Tài liệu Báo cáo khoa học: Cloning, characterization and expression analysis of interleukin-10 from the common carp, Cyprinus carpio L. docx

Cloning, characterization and expression analysis of interleukin-10
from the common carp,
Cyprinus carpio
L.
Ram Savan
1
, Daisuke Igawa
2
and Masahiro Sakai
2
1
United Graduate School of Agricultural Sciences, Kagoshima University, Korimoto, Japan;
2
Faculty of Agriculture,
Miyazaki University, Miyazaki, Japan
Interleukin (IL)-10 was cloned from the common carp
(Cyprinus carpio L.) using IL-10 primers from carp head
kidney following stimulation with concanavalin A and
lipopolysaccharide. The cDNA consisted of a 1096 bp se-
quence containing a 55 bp 5¢ untranslated region and a
498 bp 3¢ untranslated region. An open reading frame of
543 bp encoded a putative 180 amino acid protein with a
putative signal peptide of 22 amino acids. The signature
motif of IL-10 is conserved in carp sequence. A 2083 bp
genomic sequence of carp IL-10 was found to contain five
exons interrupted by four introns. With the exception of
much more compact introns, the genomic structure was
similar to that of mammalian IL-10. By homology, phylo-
geny and genomic analyses, the carp gene cloned was des-
ignated as IL-10. Carp IL-10 was expressed in head, kidney,
liver, spleen and intestine during the resting phase. The gene

was also expressed in head kidney and liver following in vitro
stimulation with lipopolysaccharide.
Keywords: cytokines; interleukin; innate immunity; fish;
expression analysis.
Cytokines play a significant role in initiating and regulating
the inflammatory process, which is an important defense
system in innate immunity. Cytokines are subdivided into
families such as interleukins (ILs), lymphokines, growth
factors, interferons (IFNs) and chemokines. IL-10, initially
known as cytokine synthesis inhibitory factor, is a multi-
functional cytokine and demonstrates immunosuppressive
function. The main function of IL-10 seems to be regulation
of immunity and the inflammatory response, thereby
minimizing damage to the host induced by response to a
pathogen or by the self-immune system. IL-10 inhibits the
activation of macrophages/monocytes, thereby inhibiting
cytokine synthesis, nitric oxide (NO) production and the
expression of other costimulatory molecules. Apart from
IL-10 [1], a host of IL-10 family members such as IL-19 [2],
IL-20 [3], IL-22 [1], IL-24 [4] and IL-26 [5], have been
reported. Several IL-10 viral homologues have also been
reported [6], which mimic the activities of IL-10, suppressing
the immune system of the host to facilitate its survival [7].
As innate immunity is known to be important in the
defense of pathogens, isolation and characterization of
cytokines is of prime importance. Only a few cytokines and
chemokines are known in fish, where they have been cloned
either by expressed sequence tag (EST) analysis or by PCR-
mediated homology cloning. Among the cytokines, CC [8,9]
and CXC [10] chemokines, IL-1b [11], tumor necrosis

factor-a [12], transforming growth factor [13,14], IL-8 [15]
andIFN[16],haveallbeenclonedinfish.
Recently, IL-10 homologues from torafugu (Taki-
fugu rubripes) and spotted green puffer fish (Tetraodon
nigroviridis) have been submitted to the EMBL database
(accession numbers CAD62446 and CAD67773), facilita-
ted by the fugu sequencing project [17]. However, expres-
sion of IL-10 has not been reported in fish. This is the first
report of an investigation of the expression patterns of IL-
10 in fish, in different tissues and its inducibility, when
stimulated with lipopolysaccharide (LPS). The presence of
IL-10 in fish gives significant insight on the regulation of
the immune response in fish. By homology, phylogeny and
genome analyses, the carp gene cloned was confirmed as
IL-10.
Materials and methods
Fish
Common carp (mean weight 100 g) was obtained from
Sunaso fisheries farm (Miyazaki, Japan). The fish were
acclimatized in an aerated fresh water tank at 20 °C, under
a natural photoperiod, and fed for 2 weeks, prior to use in
the study.
Cloning and characterization of the carp IL-10 gene
A carp cDNA library, produced following stimulation with
concanavalin A and LPS [18], was used to isolate the IL-10
gene, employing IL-10-Fw2 and IL-10-Rv2 primers
(Table 1), which were designed based on the conserved
regions of puffer fish and mammalian IL-10. PCR was
performed using a PTC-200 (MJ Research, Waltham, MA,
USA) with 30 reaction cycles of: 30 s at 94 °C, 30 s at 58 °C

