Tài liệu Báo cáo khoa học: Stem–loop oligonucleotides as tools for labelling double-stranded DNA pdf

Stem–loop oligonucleotides as tools for labelling
double-stranded DNA
Be
´
ne
´
dicte Ge
´
ron-Landre, Thibaut Roulon and Christophe Escude
´
Laboratoire ‘Re
´
gulation et Dynamique des Ge
´
nomes’, De
´
partement ‘Re
´
gulations, De
´
veloppement et Diversite
´
Mole
´
culaire’, Muse
´
um
National d’Histoire Naturelle, Paris
Triple-helix forming oligonucleotides (TFOs) repre-
sent an interesting tool for the sequence-specific
recognition of double-stranded DNA. They can be

used for the artificial modulation of DNA informa-
tion processing [1] and for other applications that
take place in vitro, such as double-stranded DNA
isolation, labelling or modification (reviewed in [2]).
Formation of DNA triple helices has been studied in
details for the past 15 years (reviewed in [3]). Two
different motifs of DNA triple helices can be
formed, depending on the base composition of
the TFO. Binding of the TFO occurs at oligopurineÆ
oligopyrimidine sequences. Pyrimidine-rich oligonucleo-
tides bind with a parallel orientation with respect to
the oligopurine strand, by forming TÆAxT and
CÆGxC
+
base triplets, whereas purine-rich oligonucleo-
tides bind with an antiparallel orientation by forma-
tion of TÆAxT, TÆAxA or CÆGxG base triplets. The
conditions that favour triple-helix formation have
been well characterized. The pyrimidine motif is usu-
ally more stable at acidic pH, due to the require-
ment for cytosine protonation, whereas very stable
triple helices can be formed within the purine motif
at neutral pH, provided the target sequence contains
a high proportion of CÆG pairs and dications
are present. G-rich oligonucleotides often fold into
G-tetrad containing structures that can compete with
triple-helix formation, thereby limiting in practice the
use of this type of triple helix. Various strategies
have been developed that permit the recognition of
mixed sequence duplex DNA targets at physiological

pH [4,5].
Keywords
triple helix; DNA labeling; stem–loop
oligonucleotide; sequence specificity;
padlock oligonucleotide
Correspondence
C. Escude
´
, Laboratoire ‘Re
´
gulation et
Dynamique des Ge
´
nomes’, De
´
partement
‘Re
´
gulations, De
´
veloppement et Diversite
´
Mole
´
culaire’, USM 0503 Muse
´
um National
d’Histoire Naturelle, CNRS UMR5153,
INSERM U565, Case Postale 26, 43 rue
Cuvier, F-75231 Paris Cedex 05, France

Fax: +33 14079 3705
Tel: +33 14079 3774
E-mail:
(Received 23 June 2005, revised 17 August
2005, accepted 23 August 2005)
doi:10.1111/j.1742-4658.2005.04932.x
We report on a sequence-specific double-stranded DNA labelling strategy
in which a stem–loop triplex forming oligonucleotide (TFO) is able to
encircle its DNA target. Ligation of this TFO to either a short hairpin
oligonucleotide or a long double-stranded DNA fragment leads to the for-
mation of a topological complex. This process requires the hybridization of
both extremities of the TFO to each other on a few base pairs. The effects
of different factors on the formation of these complexes have been investi-
gated. Efficient complex formation was observed using both GT or TC
TFOs. The stem–loop structure enhances the specificity of the complex.
The topologically linked TFO remains associated with its target even under
conditions that do not favour triple-helix formation. This approach is suffi-
ciently sensitive for detection of a 20-bp target sequence at the subfemto-
molar level. This study provides new insights into the mechanics and
properties of stem–loop TFOs and their complexes with double-stranded
DNA targets. It emphasizes the interest of such molecules in the develop-
ment of new tools for the specific labelling of short DNA sequences.
Abbreviations
BQQ, (6-[3-(dimethylamino)propyl]amino-11-methoxy-benzo[f]quino-[3,4-b]quinoxaline); TFO, triplex forming oligonucleotide.
FEBS Journal 272 (2005) 5343–5352 ª 2005 FEBS 5343
For in vitro applications, the experimental conditions
can be chosen to favour the formation of very stable tri-
ple helices. Nevertheless, it may be desirable to form
complexes that will resist extensive washing or an
important dilution. TFOs can be covalently linked to

