. We have ob tained evidence that isoalloxazine
and t he surrounding amino acids are the binding site of the
inhibitor. Clearly, the observation that binding of Fld or
apoFld to the reductase was sufficient to overcome the
inhibition may be taken as evidence for a conformational
change produced in the reductase on interaction with this
electron partner, modifying either the FAD environment or
Ó FEBS 2004 Inhibition of FNR by Zn-ferrocyanide (Eur. J. Biochem. 271) 4591
the amino acids involved in the electron-transfer process.
These findings are significant for understanding the changes
in the reductase on binding of Fd and Fld that were not

detected by other approaches and should help in further
studies of the enzyme.
Acknowledgements
E.A.C. is a staff member of t he Cons ejo Nacional de Investigaciones
Cientı
´
ficas y Te
´
cnicas (CONICET, Argentina). D.L.C.D. a nd D.V.R.
are fellows of the same institution. This study was supported by grants
from CONICET and Agen cia de Promocio
´
nCientı
´
ficayTecnolo
´
gica
(ANPCyT, Argentina). We thank Dr M. Medin a (University of
Zaragoza, Spain) for the g ift of flavodoxin from An abaena,andMatı
´
as
Musumeci for providing the C266A FNR m utant.
References
1. Carrillo, N. & Ceccarelli, E.A. (2003) Open questions in ferre-
doxin-NADP+ reductase catalytic mechanism. Eur. J. Biochem.
270, 1900–1915.
2. Ceccarelli, E.A., Arakaki, A.K., Cortez, N. & Carrillo, N. (2004)
Functional plasticity and catalytic efficiency in plant and bacterial
ferredoxin-NADP (H ) reductases. Biochim. Biophys. Acta 1698,
155–165.

3. Hurley, J.K., Morales, R., Martinez-Julvez, M., Brodie, T.B.,
Medina, M., Gomez-Moreno, C. & Tollin, G. (2002) Structure-
function relationships in Anabaena ferredoxin/ferredoxin:
NADP(+) reductase electron transfer: insights from site-directed
mutagenesis, t ransient absorption spectroscopy a nd X-ray crys-
tallography. Biochim. Biophys. Acta 1554, 5–21.
4. Fillat, M.F., Sandmann, G. & G omez-Moreno, C. (1988) Flavo-
doxin from the nitrogen-fi xing cyanobacterium Anabaena PCC
7119. Arch. Microbiol. 150, 160–164.
5. Razquin, P., Fillat, M.F., Schmitz, S ., Stricker, O., Bohme, H.,
Gomez-Moreno, C. & Peleato, M.L. (1996) Expression of ferre-
doxin-NADP+ reductase in heterocysts from Anabaena sp. Bio-
chem. J. 316 (1), 157–160.
6. Ragsdale, S.W. & Ljungdahl, L.G. (1984) Characterization of
ferredoxin, flavodoxin, and rubredoxin from Clostridium for-
micoaceticum grown in media with high and low iron contents.
J. Bacteriol. 157,1–6.
7. Avron, M. & Jagendorf, A.T. (1956) A TPNH diaphorase from
chloroplast. Arch. Biochem. Biophys. 65, 475–490.
8. Carrillo, N. & Vallejos, R.H. (1987) Ferredoxin-NADP
+
oxido-
reductase. In Topics in Photosynthesis (Barber, J., ed.), pp. 527–
560. Elsevier, Amsterdam, New York, Oxford.
9. Shah , M.M. & Spain, J.C. (1996) Elimination of nitrite from the
explosive 2,4,6-trinitrophenylmethylnitramine (tetryl) catalyzed by
ferredoxin NADP oxidoreductase from spinac h. Biochem. Bio-
phys. Res. Commun. 220, 563–568.
10.Kranendonk,M.,Commandeur,J.N.,Laires,A.,Rueff,J.&
Vermeulen, N.P. (1997) Characterization of enzyme activities and