Correspondence to M. Sakai, Faculty of Agriculture, Miyazaki
University, Gakuen kibanadai nishi 1-1, Miyazaki 889-2192, Japan.
Fax: + 81 985 587219, Tel.: + 81 985 587219,
E-mail:
Abbreviations: EST, expressed sequence tag; IFN, interferon;
IL, interleukin; LPS, lipopolysaccharide; NO, nitric oxide;
UTR, untranslated region.
(Received 7 August 2003, revised 16 September 2003,
accepted 25 September 2003)
Eur. J. Biochem. 270, 4647–4654 (2003) Ó FEBS 2003 doi:10.1046/j.1432-1033.2003.03854.x
and 3 min at 72 °C, with a final extension for 7 min at
72 °C.
Genomic DNA was isolated from carp liver using a
formamide method, described previously [19]. PCR was
performed with 2 lL (500 ng) of template genomic DNA
using primers IL-10-Fw2 and IL-10-Rv2 (Table 1). After an
initial denaturation at 94 °C for 5 min, PCR cycling was
carried out (for 10 cycles) as follows: 10 s at 94 °C, 30 s at
57 °C,and2minat72°C. Amplification was carried out
for 20 cycles of the same temperature profile, but with an
increased holding time of elongation (3 s per cycle). A final
delay was allowed for 7 min at 72 °C. PCR products were
electrophoresed on a 1.5% (w/v) agarose gel for detection
of the specific bands.
All PCR reactions were performed according to the
following protocol: 5 lLofdNTPs(10l
M
of each dNTP),
0.5 lLofExTaq polymerase (5 UÆmL
)1

; Takara Bio Inc,
Japan), 5 lL of each gene-specific primer and 27.5 lL
of water. The products obtained were cloned into the
PGEM-T Easy vector (Promega, USA) and transformed
into JM109 by electroporation (BTX 399; Genetronics, San
Diego, CA, USA).
Sequence and phylogenetic analyses
The sequences were compared with those in the database by
using the
BLASTX
algorithm [20]. The signal sequences were
predicted using the
SIGNAL IP
program. Protein alignment
and percentage identities were calculated by
CLUSTAL W
using
BIOEDIT
software [21]. Hydropathy analyses of carp,
torafugu and human IL-10 amino acid sequences were
carried out [22]. Phylogenetic analysis was carried out for
the deduced amino acid sequences of carp and other IL-10
homologues. Phylogenetic trees were obtained by the
neighbor joining method, with 1000 replications to obtain
Bootstrap values, using
PAUP
software [23]. IFN-c was used
as an outgroup in this analysis.
Expression of the IL-10 gene
Analysis of IL-10 gene expression in healthy tissues by

RT–PCR. Total RNA extracted from the cell suspension
of organs isolated from healthy carp were used for cDNA
synthesis by ReverTra Dash (Toyobo, Osaka, Japan). Gene
specific primers IL-10-Fw3 and IL-10-Rv3 (Table 1) for IL-
10 amplification were designed using highly conserved
regions, and amplified product gave a specific product of
284 bp. A set of b-actin primers (forward:
5¢-ACTACCTCATGAAGATCCTG-3¢ and reverse:
5¢-TTGCTGACCACATCTGCTG-3¢) served as a control
for the quantity and quality of cDNA.
Semiquantitative analysis of RT–PCR products. Suspen-
sions of Carp head kidney and liver cells were treated with
10 lgÆmL
)1
LPS for 1, 3 and 6 h, individually, in RPMI-
Table 1. Primers used in this study.
Primers Sequence (5¢)3¢)
IL-10 forward2
GACTGTTGCTCATTTGTGGA
IL-10 reverse2 GAGGCTAGATACTGCTCGATGT
IL-10 forward3 TGATGATTTGGAACCATTATTGAA
IL-10 reverse3 CACCTTTTTCCTTCATCTTTTCAT
b-Actin forward1 ACTACCTCATGAAGATCCTG
b-Actin reverse1 TTGCTGATCCACATCTGCTG
T7- forward TAATACGACTCACTATAGGG
SP6-reverse ATTTAGGTGACACTATAGAA
Fig. 1. Genomic sequence structure of carp IL-10. Coding sequences are shown in uppercase, whereas the untranslated region (UTR) and introns are
shown in lower case. Intron splice sites (gt or ag) are shown in italics. The deduced amino acid sequence is given below the nucleotides. The motifs
associated with mRNA instability are shown in bold and the polyadenylation signal in bold italics. The stop codon is represented with an asterisk.
4648 R. Savan et al. (Eur. J. Biochem. 270) Ó FEBS 2003

