Tài liệu Báo cáo khoa học: Stimulation of poly(A) synthesis by Escherichia coli poly(A)polymerase I is correlated with Hfq binding to poly(A) tails ppt

Stimulation of poly(A) synthesis by Escherichia coli
poly(A)polymerase I is correlated with Hfq binding to
poly(A) tails
Marc Folichon, Fre
´
de
´
ric Allemand, Philippe Re
´
gnier and Eliane Hajnsdorf
UPR CNRS 9073, conventionne
´
e avec l’Universite
´
Paris 7 – Denis Diderot, Institut de Biologie Physico-Chimique, Paris, France
Host factor I (Hfq) is an abundant protein of
Escherichia coli, which was first identified as a host
factor required for the replication of Qb bacterio-
phage [1]. It has then been established that disrup-
tion of the hfq gene causes pronounced pleiotropic
phenotypes in uninfected E. coli [2] and that in other
bacteria Hfq permits the adaptation to multiple envi-
ronmental stresses [3,4].
There is now an accumulation of data that shows
Hfq is an RNA-binding protein that is associated with
RNA replication, translation and stabilization [5–8].
In the case of phage Qb replication, Hfq acts directly
by bringing into close proximity the 3¢ terminal and
internal regions of the genomic RNA [9]. Hfq was also
reported to weaken base-pairing in stem loops of
OxyS sRNA, to mask the ribosome binding site of

ompA mRNA [10], to protect several RNAs from deg-
radation by ribonucleases [11,12] and to assist many
sRNAs in their activity [5,13–16]. In this latter case, it
was shown that Hfq facilitates base-pairing between
small regulatory RNAs and their mRNA target
[17,18]. These properties and its capacity to rescue a
splicing defective intron from a ‘folding trap’ led to
the proposal that Hfq is an RNA chaperone acting at
many different steps of RNA metabolism [15,19–21].
In addition, the presence of a characteristic Sm fold
and its organization in a crown-shaped homo-hexamer
proved that Hfq belongs to the Sm-like protein family
[18,22–24] whose members are involved in many
RNA–RNA and RNA–protein transactions. Finally,
Hfq was also recently reported to interact with ribo-
somal protein S1 and RNA polymerase, to exhibit an
Keywords
E. coli; Hfq protein; poly(A)-polymerase I;
polynucleotide phosphorylase; RNA–protein
interaction
Correspondence
E. Hajnsdorf, UPR CNRS 9073,
conventionne
´
e avec l’Universite
´
Paris
7 – Denis Diderot, Institut de Biologie
Physico-Chimique, 13 rue Pierre et Marie
Curie, 75005 Paris, France

Fax: +33 1 58 41 50 20
Tel: +33 1 58 41 51 26
E-mail:
(Received 16 September 2004, revised 15
November 2004, accepted 16 November
2004)
doi:10.1111/j.1742-4658.2004.04485.x
The bacterial Lsm protein, host factor I (Hfq), is an RNA chaperone
involved in many types of RNA transactions such as replication and stabil-
ity, control of small RNA activity and polyadenylation. In this latter case,
Hfq stimulates poly(A) synthesis and binds poly(A) tails that it protects
from exonucleolytic degradation. We show here, that there is a correlation
between Hfq binding to the 3¢ end of an RNA molecule and its ability to
stimulate RNA elongation catalyzed by poly(A)polymerase I. In contrast,
formation of the Hfq–RNA complex inhibits elongation of the RNA by
polynucleotide phosphorylase. We demonstrate also that Hfq binding is
not affected by the phosphorylation status of the RNA molecule and
occurs equally well at terminal or internal stretches of poly(A).
Abbreviations
Hfq, host factor I; PAP I, poly(A)polymerase; PNPase, polynucleotide phosphorylase.
454 FEBS Journal 272 (2005) 454–463 ª 2004 FEBS
ATPase activity and to affect polyadenylation of bac-
terial RNAs [25–27].
Polyadenylation is ubiquitous in all organisms but
has opposite effects on mRNA stability in prokaryotes
and eukaryotes. These two opposed functions of poly-
adenylation appear to be represented in the mitochon-
dria of different organisms [28]. In the chloroplast,
however, there is no equivalent of poly(A)polymerase
and the same enzyme, polynucleotide phosphorylase,

polyadenylates and degrades the RNA molecule [29].
In some cases, factors have been identified which
stimulate the activity of poly(A)polymerase, rendering
the reaction processive; in E. coli, this function is
assured by Hfq. We have demonstrated that Hfq
stimulates poly(A) elongation catalyzed by poly(A)po-
lymerase (PAP I) and that tails are synthesized very
rapidly once RNA have acquired a tail of 20–35 resi-
dues [26]. In vivo, Hfq favors the appearance of long
poly(A) tails, it increases the fraction of polyadenylated
rpsO mRNAs and it modifies the repartition of the
poly(A) tails at the 3¢ ends of RNA species resulting
from endo- and exonucleolytic processing [26,27].
However, we do not know how Hfq affects substrate
recognition and poly(A) elongation by PAP I.
In support of the idea that Hfq binding to the 3¢
end of RNA facilitates PAP I activity, we show here
that Hfq does not stimulate the PAP I mediated elon-
gation of poly(C) tails for which it has no affinity.
Moreover, we find that RNA harboring 5¢ monophos-
phorylated extremities, which favor RNase E process-
ing and poly(A) dependent exonucleolytic degradation,
are not preferentially bound by Hfq. This suggests that
Hfq is not involved in the 5¢ end dependent activation
of RNA decay.
Results
Failure to stimulate poly(C) synthesis is
correlated with inefficient binding of Hfq to
poly(C) tailed RNA
We reported previously that Hfq stimulates elongation