their target by photocrosslinking of psoralen–oligo-
nucleotide conjugates [6,7] or by using oligonucleotides
conjugated to alkylating agents such as chlorambucyl
[8]. We have described a triple-helical complex in which
the third strand is topologically linked to its target [9].
This was achieved by circularization of the TFO after it
had wound around its double-stranded DNA target
thanks to triple-helix formation. When the target was
carried by a circular DNA, i.e. a plasmid, the TFO was
irreversibly linked to the plasmid. We have shown that
the stability of the triple helix made by the topologically
linked TFO, also called padlock oligonucleotide, was
enhanced compared to that formed with a linear TFO
[10]. For example, we showed that such a padlock oligo-
nucleotide strongly inhibits DNA digestion by a restric-
tion endonuclease, and that the complex is strong
enough to inhibit the elongation of transcription by an
RNA polymerase [11]. The triple helix used in these
studies involved a third strand containing G and T,
binding of which was stabilized by the use of a triplex
specific intercalator. This made possible the use of a
third strand which did not contain many Gs. Moreover,
as the triple helix was not stable in the absence of inter-
calator, it was possible to switch easily from conditions
where the triple helix was very stable to conditions
where it was totally unstable. A derivative of this
approach was developed in which the ends of the TFO
hybridized to each other and were ligated to either a
short stem–loop oligonucleotide or to a DNA fragment
that had a complementary sticky end (Fig. 1). The

formation of these structures may be used for the pur-
pose of grafting ligands to double-stranded DNA [12] or
for visualizing short double-stranded sequences by fluor-
escence microscopy [13]. Both structures were formed
only if the samples were heated before the ligation
reaction was started. Our idea was that the stem could
dissociate upon heating, thereby allowing triple-helix
formation between the loop of the TFO and the target
during the cooling step, before rehybridization of the
complementary sequences in the stem can take place. A
stem length of 6 or 8 bp had been arbitrarily chosen in
both studies. Although the topological link has been
clearly established for both structures, no detailed study
regarding the influence of stem length and heating con-
ditions had been performed.
The aim of the present study was to investigate the
features of this type of complex. Efficient complex for-
mation was observed using both the pyrimidine and
purine motif triple helices. In particular, the influence
of heating conditions and of the length of the stem has
been studied as well as the specificity and the sensitiv-
ity of this approach for DNA detection.
Results
Oligonucleotide design and labelling strategy
We chose as a target sequence for the present study a
20-bp oligopurineÆoligopyrimidine sequence that is re-
presented only once in the yeast genome (D. Polverari
and J.S. Sun, personal communication). We designed
two types of TFO with a stem–loop structure that can
form a triple helix by binding to this sequence (Fig. 2).

The first type contains G and T in the loop of the
AB
Fig. 1. Scheme of the padlock structures. The central part of the
TFO forms a triplex with the target dsDNA. The 5¢-and3¢-part of
the TFO hybridize to each other, thereby forming a short double-
stranded stem, and leaving a four nucleotide single-stranded dan-
gling end. This end hybridizes to the complementary extremity of
either a short hairpin oligonucleotide (A) or a long DNA fragment
(B). A ligation reaction results in the formation of a closed dumbell-
like oligonucleotide or a very long stem–loop structure. In both
cases, the TFO encircles the target. Rupture of the topological link
requires cleavage of the circular oligonucleotide (A) or denaturation
of the double-stranded DNA (B).
Fig. 2. Sequence of targets and TFOs used in this study. The cen-
tral part of TG and TC TFOs as well as the target sequences inser-
ted in plasmids pY, pY1m and pY2m are shown. The pY plasmid
contains a 20-bp oligopurineÆoligopyrimidine target sequence,
shown in bold. The pY1m and pY2m plasmids have the same
target sequence as pY except for one or two mismatch(es),
respectively, which are shown underscored. This sequence can
form a triplex made of TÆAxT and CÆGxC
+
triplets with a parallel TC
TFO or a triplex made of TÆAxT and CÆGxG triplets with an antiparallel
TG TFO.
Stem–loop padlock oligonucleotides for dsDNA B. Ge
´
ron-Landre et al.
5344 FEBS Journal 272 (2005) 5343–5352 ª 2005 FEBS
TFO and can form a triple helix in the presence of the