1640 supplemented with 10% carp serum and 1% strepto-
mycin/penicillin. Controls of the same cells were incubated
for 0, 1, 3 and 6 h in identical medium but without LPS.
Total RNA extracted from cells after culture was used for
cDNA synthesis (ReverTra Dash; Toyobo).Semiquantita-
tive analysis was carried out according to the method
described by Laing et al. [24]. In order to adopt a more
semiquantitative approach for analysing IL-10 gene expres-
sion, both carp IL-10 and b-actin genes were amplified using
a range (21–30) of PCR cycles. Following this procedure, an
optimal number of PCR cycles (24 for IL-10 and 21 for b-
actin) was determined and subsequently employed in the
above expression analysis. The carp IL-10 gene/b-actin ratio
was determined by densitometry, performed by measuring
the photo-stimulated luminescence values using
SCIENCE
LAB
99
IMAGE GAUGE
software (Fujifilm, Tokyo, Japan)
and by comparing the carp IL-10 transcript levels with those
of b-actin.
PCR conditions
All PCR reactions were performed according to the
following protocol: 1 lL of cDNA was mixed with 5 lL
of dNTPs (10 l
M
of each dNTP), 10 · Gene Taq Universal
buffer, 0.5 lLofTaq polymerase (5 UÆmL
)1

; Nippon Gene,
Tokyo, Japan), 5 lL of each gene specific primer (5 l
M
),
2 lL of cDNA and 27.5 lL of distilled water. The PCR was
performed using a PTC-200 thermal cycler (MJ Research)
with predetermined reaction cycles of 30 s at 94 °C, 30 s
at 56 °C (IL-10) and 57 °C(b-actin), and 1 min at 72 °C.
PCR products were electrophoresed on a 2.0%
(w/v) agarose gel to enable detection of the specific bands.
Results
Cloning of the IL-10 gene from carp
By using PCR primers based on the conserved regions of
mammalian IL-10 homologues and the torafugu IL-10
genomic sequence, we isolated a clone of 440 bp (resem-
bling mammalian IL-10) from carp head kidney cells
stimulated with LPS and concanavalin A [18]. The 5¢ and
3¢ termini of the clone were obtained by anchored PCR.
This enabled us to clone additional sequences of 145 and
518 bp at the 5¢ and 3¢ ends, respectively. Thus, the fully
cloned carp IL-10 cDNA consisted of a sequence of
1096 bp comprising a 55 bp 5¢ untranslated region (UTR),
a 543 bp open reading frame encoding an 180 amino acid
peptide, and a 498 bp 3¢-UTR (Fig. 1). The 3¢-UTR
contains two ÔATTTAÕ inflammatory motifs compared
with five such segments in human IL-10 and contains a
single typical polyadenylation signal (AATAAA) between
nucleotides 1074–1079. The predicted cleavage site of the
signal sequence to the mature protein is between Gln21
and Cys22 (Fig. 2). The putative carp IL-10 is an 18 000

molecular mass polypeptide with a pI of 7.89. A similar
Fig. 2. Alignment of the deduced amino acid sequence of carp IL-10 with other homologues in pufferfish and mammalian counterparts. Identical amino
acid residues are indicated by dashes (–), while dots indicate gaps that have been introduced for optimal alignment. IL-10 signature motifs are
shown in the box. The position of A–F helices that has been determined in human IL-10 is shown as a ladder in the alignment. Cysteines from the
matured proteins forming disulphide bonds are denoted as numbers relative to their positions. The arrowheads depict the residues important for
the structural core of the IL-10 gene. The underlined amino acid residues are the signal sequences of the respective genes. The asterisk indicates the
residues important for an interaction with the IL-10R/R1 receptor chain. The accession numbers of the IL-10 sequences used in the alignment are as
follows: human, NP_000563; cat, AAC64708; rat, CAA43090; mouse, A34853.
Ó FEBS 2003 Cloning and analysis of IL-10 in fish (Eur. J. Biochem. 270) 4649
hydropathy profile was observed in torafugu and carp IL-
10 sequences (Fig. 3). The sequence is deposited with
DDBJ under the accession number AB110780.
Genomic structure of carp IL-10
Using the carp primers IL-10-Fw2 and IL-10-Rv2, we
amplified a product of 1.4 kbp from carp genomic DNA.
A 1403-bp IL-10 genomic sequence was obtained upon
sequencing of the cloned product using T7 or SP6 primers
(Fig. 1). The carp IL-10 is composed of five exons and four
introns, and thus similar to its mammalian counterparts.
The exons were positioned exactly to the exons in
mammalian IL-10. Typical intron splice motifs were
observed at the 5¢ (GT) and 3¢ (AG) ends of each intron.
The four introns are 150, 242, 444 and 119 bp in length,
respectively. However, while the mammalian counterpart
spanned > 5.5 kb, the carp IL-10 was only  2 kb.
Structural and phylogenetic analyses of carp IL-10
Alignment of the deduced amino acid sequence of IL-10
with those of mammalian homologues revealed common
structural features (Fig. 2). The IL-10 signature sequence
motif [KQS]-x(4)-C-[QYC]-x(4)-[LIVM](2)-x-[FL]-[LMV]-