of poly(A) tails, but it is not known whether this
reflects a modification of the RNA substrate due to
the formation of an Hfq–RNA complex or to a direct
interaction of Hfq with PAP I. To better understand
the mechanism of activation, we have investigated
whether stimulation of PAP I activity is correlated
with the affinity of Hfq for the 3¢ end of RNA. We
used an RNA fragment corresponding to the 3¢ end of
the rpsO transcript, which was shown to be polyaden-
ylated both in vivo and in vitro [26,30,31]. For that
purpose, we have first examined Hfq binding to 3¢rpsO
RNA fragments harboring different homopolymeric
tails of 18 nucleotides or a stretch of 18 encoded
nucleotides lying downstream of the transcription ter-
minator of the polycistronic rpsO-pnp mRNA (5¢-AA
GCUGACGGCAGCAAUU). As seen in Fig. 1A, we
find that Hfq binds much more efficiently RNAs that
harbor poly(A) or poly(U) tails than RNA harboring
poly(G) or poly(C). These results are in agreement
with previous data obtained with homopolymers [22].
Comparison with tail-less RNA suggests that poly(G),
poly(C) tails and the natural stretch of 18 nucleotides
encoded downstream of the rpsO transcription termi-
nator are either not, or only inefficiently, bound by
Hfq. In order to determine which RNA substrate is
more efficiently bound by Hfq, we performed competi-
tion experiments using poly(A) and poly(U) tailed
3¢rpsO RNA. The gel-shift experiments of Fig. 1B
clearly show that Hfq exhibits a preference for poly-
adenylated molecules over RNA tailed with a poly(U)

sequence. It must be mentioned here that the intracel-
lular Hfq concentration (about 10 lm [32]) is much
higher that the concentration used in the experiment.
We next examined whether Hfq stimulates synthesis
of a homopolymeric tail that it does not recognize. To
avoid synthesis of a poly(A) tail, which would create
an Hfq binding site at the 3¢ end of the RNA, we
investigated whether Hfq stimulates elongation of
poly(C) tails for which it exhibits a very low affinity.
This approach was valudated by previous results indi-
cating that, in spite of its high preference for ATP,
PAP I can also achieve CTP elongation by approxima-
tively 500 nucleotides [33]. Accordingly, we found that
PAP I slowly polymerises C residues at the 3¢ end of
the 3¢rpsO substrate in our experimental conditions
[34,35] (Fig. 2A). Interestingly, Fig. 2B clearly shows
that Hfq does not affect synthesis of poly(C) tails by
PAP I. Hfq (160 nm) does not inhibit poly(C) synthesis
but at this Hfq concentration and at higher concentra-
tions (data not shown) degradation of the RNA sub-
strate can be detected; this faint degradation is also
seen in lane 7 of the same figure. Some nonadenylated
substrate remains in the presence of Hfq (Fig. 2B) but
also in the absence of Hfq (Fig. 2A, lane ATP). These
small amounts of nonadenylated RNA fragment are
not constant, nor proportional to Hfq concentration.
These data demonstrate that Hfq does not stimulate
elongation of an RNA molecule that it does not bind,
and are consistent with the idea that stimulation of
polyadenylation reflects the affinity of Hfq for the

RNA rather than its interaction with PAP I. Alternat-
ively, it is also possible that PAP I stimulation of
poly(A) synthesis is correlated with the ATPase activ-
ity of Hfq [25].
M. Folichon et al. Hfq binding to RNA stimulates elongation by PAP I
FEBS Journal 272 (2005) 454–463 ª 2004 FEBS 455
The position of the AU rich region at the 5¢ end
is not critical for Hfq binding
The idea that stimulation of poly(A) synthesis is cor-
related with the association of Hfq to the 3¢ end of
RNA prompted us to investigate whether 3¢ terminal
AU rich regions are preferentially bound by Hfq. If
true, this may indicate that a function of Hfq in vivo
could be to favor polyadenylation of RNAs harbor-
ing such 3¢ elements. It is already known that Hfq
binds the OxyS109 sRNA as well as mRNA frag-
ments such as 3¢rpsO and ompA105. Moreover, it
has been shown that appending a 3¢ terminal poly(A)
or a single stranded stretch of nucleotides to these
mRNA fragments (thus giving rise to 3¢rpsO-A
18
and
ompA117, respectively) strongly enhances Hfq affinity
(Fig. 3) [10,12]. We performed a series of gel-shift
experiments in order to generate a hierarchy of Hfq
binding efficiency to these different RNAs harboring
internal or 3¢ terminal presumptive binding sites.
Interestingly, Fig. 3 shows that Hfq exhibits roughly
the same affinity for the 3¢rpsO-A
18

RNA harboring
a3¢ terminal tail and the OxyS109 RNA that was
proposed to be bound by Hfq at an internal site
framed by two stable hairpins [13]. This suggested
that Hfq binding is independent of the location of
the AU rich region in the RNA. This conclusion has
been verified by comparing the affinity of Hfq for
3¢rpsO RNA harboring a stretch of 18 A residues
appended either at the 3¢ end (3¢rpsO-A
18
) or between
the two secondary structures. This last RNA is bound
by Hfq with an affinity similar to that of the RNA
harboring a 3¢ terminal poly(A) tail. As shown in
Fig. 4, two slowly migrating complexes were detected
when the A
18
sequence is internal, while three
complexes were detected with the A
18
sequence at the
A
B
Fig. 1. Relative affinity of Hfq for 3¢ A
18
,3¢ U
18
,3¢ C
18
,3¢ G