cofactors involved in bioactivation and bioinactivation of chemi-
cal carcinogens in the tester strains Escherichia coli K1 2 MX100
and Salmonella typhimurium LT2 TA100. Mutagenesis 12, 245–
254.
11. Bruns, C.M. & Karplus, P.A. (1995) Refined crystal structure of
spinach f erredo xin reductase at 1.7 A resolution: oxidized, reduced
and 2¢-phospho -5¢-AMP bound states. J. Mol. Biol. 247, 125–145.
12. McCall, K.A., Huang, C. & Fierke, C.A. (2000) Function and
mechanism of z in c metalloenzyme s. J. Nutr. 130, 1437S–1446S.
13. Perry, J.M., Zhao, Y . & Marletta, M.A. (2000) Cu
2+
and Z n
2+
inhibit nitric-oxide synthase through an interaction with the
reductase domain. J. Biol. Chem. 275, 14070–14076.
14. Brown , A.M., Kristal, B .S., Effron, M.S., Shestopalov, A.I.,
Ullucci, P.A., Sheu, K.F., Blass,J.P.&Cooper,A.J.(2000)Zn
2+
inhibits alpha-ketoglutarate-stimulated mitochondrial respiration
and the isolated alpha-ketoglutarate dehydrogenase complex.
J. Biol. Chem. 275, 13441–13447.
15. Gazaryan, I.G., Krasnikov, B.F., Ashby, G.A., Thorneley, R.N.,
Kristal, B.S. & B rown, A.M. (2002) Zinc is a potent inhibitor of
thiol oxidoreductase activity and stimulates reactive oxygen spe-
cies production by lipoamide dehydrogenase. J. Biol. C hem. 277,
10064–10072.
16. Egashira, T ., Sakai, K., T akayama, F., Sakurai, M. & Yoshida, S.
(2003) Zinc benzoate, a contaminating environmental compound
derived from polystyrene resin inhibits A-type monoamine oxi-
dase. Toxicol. Lett. 145, 161–165.

17. Han, M.S., Oh, D.J. & Kim, D.H. (2004) Inhibition of alpha-
chymotrypsin with th iol-bearing substrate analogues in the p re-
sence of zinc ion. Bioorg. Med. Chem. Lett. 14, 701–705.
18. Maret, W., Jacob, C., Vallee, B.L. & Fischer, E.H. (1999)
Inhibitory sites in enzymes: zinc removal and reactivation by
thionein. Proc. N atl Acad. Sci. USA 96, 1936–1940.
19. Maret, W., Yetman, C.A. & Jiang, L. (2001) Enzyme regulation
by reversible zinc inhibition: glycero l phosphate dehydro genase as
an example. Chem. Biol. Interact. 130–132, 891–901.
20. Luna, C.M., Casano, L.M. & Trippi, V.S. (2000) Inhibition of
wheat nitrate reductase a ctivity by zinc. B iol. Plant. 43 , 257–262.
21. Egash ira, T., Takayama, F . & Sakai, K. (2003) Inhibition by Zn
(2+) of A-form monoamine oxidase in monkey brain mitochon-
dria. J. Pharmacol. Sci. 91, 239–245.
22. Brohawn,S.G.,Miksa,I.R.&Thorpe,C.(2003)Aviansulfhydryl
oxidase is not a metallo enzyme: adventitious binding o f divalent
metal ions to the enzyme. Biochemistry 42, 1 1074–11082.
23. Kannt,A.,Ostermann,T.,Muller,H.&Ruitenberg,M.(2001)Zn
(2+) binding to the cytop lasmic side of Paracoccus denitrificans
cytochrome c oxidase selectively uncouples electron transfer and
proton translocation. FEBS Lett. 503, 142–146.
24.Mills,D.A.,Schmidt,B.,Hiser,C.,Westley,E.&Ferguson-
Miller, S . (2002) Membrane potential-controlled inhibition of
cytochrome c oxidase by zinc. J. Biol. Chem. 277, 14894–14901.
25. Samiotakis, M. & Ebbs, S.D. (2004) Possible evidence for trans-
port of an iron cyanide complex by plants. Environ. Pollut. 127,
169–173.
26. Morales, R., Charon, M.H., Kachalova, G., Serre, L., Medina,
M., Gomez-Moreno, C. & Frey, M. (2000) A redox-dependent
interaction between two e lectron-transfer partners involved in