x-[DERT]-[IV]-[LMF] is conserved except that the first
aminoacidisNreplacedfor[KQS]andMfor[LMV].
Another conserved motif present in the F-helix, KALGEL-
DIL, is conserved in carp IL-10 as in other mammalian
IL-10 family members. Four conserved cysteine residues in
human IL-10 and IL-22 were found to be conserved in carp
IL-10. The first cysteine forms a disulphide linkage with the
third cysteine found on the D-helix. The second cysteine
forms a disulphide bond with the fourth cysteine between
the D–E helix. A high degree of conservation is seen around
the C-terminal region, especially at the F-helix of the
mammalian counterparts.
Comparatively high homology was recorded to torafugu
(43.2%) and spotted green pufferfish (37.6%). Low
sequence identities of  20–28% were observed for mam-
malian and viral IL-10 homologues. Very low sequence
identity of 12–21% was seen in members of the IL-10 family
(Table 2). Phylogenetic analysis was carried out by neighbor
joining and the
PAUP
software (Fig. 4). IFN-c was used as
an outgroup, as this gene is structurally related to IL-10.
Expression analysis of IL-10 by RT-PCR
RT-PCR was used to analyse expression of the IL-10 gene
in normal (healthy) tissues of carp (Fig. 5). Using the
primers IL-10-Fw3 and IL-10-Rv3 (Table 1), a 284 bp
product was obtained from head kidney, spleen, intestine
and gill tissues; however, a more pronounced expression of
carp IL-10 was observed in head kidney and intestine
tissues. A semiquantitative analysis of IL-10 expression in

head kidney and liver tissues was carried out using a time
course in vitro stimulation with LPS (Fig. 6). A relative
increase of IL-10 gene expression was seen at 1 h poststim-
ulation and showed a slight decrease at 3 h, producing a low
intensity product at 6 h in head kidney. In liver, the IL-10
Fig. 3. Hydropathy plot of putative IL-10 proteins from carp, torafugu
and human. The x-axis denotes the residue position and the y-axis
represents hydrophobicity. The hydrophobicity analysis was carried
out according to the Kyte and Doolittle method [22] using
GENETYX
software.
Table 2. Identities of cellular, viral and family members of interleukin
(IL)-10 to the carp gene.
Species
Accession
number
Identities to carp
IL-10 (%)
Overall Mature
Torafugu CAD62446 43.2 45.7
Spotted green pufferfish CAD67773 37.6 39.3
Human NP_000563 28.0 26.6
Cat AAC64705 28.5 26.6
Rat CAA43090 25.2 25.1
Mouse A34853 25.2 25.1
Virus IL-10 homologues
Human Epstein–Barr virus IL-10 CAA24863 27.4 26.9
Equine herpes virus type 2 IL-10 AAB26148 28.0 26.6
Human cytomegalovirus CAA24863 27.0 25.7
Human IL-10 family members