18
or 3¢ N
18
tailed rpsO mRNAs. 5¢ end labeled RNA and RNA 3¢ end tailed with
various homopolymer and heteropolymer sequences were mixed with Hfq and analyzed on native gel. N
18
represents the 18 nucleotide
sequence 5¢-AAGCUGACGGCAGCAAUU. (A) Hfq binding to various RNA substrates. The different 5¢ end labeled RNAs (20 p
M) indicated at
the bottom of the graph were mixed with 20 p
M Hfq-His6 and formation of complexes was analyzed by gel-shift assay. The quantification of
the gel is shown. (B) Competition assay. The 5¢ labeled RNA indicated at the bottom of the autoradiograph (20 p
M) was incubated without
(–) (lane 1) and with 10 p
M Hfq-His6 (+) (lanes 2–7) and increasing amounts of the competitor RNA indicated at the top of the autoradio-
graph; 20 p
M (lane 3), 40 pM (lane 4), 100 pM (lane 5), 200 pM (lane 6) and 400 pM (lane 7).
Hfq binding to RNA stimulates elongation by PAP I M. Folichon et al.
456 FEBS Journal 272 (2005) 454–463 ª 2004 FEBS
AB
Fig. 2. Hfq stimulates addition of A residues
by PAP I but not of C residues. (A) Addition
of various residues by PAP I. 5¢ end labeled
p-3¢rpsO mRNA was incubated for 15 min
at 37 °C, without PAP I (–) and with the
NTP indicated at the top of the panel.
Samples were analyzed on a sequencing
6% acrylamide gel along with radioactive
DNA size markers. (B) Hfq stimulation of
PAP I elongation in the presence of ATP or

CTP. The 5¢ end labeled p-3¢rpsO mRNA
was mixed without (lanes 1 & 8) and with
increasing Hfq concentrations; 5 n
M (lanes 2
& 9), 10 n
M (lanes 3 & 10), 20 nM (lanes 4 &
11), 40 n
M (lanes 5 & 12), 80 nM (lanes 6 &
13) and 160 n
M (lanes 7 & 14). Incubation
was conducted in the presence of PAP I for
15 min at 37 °C, in the presence of ATP
(lanes 1–7) or CTP (lanes 8–14).
Fig. 3. Comparison of Hfq binding to various RNA. (A) Predicted structures of the RNA used in the gel retardation experiments. The RNA
sequences were folded with
MFOLD ( and their size is indicated in brackets (nt, nucleotides). Num-
bers on the secondary structures indicate the length of the single stranded regions. Black rectangles locate Hfq binding sites determined by
enzymatic and chemical probing and by mutational analysis. Grey rectangle locates the Hfq binding site determined by gel retardation assay.
Grey curves locate AU rich sequences. 5¢ end labeled RNA (20 p
M) were incubated in the absence and in the presence of 20 pM and 200 pM Hfq-
His6 protein. Complexes were separated from unbound RNA substrates as described in Fig. 1. (B) PhosphoImager analysis of the results. The
5¢ end labeled RNA indicated at the bottom of the figure was incubated with 20 p
M (open columns) and 200 pM (gray columns) of Hfq protein.
M. Folichon et al. Hfq binding to RNA stimulates elongation by PAP I
FEBS Journal 272 (2005) 454–463 ª 2004 FEBS 457
3¢ end. We conclude that the presence of secondary
structures at both extremities of the potential Hfq
binding site may limit the number of Hfq molecules
susceptible to interact with the RNA, but that the
position of the 18 A residues relative to secondary

structures does not modify the affinity of Hfq for
RNA.
These data prompted us to examine whether any
RNA fragment containing AU rich single-stranded
sequences and secondary structures may be bound by
Hfq. For that purpose, we synthesized an RNA frag-
ment which corresponds to the 5¢ part of rpsO mRNA
(5¢rpsO). Examination of its secondary structure
reveals a bulge loop containing a UUUUAAAAUGU
sequence and an 11 nucleotide long linker containing 6
Us and 3 As [36]. It is interesting that this RNA frag-
ment, which is not known to interact with Hfq in the
cell, is bound by Hfq as efficiently as the ompA117
mRNA fragment which contains an Hfq binding site
implicated in translation and stability of this mRNA
(Fig. 3). These data may indicate either that structural
determinants different from the AU rich stretch of
nucleotides are required for efficient Hfq binding
in vivo or that Hfq interacts with the 5¢rpsO RNA
fragment which contains the translational operator of
the rpsO messenger [37].
The phosphate number at the 5¢ end of the RNA
does not affect Hfq binding
We have also examined whether the phosphorylation
status of the 5 ¢ end of the RNA fragment, which was
shown to affect poly(A) synthesis of RNA I, a highly
folded unstranslated regulatory RNA [38], poly(A)
dependent decay [39,40] as well as RNase E and RNase
G processing [41–43] also modulates Hfq binding. To
address this question, two forms of the (3¢rpsO-A

18
)
RNA substrate differing by the phosphorylation state
of their 5¢ extremity were synthesized. As usual, the tri-
phosphorylated substrate was prepared by in vitro tran-
scription in the presence of all four nucleoside
triphosphates and [
32
P]UTP[aP]. The reaction mixture
for the in vitro synthesis of the monophosphorylated
substrate contained [
32
P]UTP[aP] as a tracer and a
large excess of guanosine over GTP, generating non-
phosphorylated 5¢ ends which were then selectively
labeled by T4 polynucleotide kinase in the presence of
[
32
P]ATP[a
˜
P]. As shown in Fig. 5A, Hfq binds both
mono- and tri-phosphorylated RNA substrates with
the same efficiency. In both cases, four complexes were
observed by increasing Hfq concentrations. These data
agree with previous identifications of two Hfq binding
sites on the mono-phosphorylated 3¢rpsO-A
18
[12]. We
cannot determine if higher complexes result from Hfq
binding to other unidentified sites or whether protein–