photosynthesis. EMBO Rep. 1, 271–276.
27. Martinez-Julvez, M., Medina, M. & Gomez-Moreno, C. (1999)
Ferredoxin-NADP (+) reductase uses the same site for the
interaction w ith ferredoxin and flavodoxin. J. Biol. Inorg. Chem. 4,
568–578.
28. Orellano, E.G., Calcaterra, N.B., Carrillo, N. & Ceccarelli, E.A.
(1993) Probing the role of the carboxyl-terminal region of ferre-
doxin-NADP
+
reductase by site-directed mutagenesis and de le-
tion analysis. J. Biol. Chem. 268, 19267–19273.
29. Rial, D .V., Arakaki, A.K. & C eccarelli, E.A. (2000) Interaction of
the targeting sequence of chloroplast precursors with Hsp70
molecular chaperones. Eur. J. Biochem. 267, 6239–6248.
30. Serra, E.C., Carrillo, N., Krapp, A.R. & C eccarelli, E.A. (1993)
One-step purification of plant ferred oxin-NADP+ o xidoreduc-
tase exp res sed i n Esch erichia c oli as fusion with glutathion e
S-transferase. Protein Ex pr. Purif. 4, 539–546.
31. Hu rley, J.K., Salamon, Z., Meyer, T.E., Fitch, J.C., Cusanovich,
M.A., Markley, J.L., Cheng, H., Xia, B., Chae, Y.K. & Medina, M.
(1993) Amino acid residues in Anabaena ferredoxin crucial to
interaction with ferredoxin–NADP+ reductase: s ite-directed
mutagenesis and laser flash photolysis. Biochem ist ry 32, 9346–
9354.
4592 D. L. Catalano Dupuy et al.(Eur. J. Biochem. 271) Ó FEBS 2004
32. Je nkins, C.M. & Waterman, M.R. (1998) NADPH–flavodoxin
reductase and flavodoxin from Escherichia coli: characteristics
as a soluble m icroso mal P 450 re ducta se. Biochemistry 37, 6106–
6113.
33. Genzor, C .G., Beldarrain, A., Gomez-Moreno, C., Lopez-

Lacomba, J.L., Cortijo, M. & Sancho, J. (1996) Conformational
stability of a poflavodoxin. Protein Sci. 5, 1376–1388.
34. Zanetti, G. (1976) A lysyl residue at the NADP binding site of
ferredoxin-NADP reductase. Biochim. Biophys. Acta 445, 14–24.
35. G eren, L.M. & Millett, F. (1981) Fluorescence energy transfer
studies of the interaction between ad renodoxin a nd cytochrom e c.
J. Biol. Chem. 256, 10485–10489.
36. Aliverti, A., Lubberstedt, T., Zanetti, G., Herrmann, R.G. &
Curti, B. (1991 ) P robing the role of lysine 116 and lysine 2 44 in the
spinach ferredoxin–NADP
+
reductase by site-directed mutagen-
esis. J. Biol. Chem. 266, 17760–17763.
37. Sancho, J. & Gomez-Moreno, C. (1991) Interaction of ferredoxin–
NADP
+
reductase from Ana baena w ith its sub st rates. Arch.
Biochem. Biophys. 288, 231–238.
38. Wang, Z.X., Kumar, N.R. & Srivastava, D.K. (1992) A novel
spectroscopic titration method for determining the dissociation
constant and stoichiometry of p rotein-ligand complex. Anal.
Biochem. 206, 376–381.
39. Piro la, M.C., Monti, F., Aliverti, A. & Zanetti, G. (1994) A
functional heterologo us electron-transfer prot ein complex:
Desulfovibrio vulgaris flavodoxin covalently linked to spinach
ferredoxin-NADP
+
reductase. Arch. Bioc hem. Biophys. 311,
480–486.
40. Deng, Z., Aliverti, A., Zanetti, G., Arakaki, A.K., Ottado, J.,