IL-19 AAG16755 18.3 16.0
IL-20 NP_061194 21.9 19.0
IL-22 AAK62468 14.0 13.8
IL-24 AAG41401 12.9 14.3
IL-26 NP_060872 16.9 15.0
4650 R. Savan et al. (Eur. J. Biochem. 270) Ó FEBS 2003
product was present at all time-points of incubation, except
for the 0 h control. The highest level of expression was seen
at 1 h post-LPS stimulation of liver cells.
Discussion
IL-10, a helical cytokine, was initially isolated by Mos-
mann [25], in humans, and then subsequently in mouse,
rat and other mammalian counterparts [26–28]. In the
present work we isolated and characterized a carp cDNA
sequence that is homologous to the DNA sequence of
mammalianIL-10.CarpIL-10is1096bpinlengthand
encodes a 180 amino acid protein similar to that of
torafugu and mammalian counterparts. Compared with
other family members containing the IL-10 gene, human
IL-19 and IL-24 encode longer polypeptides of 215 and
206 amino acids, respectively; these polypeptides are
longer because they contain an additional in-frame
methionine codon upstream as a result of alternative
splicing [29]. Carp IL-10 shares a higher similarity to
mammalian IL-10 (25–28%), when compared with the
other IL-10 family members (16–21%). Spotted green
pufferfish IL-20 (AY294560) and IL-24 (AY294560) share
identities of 16 and 20% with carp IL-10, which is low
when compared with the torafugu IL-10 gene. Phylo-
genetic analyses reveal that the carp IL-10 sequence is

closer to human and pufferfish (torafugu and spotted green
pufferfish) IL-10 sequences. Pufferfish and carp IL-10
genes, clustered together and distant from IL-20 and IL-
24, as recently determined from analysis of the spotted
green pufferfish genome, imply that the carp sequence is
IL-10. The hydropathy analysis also shows similarity of
the torafugu IL-10 sequence to its carp counterpart. These
comparisons suggest that carp IL-10 shares many char-
acteristics of IL-10 with its family members.
The general IL-10 signature sequence comprises a 21
amino acid sequence that is conserved in the carp IL-10
sequence. The first residue in the IL-10 signature sequence is
Lys, except for carp, in which it is Asn. The seventh residue
is His in all three fish sequences, but Gln in mammals. The
second motif (KALGELDL) on the F-helix, which is
conserved in all other family members, is conserved in carp
IL-10. Regions that form the helices in the human IL-10
sequence show a degree of similarity to the carp IL-10
sequence. The most highly conserved stretch in the IL-10
family is at the C-terminus in the C-helix and at the N-
terminus of the F-helix; a similar pattern was also found in
carp IL-10.
By X-ray crystallographic studies, human and viral
homologues of IL-10 are known to have a structure similar
to that of IFN-c, i.e. a noncovalent symmetric homodimer
that forms V-shaped dimers [30,31]. The monomers are
characterized by two disulphide bonds and six a helices. The
structurally important cysteine residues, which form
the disulphide bonds, are all conserved in carp IL-10.
The residues reported to be key in stabilizing the structural

core in IL-10 and IFN-c (Leu, Phe, Tyr and Ala), are also
strictlyconservedincarpIL-10.
Genomic analysis revealed that the carp IL-10 gene
contained four introns, which is similar to the human IL-10,
IL-20 and IL-26 gene sequences. The intron/exon areas are
also conserved in carp IL-10; however, the introns were more
compact in carp IL-10 than in its mammalian counterparts.
IL-22, IL-19 and IL-24, which are also family members of
IL-10, contain five introns. This confirms that the carp gene
cloned in this study is, in fact, IL-10, as it has the same intron/
exon structure as human IL-10 (Fig. 7) and shows a higher
homology with IL-10 than with IL-20 or IL-26.
The presence of the instability motifs are known to
influence mRNA half-life and translational efficiency.
Fig. 5. Expression patterns of the common carp IL-10 gene from
unstimulated organs studied by RT-PCR. b-Actinwasusedasacontrol
of the amount and quality of cDNA.
Fig. 4. An unrooted phylogenetic tree constructed by the neighbor join-
ing method (using
PAUP
software) from the amino acid sequences of the
IL-10 family together with the carp IL-10 gene. The numbers indicate
the bootstrap confidence values obtained for each node after 1000
replications. The accession numbers of the sequences used in the
alignment are as follows: from humans, Epstein–Barr virus IL-10
(CAA24863), IL-10 (NP_000563), IL-19 (AAG16755), IL-20
(NP_061194), IL-22 (AAK62468), IL-24 (AAG41401),
IL-26 (NP_060872) and interferon-a (P01579); from torafugu IL-10
(CAD62446); from spotted green pufferfish IL-10 (CAD 67773), IL-20
(AY294557) and IL-24 (AY294560); and from carp IL-10 (AB110780).