protein interactions account for the appearance of these
complexes. We concluded that, in contrast to the many
processes quoted above, Hfq binding does not depend
on the phosphorylation status of the 5¢ extremity
(Fig. 5A).
We also examined whether polyadenylation effic-
iency of an mRNA fragment is influenced by the phos-
phorylation state of its 5¢ extremity as previously
reported for RNA I of colE1 plasmid. As shown in
Fig. 5B, PAP I is more active on the mono- than on
the tri-phosphate RNA substrate; poly(A) tailed
p-3¢rpsO are, on average, 150 nucleotides longer after
30 min than poly(A) tailed ppp-3¢rpsO. Our result
extends to mRNA the previous data obtained with
small regulatory RNA (Fig. 5B).
Hfq inhibits poly(A) synthesis by polynucleotide
phosphorylase
Because Hfq binds to the 3¢ end of RNA harboring
a single stranded stretch of nucleotides, we have
investigated whether Hfq also affects the activity of
Fig. 4. Relative affinity of Hfq for rpsO mRNA tailed at its 3¢ end
with 18 A residues or containing an internal A
18
sequence. The 5¢
labeled RNA indicated at the bottom of the autoradiograph (10 p
M)
was incubated without (–) and with (+) 200 p
M Hfq protein. Com-
plex formation was analyzed on native gel. The arrows indicate the
position of the A

18
sequence.
Hfq binding to RNA stimulates elongation by PAP I M. Folichon et al.
458 FEBS Journal 272 (2005) 454–463 ª 2004 FEBS
polynucleotide phosphorylase (PNPase). It has previ-
ously been proposed that PNPase also synthesises
tails in vivo [44]. For that purpose we have looked at
the elongation of 5¢ labeled polyadenylated 3¢rpsO
RNA by purified PNPase in the presence of ADP.
Data shown in Fig. 6 suggest that Hfq impairs access
of PNPase to the substrate but does not affect the
elongation of the tails. Indeed we observed that the
addition of Hfq delays utilization of the substrate
(this effect increases with the amount of Hfq) but
that it does not affect appearance of the long tails.
This can be explained easily by assuming that Hfq
does not impair the rate of processive elongation of
RNA by the PNPase molecule, which remains bound
to the polynucleotide. One can propose that Hfq may
mask the 3¢ end of RNA (namely the 18 A residues
at the 3¢ end of the substrate) and therefore prevent
recycling of PNPase from a molecule that has been
elongated to a new molecule of primer. In contrast,
once the RNA–PNPase complex is formed and pro-
cessive elongation engaged, Hfq can probably not
affect the rate of polymerization. These data are con-
sistent with the idea that Hfq forms a complex with
RNA which, in this case, has an inhibitory effect on
binding of poly(A) by PNPase. In contrast, an inter-
action between Hfq and PNPase would be expected

to inhibit both initiation and elongation of the tail.
Discussion
In this report, we show a correlation between Hfq
binding to the 3¢ end of an RNA molecule and its abil-
ity to stimulate PAP I which suggests that the Hfq–
RNA interaction facilitates RNA recognition by
PAP I. Moreover, we also demonstrate that Hfq binds
very efficiently to RNA harboring stretches of poly(A)
and poly(U) and that the location of this structural
feature in the molecule (i.e. whether it is internal or 3¢
terminal) does not affect the affinity of Hfq. Hfq bind-
ing does not depend upon the phosphorylation status
of the 5¢ end. Finally, we show that formation of a
Hfq–poly(A) complex which activates poly(A) synthe-
sis by PAP I, inhibits poly(A) synthesis by PNPase,
suggesting that the two enzymes interact differently
with 3¢ extremities.
Our data suggest that PAP I preferentially elongates
RNA harboring poly(A) tails bound by Hfq. It is poss-
ible that structural modifications resulting from Hfq
binding facilitate recognition of the 3¢ end or its adeny-
lation by PAP I [12]. It is worth recalling here, that
similarly, an interaction between the 5¢ extremity of an
RNA with its 3¢ end was proposed to explain why 5¢
monophosphorylated RNAs are more efficently adeny-
lated by PAP I than those harboring a triphosphoryl-
ated 5¢ end [38].
AB
Fig. 5. A monophosphate 5¢ end stimulates polyadenylation but not Hfq binding. (A) Hfq binding to mono- and tri-phosphorylated RNA sub-
strates. 5¢ end labeled p-3¢rpsO mRNA and of uniformly labeled ppp-3¢rpsO mRNA (50 p

M) were incubated without (lanes 1 & 5) and with
increasing amounts of Hfq-His6; 100 p
M (lanes 2 & 6), 500 pM (lanes 3 & 7) and 2.5 nM (lanes 4 & 8). (B) Polyadenylation of RNA substrates
harboring a 5¢ mono- or a 5¢ tri-phosphorylated extremity. Uniformly labeled ppp-3¢rpsO mRNA and 5¢ end labeled p-3¢rpsO mRNA were incu-
bated with 1.2 pmol PAP I. Samples were taken at the times indicated at the bottom of the figure. The two time course experiments were
analyzed by electrophoresis on the same gel along with radioactive DNA markers. For convenience, two exposures of the same gel are
shown.
M. Folichon et al. Hfq binding to RNA stimulates elongation by PAP I
FEBS Journal 272 (2005) 454–463 ª 2004 FEBS 459
Interestingly, the hierarchy and the relative affinities
of Hfq to homopolymeric tails [poly(A) > poly(U)
>> poly(C) > poly(G)] is similar to that previously
described in the case of the Staphylococcus aureus pro-
tein for oligonucleotides [22], suggesting that tails of
long RNA also bind the sites surronding the central
hole of the Hfq hexamer. However, the much higher
stability of complexes formed with long RNA com-
pared to that of the Hfq-oligos [22,45] indicates that
Hfq establishes additional contacts with RNA that
reinforce the strength of the association [46]. These
sites may be similar to those described at the surface
of an archael Sm-like protein [47].
Our previous data showing that Hfq binds long
poly(A) sequences [poly(A
115
)] as efficiently as poly-
adenylated molecules suggests that the length of the
RNA rather than secondary structures could account
for the formation of stable complexes [12]. One could
postulate that secondary structures stimulate Hfq bind-