Orellano, E.G., Calcaterra, N.B., Ceccarelli, E.A., Carrillo, N. &
Karplus, P.A. (1999) A productive NADP
+
binding mode of
ferredoxin-NADP
+
reductase revealed by protein engineering and
crystallographic studies. Nat. Struct. Biol. 6, 847–853.
41. Yu, M.W. & Fritchie, C.J. Jr (1975) Interaction of flavins with
electron-rich metals. J. Biol. Chem. 250, 946–951.
42. Kaim, W., Schwederski, B., Heilmann, O. & Hornung, F.M.
(1999) Coordination compounds of pteridine, alloxazine and fla-
vin ligands: structures and properties. Coord. Chem. Rev. 182,
323–342.
43. Piubelli, L., Aliverti, A ., Arakaki, A.K., Carrillo, N., Ceccarelli,
E.A.,Karplus,P.A.&Zanetti,G. (2000) Competition between
C-terminal tyrosine and nicotinamide modulates pyridine nu -
cleotide affinity and specificity in plant ferredoxin- NADP (+)
reductase. J. Biol. C hem. 275, 10472–10476.
44. Arakak i, A.K., Ceccarelli, E.A. & Carrillo, N. (1997) Plant-type
ferredoxin–NADP
+
reductases: a basal structural framework and
a multiplicity o f functions. FASEB J. 11, 133–140.
45. Ka rplus, P.A. & Bruns, C.M. (1994) Structure–function relations
for ferredoxin reductase. J. Bioenerg. Biomembr. 26, 89–99.
46. K uriyan, J., Krishna, T.S., Wong, L., Guenther, B., Pahler, A.,
Williams, C.H. Jr & Model, P. (1991) Conve rgent evolution of
similar function in two structurally divergent enzymes. Nature
(London) 352, 172–174.

47. K im, E.E. & Wyckoff, H.W. (1991) R eaction mechanism o f
alkaline phosphatase based o n cryst al st ru ctu res. T wo -metal i on
catalysis. J. Mol. Biol. 21 8, 449–464.
48. Eley, C.G., Ragg, E. & Moore, G.R. (1984) Kinetics of electron
transfer between mitochondrial c ytochrome c and iron hexa-
cyanides. J. Inorg. Biochem. 21, 295–310.
49. Colot ti, G., Verzili, D., Boffi, A. & Chiancone, E. (1994) Identi-
fication of the site of ferrocyanide binding involved in the intra-
molecular electron transfer process to oxidized heme in Scapharca
dimeric hemoglobin. Arch. Biochem. Biophys. 311, 103 –106.
50. Kurisu, G., Kusunoki, M., Katoh, E., Yamazaki, T., Teshima, K.,
Onda, Y., Kimata-Ariga, Y. & Hase, T . (2001) Structure of the
electron transfer co mple x between ferredoxin and ferredoxin-
NADP (+) reductase. Nat. Struct. B iol. 8, 117–121.
51. Medina, M., Martinez-Julvez, M., Hurley, J.K., Tollin, G. &
Gomez-Moreno, C. (1998) Involvement of glutamic acid 301 in
the catalytic mechanism of ferredoxin-NADP
+
reductase from
Anabaena PCC 7119. Biochemistry 37, 2715–2728.
52. Aliverti, A., Deng, Z., Ravasi, D., Piubelli, L., Karplus, P.A. &
Zanetti, G. (1998) Probing the func tion of the invariant glutamyl
residue 312 in spinach ferredoxin-NADP
+
reductase. J. Biol.
Chem. 273, 34008–34015.
53. Aliverti, A., Bruns, C.M., Pandini, V.E., Karplus, P.A., Vanoni,
M.A.,Curti,B.&Zanetti,G.(1995)Involvementofserine96in
the catalytic mechanism of ferredoxin-NADP
+