Ó FEBS 2003 Cloning and analysis of IL-10 in fish (Eur. J. Biochem. 270) 4651
The carp IL-10 harbored two instability motifs, in
comparison to five in human IL-10, in the 3¢-UTR.
Whether this difference in the number of instability
motifs affects translation needs to be investigated in
future studies.
LPS induction alone, and costimulation with LPS and
IFN-c or IL-13, resulted in expression of the human IL-10
gene. However, when human monocytes were stimulated
with LPS (100 ngÆmL
)1
) alone, strong expression was not
seen until 2–4 h after stimulation [2]. In our study, we
observed IL-10 gene expression in spleen, head kidney, gill
and intestine from healthy tissues of carp. When stimulated
with LPS, an increase in expression at 1 h poststimulation
was recorded in both head kidney and liver. This indicates
that the gene is inducible by LPS stimulation. Administra-
tion of endotoxin induced IL-10 production in mice,
chimpanzees, baboons and humans [32–35]. The presence
of endogenous IL-10 confers protection from the lethal
effects of endotoxin challenge and reduces the levels of
TNF, IFN-c and macrophage inflammatory protein-2 [36].
Although the expression study indicates that this cytokine is
involved in the immune response, further experiments on
the regulatory mechanisms of carp IL-10 expression and its
role in the regulation of other pro-inflammatory genes, such
as TNF and IFN, in fish, need to be conducted.
In conclusion, the IL-10 gene from carp has been isolated
and its genomic structure and expression analysis investi-

gated. This work will pave the way for further investigation
of the biological function of this gene, and the probability of
the presence of IL-10-related genes in fish, as seen in
mammals.
Acknowledgements
This study was supported, in part, by a grant from the ÔResearch for the
Future (JSPS-RFTF 97L00902)Õ program from the Japan Society for
the Promotion of Science.
References
1. Dumoutier, L., Louahed, J. & Renauld, J.C. (2000) Cloning and
characterization of IL-10-related T cell-derived inducible factor
(IL-TIF), a novel cytokine structurally related to IL-10 and
inducible by IL-9. J. Immunol. 164, 1814–1819.
Fig. 7. Schematic representation of IL-10
intron/exon organization together with human
IL-10 structure. Boxes are exons and hori-
zontal lines are introns, with their nucleotide
lengths. Shaded areas represent 5¢ and 3¢
UTRs.
Fig. 6. Semiquantitative RT-PCR of IL-10 gene expression by LPS stimulation performed for head kidney and liver. Data are presented as PCR
products after normalizing against products of b-actin. The x-axis indicates the time-periods of LPS incubation and the relative expression of the
carp IL-10 gene on the y-axis. Controls for 0, 1, 3 and 6 h of incubation without LPS are also shown in the graph.
4652 R. Savan et al. (Eur. J. Biochem. 270) Ó FEBS 2003
2. Gallagher, G., Dickensheets, H., Eskdale, J., Izotova, L.S.,
Mirochnitchenko, O.V., Peat, J.D., Vazquez, N., Pestka, S.,
Donnelly, R.P. & Kotenko, S.V. (2000) Cloning, expression and
initial characterization of interleukin-19 (IL-19), a novel
homologue of human interleukin-10 (IL-10). Genes Immun. 1,
442–450.
3. Blumberg, H., Conklin, D., Xu, W.F., Grossmann, A., Brender,

T., Carollo, S., Eagan, M., Foster, D., Haldeman, B.A., Ham-
mond, A., Haugen, H., Jelinek, L., Kelly, J.D., Madden, K.,
Maurer, M.F., Parrish-Novak, J., Prunkard, D., Sexson, S.,
Sprecher, C., Waggie, K., West, J., Whitmore, T.E., Yao, L.,
Kuechle, M.K., Dale, B.A. & Chandrasekher, Y.A. (2001)
Interleukin 20: discovery, receptor identification, and role in
epidermal function. Cell 104, 9–19.
4. Jiang,H.,Lin,J.J.,Su,Z.Z.,Goldstein,N.I.&Fisher,P.B.(1995)
Subtraction hybridization identifies a novel melanoma differen-
tiation associated gene, mda-7, modulated during human mel-
anoma differentiation, growth and progression. Oncogene 11,
2477–2486.
5. Knappe, A., Hor, S., Wittmann, S. & Fickenscher, H. (2000)
Induction of a novel cellular homolog of interleukin-10, AK155,
by transformation of T lymphocytes with herpesvirus saimiri.
J. Virol. 74, 3881–3887.
6. Kotenko, S.V., Saccani, S., Izotova, L.S., Mirochnitchenko, O.V.
& Pestka, S. (2000) Human cytomegalovirus harbors its own
unique IL-10 homolog (cmvIL-10). Proc. Natl Acad. Sci. USA 97,
1695–1700.
7. Spencer,J.V.,Lockridge,K.M.,Barry,P.A.,Lin,G.,Tsang,M.,
Penfold, M.E. & Schall, T.J. (2002) Potent immunosuppressive
activities of cytomegalovirus-encoded interleukin-10. J. Virol. 76,
1285–1292.
8. Fujiki, K., Shin, D.H., Nakao, M. & Yano, T. (1999) Molecular
cloning of carp (Cyprinus carpio) CC chemokine, CXC chemo-
kine receptors, allograft inflammatory factor-1, and natural killer
cell enhancing factor by use of suppression subtractive hybrid-
ization. Immunogenetics 49, 909–914.
9. Kono, T., Fujiki, K., Nakao, M., Yano, T., Endo, M. & Sakai,