ing when they prevent intramolecular annealing of
RNA sequences with AU rich regions preferentially
recognized by Hfq.
We have shown here and in our previous study [12]
that the Hfq–poly(A) complex, which facilitates elonga-
tion of the RNA by PAP I, prevents its recognition by
PNPase which inhibits both degradation and elongation
of the RNA by this latter enzyme. These data imply
that different structural features of RNA are recognized
by the two enzymes. In the case of PNPase, Hfq may
mask the secondary site that was proposed to facilitate
RNA recognition and processivity of the reaction [48].
Failure of Hfq to impair the processivity of the reaction
(Fig. 6) suggests that it does not compete with PNPase
already engaged in processive elongation of the RNA.
These data also suggest that PAP I does not interact
with single-stranded RNA upstream of the 3¢ end of the
molecule which is presumably masked by Hfq. In addi-
tion, one can also speculate that the synthesis of long
tails, which was attributed to PNPase, is presumably
strongly inhibited by Hfq in vivo. Finally, although our
data suggest that structural modification of RNA due
to Hfq binding, account for stimulation of PAP I medi-
ated poly(A) synthesis, the recent demonstration that
Hfq interacts with proteins such as ribosomal protein
S1 and RNA polymerase implies that Hfq also establi-
shes protein–protein interactions that may affect
physiological functions of its protein partner.
Materials and methods
Protein purification

Hfq-His6 was overproduced and purified as described [12].
Hfq without the His-tag was produced from the pET-Hfq
plasmid, which was constructed as follows. A PCR fragment
was generated using reverse and forward primers with the
sequences 5¢-GGGAATTCCATATGGCTAAGGGGCAA
TC and 5¢-AGGATCGCTGGATCCCCGTGTAAAAAA
AC, respectively, with pTX367 plasmid [8], creating an NdeI
site that included the translation initiation codon and a
BamHI site downstream of the terminator. The PCR frag-
ment digested by NdeI and BamHI was inserted into pUC18
vector that had been digested with the same enzymes. The
Hfq containing DNA fragment was excised with the same
enzymes and ligated into the corresponding sites of pET11c
and then transformed into the E. coli strain BL21(DE3).
Cells in 10 mL lysis buffer [100 mm Tris ⁄ HCl (pH 7.5),
800 mm LiCl, 150 mm MgCl
2
,1mm dithiothreitol, antipro-
tease cocktail complete, mini-EDTA free (Mannheim
GmbH, Germany)] were disrupted using a French press
(twice at 85 MPa at 4 °C). The lysate was incubated on ice
for 20 min with 1 lgÆmL
)1
Dnase I. The cell debris was
removed by centrifugation at 9000 g for 30 min, the resul-
tant clear lysate supernatant was precipitated by ammonium
sulfate (70% saturation). The precipitate was pelleted and
resuspended in 10 mL Binding Buffer [50 mm Tris ⁄ HCl
(pH 8), 50 mm NaCl, 10% glycerol, 1 mm dithiothreitol]
and then dialyzed overnight against the same buffer at 4 °C.

The suspension was injected onto a Q FF column (16 ⁄ 20
Amersham Biosciences Europe GmbH, Saclay, France).
Fractions eluting at 200 mm NaCl were pooled and dialyzed
Fig. 6. Hfq inhibits the addition of A residues by PNPase. Elonga-
tion of 5¢ labeled polyadenylated 3¢rpsO mRNA by PNPase was per-
formed in the absence and in the presence of 10 n
M and 100 nM
Hfq-His6 as described in Materials and methods. Aliquots were
removed at 0.5, 2, 3 and 5 min and analyzed on an acrylamide
sequencing gel.
Hfq binding to RNA stimulates elongation by PAP I M. Folichon et al.
460 FEBS Journal 272 (2005) 454–463 ª 2004 FEBS
overnight at room temperature in Binding Buffer. The solu-
tion was applied onto a Hi-trap Heparin column (Pharma-
cia) and eluted with a linear NaCl gradient between 500 and
600 mm NaCl. The pooled fractions were dialyzed overnight
at 4 °C into 50 mm Tris ⁄ HCl (pH 7.5), 50 mm NH
4
Cl, 5%
glycerol, 1 mm EDTA (Buffer A). The sample was loaded
onto a poly(A)-column [poly(A) Sepharose 4B Pharmacia]
equilibrated with Buffer A at 4 °C [49]. The run through
was collected and reloaded. The column was washed at 4 °C
with 50 mm Tris ⁄ HCl (pH 7.5), 1 m NH
4
Cl, 5% glycerol,
1mm EDTA (Buffer B) and then transfered to room tem-
perature. Hfq was eluted with Buffer B plus 8 m urea and
dialyzed at 4 °C into Buffer A with 0.5 mm dithiothreitol.
Purified Hfq was stored at 4 °C in the same buffer contain-