reductase: struc-
ture–function r elationship as studied b y site-directed m utagenesis
and X-ray crystallography. Biochemistry 34, 8371–8379.
54. Aliverti, A., Piubelli, L., Zanetti, G., Lubberstedt, T., Herrmann,
R.G. & Curti, B. (1993) The role of cysteine residues of spinach
ferredoxin-NADP
+
reductase as assessed by site-directed muta-
genesis. Biochemistry 32, 6374–6380.
55. Mayo ral, T., Medina, M., Sanz-Aparicio, J ., Gomez-Moreno, C.
& Hermoso, J.A. (2000) Structural basis of the catalytic role of
Glu301 in Anabaena PCC 7119 ferredoxin-NADP
+
reductase
revealed by x-ray c rystallography. Proteins 38, 60–69.
56. Ullmann, G.M., Hauswald, M., J ensen, A. & Knapp, E.W. (2000)
Structural alignment of ferredoxin and flavod oxin based on
electrostatic potentials: implications for their interactions with
photosystem I and ferredoxin–NAD P reductase. Proteins 38,
301–309.
57. Martinez-Julvez, M., Medina, M. & Gomez-Moreno, C. (1999)
Ferredoxin–NADP (+) reduc tase uses the same site for the
interaction w ith ferredoxin a nd flavodoxin. J. Biol. Inorg. Chem. 4,
568–578.
58. Batie, C.J. & Kamin, H. (1984) Electron transfer by f erredoxin:
NADP+ reductase. Rapid-reaction e vidence for participation of
a ternary complex. J. Biol. Chem. 259, 11976–11985.
59. Batie, C.J. & Kamin, H . (1986) Association of ferredoxin-
NADP+ reductase with NAD P (H) spec ificity and o xidatio n–
reduction properties. J. Biol. C hem. 261, 11214–11223.

60. Serre, L., Vellieux, F.M., Medina, M., Gomez-Moreno, C.,
Fontecilla-Camps, J.C. & Frey, M. (1996) X-ray structure of the
ferredoxin: NADP
+
reductase from the cyanobacterium Anab-
aena PCC 7119 a t 1.8 A resolution, and c rystallographic studies of
NADP
+
binding at 2.25 A resolution. J. M ol. Biol. 263, 20–39.
61. No gues, I., Mar tinez-Julvez, M., Navarro, J.A., Hervas, M.,
Armenteros, L., de la Rosa, M.A., Brodie, T.B., Hurley, J.K.,
Tollin,G.,Gomez-Moreno,C.&Medina,M.(2003)Roleof
hydrophobic interactions in the flavodo xin mediated electro n
transfer from ph otosystem I to ferredoxin-NADP
+
reductase in
Anabaena PCC 7119. Biochemistry 42, 2036–2045.
62. Medina,M.&Gomez-Moreno,C.(2004)Interactionofferre-
doxin–NADP
+
reductase with its substrates. Optimal interact for
efficient electron transfer. Photosynth. Res. 79 , 113–131.
63. Smith,J.M.,Smith,W.H.&Knaff,D.B.(1981)Electrochemical
titrations of a ferredoxin-ferredoxin: N ADP
+
oxidoreductase
complex . Biochim. Biophys. Acta 635, 405–411.
64. Mald onad o, S., L ostao , A., Irun, M.P., Fernandez-Recio, J.,
Gustavo, G.C., Begona, G.E., Rubio, J.A., Luquita, A., Daoudi,
F. & Sancho, J. (1998) Apoflavodoxin: structure, stability, and

FMN binding. Biochimie 80 , 813–820.
Ó FEBS 2004 Inhibition of FNR by Zn-ferrocyanide (Eur. J. Biochem. 271) 4593