M. (2002) The immune responses of common carp, Cyprinus
carpio L.,injectedwithcarpinterleukin-1betagene.J. Interferon
Cytokine Res. 22, 413–419.
10. Savan, R., Kono, T., Aman, A. & Sakai, M. (2003) Isolation and
characterization of a novel CXC chemokine in common carp
(Cyprinus carpio L.). Mol. Immunol. 39, 829–834.
11. Fujiki, K., Shin, D.H., Nakao, M. & Yano, T. (2000) Molecular
cloning and expression analysis of carp (Cyprinus carpio)
interleukin-1 beta, high affinity immunoglobulin E Fc receptor
gamma subunit and serum amyloid A. Fish Shellfish Immunol. 10,
229–242.
12. Saeij, J.P., Stet, R.J., de Vries, B.J., van Muiswinkel, W.B. &
Wiegertjes, G.F. (2003) Molecular and functional characteriza-
tion of carp TNF: a link between TNF polymorphism and try-
panotolerance? Dev. Comp. Immunol. 27, 29–41.
13. Sumathy, K., Desai, K.V. & Kondaiah, P. (1997) Isolation of
transforming growth factor-beta2 cDNA from a fish, Cyprinus
carpio,byRT–PCR.Gene 191, 103–107.
14. Zhan, Y. & Jimmy, K. (2000) Molecular isolation and
characterisation of carp transforming growth factor beta 1
from activated leucocytes. Fish Shellfish Immunol. 10,309–
318.
15. Najakshin, A.M., Mechetina, L.V., Alabyev, B.Y. & Taranin,
A.V. (1999) Identification of an IL-8 homolog in lamprey
(Lampetra fluviatilis): early evolutionary divergence of chemok-
ines. Eur. J. Immunol. 29, 375–382.
16. Altmann, S.M., Mellon, M.T., Distel, D.L. & Kim, C.H. (2003)
Molecular and functional analysis of an interferon gene from the
zebrafish, Danio rerio. J. Virol. 77, 1992–2002.
17. Zou,J.,Clark,M.S.&Secombes,C.J.Characterisation,expres-

sion and promoter analysis of an interleukin 10 homologue in the
puffer fish, Fugu rubripes. Immunogenetics 55, 325–335.
18. Savan, R. & Sakai, M. (2002) Analysis of expressed sequence tags
(EST) obtained from common carp, Cyprinus carpio L., head
kidney cells after stimulation by two mitogens, lipopolysacchar-
ide and concanavalin-A. Comp. Biochem. Physiol. B Biochem.
Mol. Biol. 131, 71–82.
19. Sambrook, J., Fritsch, E.F. & Maniatis, T. (2001) Molecular
Cloning: A Laboratory Manual, 3rd edn. Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, New York.
20. Altschul, S.F., Gish, W., Miller, W., Meyers, E.W. & Lipman,
D.J. (1990) Basic local alignment search tool. J. Mol. Biol. 215,
403–410.
21. Hall, T.A. (1999) Bioedit: a user friendly biological sequence
alignment editor and analysis program for Windows 95/98/NT.
Nucleic Acids Symp. Ser. 41, 95.
22. Kyte, J. & Doolittle, R.F. (1982) A simple method for displaying
the hydropathic character of a protein. J. Mol. Biol. 157, 105–132.
23. Swofford, D.L. (1998)
PAUP
* Phylogenetic Analysis Using Par-
simony (*and Other Methods), 4th edn. Sinauer Associates,
Sunderland, Massachussetts.
24. Laing, K.J., Holland, J., Bonilla, S., Cunningham, C. & Secom-
bes, C.J. (2001) Cloning and sequencing of caspase 6 in rainbow
trout, Oncorhynchus mykiss, and analysis of its expression under
conditions known to induce apoptosis. Dev. Comp. Immunol. 25,
303–312.
25. Mosmann, T. (1994) Properties and function of interleukin-10.
Adv. Immunol. 56, 1–26.