ing 0.1% Triton. Hfq and Hfq-His6 were used interchange-
ably [12] and their concentrations are expressed as monomer
concentration. PAP I was overproduced from plasmid
pPAP and purified as in [50].
RNA preparation and labeling
Templates for synthesis of the different RNAs were
obtained by PCR amplification of the first 125 nucleotides
of the rpsO mRNA (5¢rpsO), the last 97 nucleotides of
the same transcript (3¢rpsO), part of the 5¢ UTR of ompA
transcript (ompA117 and ompA105) and the OxyS
sequence (oxyS109) using the primers described in Table 1.
The templates used to synthesize 3¢rpsO-RNA with 3¢ tails
of 18 A, 18 C, 18 G, 18 U or 18 N (5¢-AA
GCUGACGGCAGCAAUU) residues were transcribed
using the corresponding reverse primers. The template
used to synthesize the 3¢rpsO RNA containing an inser-
tion of 18 A residues between the two hairpins was
obtained after two PCRs using first the forward rpsO
internal primer and the reverse 3¢rpsO primer, and then,
the first PCR product and the forward 3¢rpsO primer. The
PCR products were purified on an agarose gel after each
step.
Transcription reactions were carried out as in [12] using
[
32
P]UTP[aP] as tracer, yielding uniformly labeled RNA.
When needed, 20 mm guanosine was also added to allow
further direct 5¢ labeling. Radiolabeled RNAs were gel puri-
fied and resuspended in water. RNA concentrations were
monitored by counting out the radioactivity. Labelling of

the 5¢ end was performed with [
32
P]ATP[a
˜
P] and T4 poly-
nucleotide kinase, labeled RNAs were separated from un-
incorporated nucleotides through a ProbQuant G-50
Microcolumn (Amersham Biosciences).
Electrophoretic mobility shift assays
Hfq protein was incubated with 5¢ [
32
P]RNA in 20 lL buffer
containing 10 mm Tris⁄ HCl (pH 8), 1 mm EDTA, 80 mm
NaCl, 1% glycerol (v ⁄ v). Reactions were incubated at 37 °C
for 30 min and complexes were resolved by electrophoresis
through native polyacrylamide gel [13]. A PhosphoImager
and the imagequant software (Amersham Biosciences
Europe) were used to view the gel and to quantify results.
Polyadenylation in vitro
Polyadenylation by PAP I was conducted as in [26] using 5¢
end labeled RNA or uniformly labeled 3¢rpsO RNA with
purified PAP I (77 fmol). Samples were analyzed on dena-
turing 6% polyacrylamide gel. Poly(A) tail synthesis by
PNPase was conducted using 5¢ end labeled 3¢rpsO-A
18
RNA (2 pmol) in 50 lL; 50 mm Tris ⁄ HCl (pH 8), 5 mm
MgCl
2
,50mm NaCl, 0.1 mm dithiothreitol, 0.5 mgÆmL
)1

tRNA, 0.5 mm ADP with 2 pmol PNPase.
Acknowledgments
We are grateful to J. Plumbridge for careful critical
reading of the manuscript. We thank C. Portier for
providing PNPase, A. J. Carpousis, T. Elliott and
Table 1. PCR primers. Itallics correspond to RNA polymerase sequences of the T7 or T3 phages (T3 phage indicated by *), respectively.
Primer name Sequence
Forward ompA* 5¢-TAATTAACCCTCACTAAAGGGGTGCTCGGCATAAG
Reverse ompA105 5¢-GCCATGAATATCTCCAACGAG
Reverse ompA117 5¢-CATCCAAAATACGCCATGAATATC
Forward 5¢rpsO 5¢-TAATACGACTCACTATAGGGGCCGCTTAACGTCGCG
Reverse 5¢rpsO 5¢-GCTTCAGTACTTAGAGAC
Forward 3¢rpsO 5¢-TAATACGACTCACTATAGGGAGACGTAGCACGTTACACC
Reverse 3¢rpsO 5¢-GAAAAAAGGGGCCACTCAGG
Reverse 3¢rpsO-(T)18 5¢-T(18)GAAAAAAGGGGCCACTCAGG
Forward rpsO internal 5¢GCGTCGCTAATTCTTGCGAGA18TTTCAGAAAAGGGCTG
Reverse 3¢rpsO-(C)18 5¢-C(18)GAAAAAAGGGGCCACTCAGG
Reverse 3¢rpsO-(G)18 5¢-G(18)GAAAAAAGGGGCCACTCAGG
Reverse 3¢rpsO-(N)18 5¢-GAATTGCTGCCGTCAGCTTGA
Forward oxyS109* 5¢-TAATTAACCCTCACTAAAGGGAAACGGAGCGGCACCTCTT
Reverse oxyS109 5¢-GCGGATCCTGGACCGCAAAAG
M. Folichon et al. Hfq binding to RNA stimulates elongation by PAP I
FEBS Journal 272 (2005) 454–463 ª 2004 FEBS 461
M. Winkler for the gifts of pPAP, pTE607 and
pTX367, respectively. This work was supported by
Universite
´
Paris 7 – Denis Diderot (plan quadriennal),
the Center National de la Recherche Scientifique
(UPR 9073), the Programme de Recherche Fondamen-

tale en Microbiologie et Maladies Infectieuses et Paras-
itaires of the Ministe
`
re de l’Education Nationale de la
Recherche et de la Technologie. M. F. is recipient of a
grant from M. N. R. T.
References
1 Franze de Fernandez MT, Hayward WS & August JT
(1972) Bacterial proteins required for replication of
phage Qb ribonucleic acid. J Biol Chem 247, 821–824.
2 Muffler A, Fischer D & Hengge-Aronis R (1996) The
RNA-binding protein HF-I, known as a host factor for
phage Qb RNA replication, is essential for rpoS transla-
tion in Escherichia coli. Genes Dev 10, 1143–1151.
3 Roop RM II, Robertson GT, Ferguson GP, Milford LE,
Winkler ME & Walker GC (2002) Seeking a niche:
putative contributions of the hfq and bacA gene pro-
ducts to the successful adaptation of the brucellae to
their intracellular home. Vet Microbiol 90, 349–363.
4 Brown L & Elliott T (1996) Efficient translation of the
RpoS sigma factor in Salmonella typhimurium requires
Host Factor I, an RNA-binding protein encoded by the
hfq gene. J Bacteriol 178, 3763–3770.
5 Sledjeski DD, Whitman C & Zhang A (2001) HFq is
necessary for regulation by the untranslated RNA
DsrA. J Bacteriol 183, 1997–2005.
6 Takada A, Wachi M & Nagai K (1999) Negative regu-
latory role of the Escherichia coli hfq gene in cell divi-
sion. Biochem Biophys Res Com 266, 579–583.
7 Wachi M, Takada A & Nagai K (1999) Overproduction

of the outer-membrane proteins FepA and FhuE
responsible for iron transport in Escherichia coli hfq::cat
mutant. Biochem Biophys Res Com 264, 525–529.
8 Tsui H-CT, Feng G & Winkler ME (1997) Negative
regulation of mutS and mutH repair gene expression by
the Hfq and RpoS global regulators of Escherichia coli
K-12. J Bacteriol 179, 7476–7487.
9 Barrera I, Schuppli D, Sogo JM & Weber H (1993) Dif-
ferent mechanisms of recognition of bacteriophage Q
beta plus and minus strand RNAs by Q beta replicase.
J Mol Biol 232, 512–521.
10 Vytvytska O, Moll I, Kaberdin VR, von Gabain A &
Bla
¨
si U (2000) HFq (HFI) stimulates ompA mRNA
decay by interfering with ribosomes binding. Genes Dev
14, 1109–1118.
11 Moll I, Afonyushkin T, Vytvytska O, Kaberdin VR &
Blasi U (2003) Coincident Hfq binding and RNase E
cleavage sites on mRNA and small regulatory RNAs.
RNA 9, 1308–1314.
12 Folichon M, Arluison V, Pellegrini O, Huntzinger E,
Regnier P & Hajnsdorf E (2003) The poly(A) binding
protein Hfq protects RNA from RNase E and exoribonu-
cleolytic degradation. Nucleic Acids Res 31, 7302–7310.
13 Zhang A, Altuvia S, Tiwari A, Argaman L,
Hengge-Aronis R & Storz G (1998) The oxyS regulatory
RNA represses rpoS translation and binds the Hfq
(HF-1) protein. EMBO J 17, 6061–6068.
14 Masse

´
E, Escorcia FE & Gottesman S (2003) Coupled
degradation of a small regulatory RNA and its mRNA
targets in Escherichia coli. Gene Dev 17, 2374–2383.
15 Geissmann TA & Touati D (2004) Hfq, a new chaper-
oning role: binding to messenger RNA determines
access for small RNA regulator. EMBO J 23, 396–405.
16 Majdalani N, Chen S, Murrow J, St John K &
Gottesman S (2001) Regulation of rpoS by a novel
small RNA: the characterization of RprA. Mol Micro-
biol 39, 1382–1394.
17 Zhang A, Wassarman KM, Ortega J, Steven AC &
Storz G (2002) The Sm-like HFq protein increases OxyS
RNA interaction with target mRNAs. Mol Cell 9, 11–22.
18 Moller T, Franch T, Hojrup P, Keene D, Ba
¨
chinger
HP, Brennan RG & Valentin-Hansen P (2002) HFq: a
bacterial Sm-like protein that mediates RNA–RNA
interaction. Mol Cell 9, 23–30.
19 Muffler A, Traulsen DD, Fischer D, Lange R &
Hengge-Aronis R (1997) The RNA-binding protein
HF-1 plays a global regulatory role which is largely, but
not exclusively, due to its role in expression of the
r
S
subunit of RNA polymerase in Escherichia coli.
J Bacteriol 179, 297–300.
20 Schuppli D, Miranda G, Tsui H-CT, Winckler ME, Sogo
JM & Weber H (1997) Altered 3¢-terminal RNA structure

in phage Qb adapted to host factor-less Escherichia coli.
Proc Natl Acad Sci USA 94, 10239–10242.
21 Moll I, Leitsch D, Steinhauser T & Bla
¨
si U (2003)
RNA chaperone activity of the Sm-like Hfq protein.
EMBO Rep 4, 284–289.
22 Schumacher MA, Rearson RF, Moller T, Valentin-
Hansen P & Brennan RG (2002) Structures of the
pleiotropic translational regulator HFq and an HFq-
RNA complex: a bacterial Sm-like protein. EMBO J 21,
3546–3556.
23 Arluison V, Derreumaux P, Allemand F, Folichon M,
Hajnsdorf E & Re
´
gnier P (2002) Structural modelling of
the Sm-like protein Hfq from Escherichia coli. J Mol
Biol 320, 705–712.
24 Sauter C, Basquin J & Suck D (2003) Sm-like proteins
in Eubacteria: the crystal structure of the Hfq protein
from Escherichia coli. Nucleic Acids Res 31, 4091–4098.
25 Sukhodolets MV & Garges S (2003) Interaction of
Escherichia coli RNA polymerase with the ribosomal
protein S1 and the Sm-like ATPase Hfq. Biochemistry
42, 8022–8034.
Hfq binding to RNA stimulates elongation by PAP I M. Folichon et al.
462 FEBS Journal 272 (2005) 454–463 ª 2004 FEBS
26 Hajnsdorf E & Re
´
gnier P (2000) Host factor HFq of