26.Moore,K.W.,Vieira,P.,Fiorentino,D.F.,Trounstine,M.L.,
Khan, T.A. & Mosmann, T.R. (1990) Homology of cytokine
synthesis inhibitory factor (IL-10) to the Epstein–Barr virus gene
BCRFI. Science 8, 1230–1234.
27. Vieira, P., de Waal-Malefyt, R., Dang, M.N., Johnson, K.E.,
Kastelein, R., Fiorentino, D.F., deVries, J.E., Roncarolo, M.G.,
Mosmann, T.R. & Moore, K.W. (1991) Isolation and expression
of human cytokine synthesis inhibitory factor cDNA clones:
homology to Epstein–Barr virus open reading frame BCRFI.
Proc.NatlAcad.Sci.USA88, 1172–1176.
28. Goodman, R.E., Oblak, J. & Bell, R.G. (1992) Synthesis and
characterization of rat interleukin-10 (IL-10) cDNA clones from
the RNA of cultured OX8- OX22- thoracic duct T cells. Biochem.
Biophys. Res. Commun. 30,1–7.
29. Kotenko, S.V. (2002) The family of IL-10-related cytokines and
their receptors: related, but to what extent? Cytokine Growth
Factor Rev. 13, 223–240.
30. Zdanov, A., Schalk-Hihi, C., Menon, S., Moore, K.W. &
Wlodawer, A. (1997) Crystal structure of Epstein–Barr virus
protein BCRF1, a homolog of cellular interleukin-10. J. Mol.
Biol. 2, 460–467.
31. Zdanov, A., Schalk-Hihi, C., Gustchina, A., Tsang, M., Weath-
erbee, J. & Wlodawer, A. (1995) Crystal structure of interleukin-
10 reveals the functional dimer with an unexpected topological
similarity to interferon gamma. Structure 15, 591–601.
32. Pajkrt, D., Camoglio, L., Tiel-van Buul, M.C., de Bruin, K.,
Cutler, D.L., Affrime, M.B., Rikken, G., van der Poll, T., ten
Cate, J.W. & van Deventer, S.J. (1997) Interleukin-10 inhibits
activation of coagulation and fibrinolysis during human endo-
toxemia. Blood 15, 2701–2705.

33. Durez, P., Abramowicz, D., Gerard, C., Van Mechelen, M.,
Amraoui, Z., Dubois, C., Leo, O., Velu, T. & Goldman, M.
(1993) In vivo induction of interleukin 10 by anti-CD3 mono-
clonal antibody or bacterial lipopolysaccharide: differential
modulation by cyclosporin A. J. Exp. Med. 177, 551–555.
34. Jansen, P.M., van der Pouw Kraan, T.C., de Jong, I.W., van
Mierlo, G., Wijdenes, J., Chang, A.A., Aarden, L.A., Taylor,
Ó FEBS 2003 Cloning and analysis of IL-10 in fish (Eur. J. Biochem. 270) 4653
F.B. Jr & Hack, C.E. (1996) Release of interleukin-12 in
experimental Escherichia coli septic shock in baboons: relation to
plasma levels of interleukin-10 and interferon-gamma. Blood 87,
5144–5151.
35. Marchant, A., Bruyns, C., Vandenabeele, P., Abramowicz, D.,
Gerard,C.,Delvaux,A.,Ghezzi,P.,Velu,T.&Goldman,M.
(1994) The protective role of interleukin-10 in endotoxin shock.
Prog. Clin. Biol. Res. 388, 417–423.
36. Standiford,T.J.,Strieter,R.M.,Lukacs,N.W.&Kunkel,S.L.
(1995) Neutralization of IL-10 increases lethality in endotoxemia.
Cooperative effects of macrophage inflammatory protein-2 and
tumor necrosis factor. J. Immunol. 155, 2222–2229.
4654 R. Savan et al. (Eur. J. Biochem. 270) Ó FEBS 2003