Escherichia coli stimulates elongation of poly(A) tails by
poly(A) polymerase I. Proc Natl Acad Sci USA 97,
1501–1505.
27 Le Derout J, Folichon M, Briani F, Deho
`
G, Re
´
gnier P
& Hajnsdorf E (2003) Hfq affects the length and the fre-
quency of short oligo(A) tails at the 3¢ end of Escheri-
chia coli rpsO mRNAs. Nucleic Acids Res 31, 4017–
4023.
28 Gagliardi D, Stepien PP, Temperley RJ, Lightowlers
RN & Chrzanowska-Lightowlers ZM (2004) Messenger
RNA stability in mitochondria: different means to an
end. Trends Genet 20, 260–267.
29 Yehudai-Resheff S, Hirsh M & Schuster G (2001) Poly-
nucleotide phosphorylase functions as both an exonu-
clease and a poly(A) polymerase in spinach
chloroplasts. Mol Cell Biol 21, 5408–5416.
30 Hajnsdorf E, Braun F, Haugel-Nielsen J & Regnier P
(1995) Polyadenylylation destabilizes the rpsO mRNA
of Escherichia coli. Proc Natl Acad Sci USA 92, 3973–
3977.
31 Haugel-Nielsen J, Hajnsdorf E & Regnier P (1996) The
rpsO mRNA of Escherichia coli is polyadenylated at
multiple sites resulting from endonucleolytic processing
and exonucleolytic degradation. EMBO J 15, 3144–
3152.
32 Valentin-Hansen P, Eriksen M & Udesen C (2004) The

bacterial Sm-like protein Hfq: a key player in RNA
transactions. Mol Microbiol 51, 1525–1533.
33 Yehudai-Resheff S & Schuster G (2000) Characteriza-
tion of the E. coli poly(A) polymerase: nucleotide speci-
ficity, RNA binding affinities and RNA structure
dependence. Nucleic Acids Res 28, 1139–1144.
34 Sippel AE (1973) Purification and characterization of
adenosine triphosphate: ribonucleic acid adenyltrans-
ferase from Escherichia coli. Eur J Biochem 37, 31–40.
35 Sano H & Feix G (1976) Terminal riboadenylate trans-
ferase from Escherichia coli. Eur J Biochem 71, 577–583.
36 Philippe C, Be
´
nard L, Eyermann F, Cachia C, Kirillov
SV, Portier C, Ehresmann B & Ehresmann C (1994)
Structural elements of rpsO mRNA involved in the
modulation of translational initiation and regulation of
E. coli ribosomal protein S15. Nucleic Acids Res 22,
2538–2546.
37 Philippe C, Benard L, Portier C, Westhof E, Ehresmann
B & Ehresmann C (1995) Molecular dissection of the
pseudoknot governing the translational regulation of
Escherichia coli ribosomal protein S15. Nucleic Acids
Res 23, 18–28.
38 Feng Y & Cohen SN (2000) Unpaired terminal nucleo-
tides and 5¢ monophosphorylation govern 3¢ polyadeny-
lation by Escherichia coli poly(A) polymerase I. Proc
Natl Acad Sci USA 97, 6415–6420.
39 Xu F & Cohen SN (1995) RNA degradation in
Escherichia coli regulated by 3¢ adenylation and 5¢ phos-

phorylation. Nature 374, 180–183.
40 Hajnsdorf E & Re
´
gnier P (1999) E. coli rpsO mRNA
decay: RNase E processing at the beginning of the cod-
ing sequence stimulates poly(A)-dependent degradation
of the mRNA. J Mol Biol 286, 1033–1043.
41 Mackie GA (1998) Ribonuclease E is a 5¢-end-depend-
ent endonuclease. Nature 395, 720–723.
42 Tock MR, Walsh AP, Carroll G & McDowall KJ
(2000) The CafA protein required for the 5¢-maturation
of 16S rRNA is a 5¢-end-dependent ribonuclease that
has context-dependent broad sequence specificity. J Biol
Chem 275, 8726–8732.
43 Jiang X, Diwa A & Belasco JG (2000) Regions of
RNase E important for 5¢-end-dependent RNA cleavage
and autoregulated synthesis. J Bacteriol 182, 2468–2475.
44 Mohanty BK & Kushner SR (2000) Polynucleotide
phosphorylase functions both as a 3¢fi5¢ exonuclease
and a poly(A) polymerase in Escherichia coli. Proc Natl
Acad Sci USA 97, 11966–11971.
45 de Haseth PL & Uhlenbeck OC (1980) Interaction of
Escherichia coli host factor protein with oligoriboadeny-
lates. Biochemistry 19, 6138–6146.
46 Brescia CC, Mikulecky PJ, Feig AL & Sledjeski DD
(2003) Identification of the HFq-binding site on DsrA
RNA: HFq binds without altering DsrA secondary
structure. RNA 9, 33–43.
47 Thore S, Mayer C, Sauter C, Weeks S & Suck D (2003)
Crystal structures of the Pyrococcus abyssi Sm core and

its complex with RNA: common features of RNA-bind-
ing in Archae and Eukarya. J Biol Chem 278, 1239–
1247.
48 Symmons MF, Jones GH & Luisi BF (2000) A dupli-
cated fold is the stuctural basis for polynucleotide phos-
phorylase catalytic activity, processivity and regulation.
Structure 8, 1215–1226.
49 Carmichael GG, Weber K, Niveleau A & Wahba AJ
(1975) The host factor required for RNA phage Qb
RNA replication in vitro. Intracellular location, quanti-
tation and purifcation by polyadenylate-cellulose chro-
matography. J Biol Chem 250, 3607–3612.
50 Raynal LC, Krisch HM & Carpousis AJ (1996) Bacter-
ial poly(A) polymerase: an enzyme that modulates RNA
stability. Biochimie 78, 390–398.
M. Folichon et al. Hfq binding to RNA stimulates elongation by PAP I
FEBS Journal 272 (2005) 454–463 ª 2004 FEBS 463