triplex-stabilizing agent 6-[3-(dimethylamino)propyl]-
amino-11-methoxy-benzo[f]quino-[3,4-b]quinoxaline
(BQQ), as already described in our previous work
[10–14]. The second one can form a triple helix at
acidic pH. The 3¢- and 5¢-regions of the TFO can
hybridize to each other, thereby forming a short
double-stranded stem of variable length and leaving
a 4-base single-stranded dangling 5¢-end, which can be
ligated using T4 DNA ligase to any DNA with a com-
plementary sticky end. The sequences of the TFOs
used in this study are summarized in Table 1. These
TFOs can be ligated to either a short hairpin oligo-
nucleotide or a DNA fragment with a 4-bases sticky
end (Fig. 1). In both cases, ligation in the presence of
the double-stranded target DNA may result in the for-
mation of a topologically linked complex, which we
call a padlock. We checked by denaturing PAGE that
all the stem–loop TFOs could be efficiently ligated to
the hairpin oligonucleotide under the experimental
conditions used in the absence of the target DNA,
irrespective of the length of the stem (data not shown).
Padlock formation with GT oligonucleotides
We first studied the formation of topologically linked
complexes using GT TFOs and the short hairpin oligo-
nucleotide. The TFO was radiolabelled and used in
excess over the amount of target. After the ligation
reaction, samples were analysed by agarose gel electro-
phoresis and autoradiographed. Two bands are
observed, corresponding to the supercoiled and relaxed
forms of the plasmid. The labelling yield can be esti-

mated from the amount of labelled oligonucleotide
that comigrates with the plasmid. No labelling was
observed when the samples were not heated (Fig. 3B,
lane 4) or when ligase was omitted (data not shown).
The length of the stem was varied from 6 to 11 bp (see
Table 1 for sequences). The maximal yields were
achieved for lengths between 8 and 10 bp (Fig. 3A,
lanes 1–4). We tried to vary the cooling rate between
80 °C and 30 °C. The best yields were achieved at
a rate of 0.25 °CÆmin
)1
(Fig. 3B). A cooling rate of
0.25 °CÆmin
)1
was therefore preferred for subsequent
experiments with GT TFOs.
Padlock formation with TC oligonucleotides
The use of TC TFOs has not been previously described
for the formation of topologically linked complexes
where a TFO encircles its double-stranded DNA tar-
get. Our previous attempts came up with the fact that
formation of the triple helix requires a pH that is too
low to enable efficient ligation by T4 DNA ligase. To
circumvent this problem we decided to perform the
incubation step at acidic pH, and then to neutralize
the sample before addition of T4 DNA ligase. An aci-
dic pH should favour triplex formation without affect-
ing the stability of the stem. After cooling the sample,
the stem–loop structure should remain stable upon
increasing the pH. Therefore, addition of the ligase

should result in the formation of the topological link
even if the triple helical structure has become unstable.
Such a protocol, carried out by forming the triple helix
at pH 5 and neutralizing to pH 7.5, led indeed to the
efficient formation of a topologically linked complex
using various TC TFO (Fig. 3). The influence of stem
length and heating conditions were also investigated in
this case. The greatest yields were obtained for a stem
length of 8 bp (Fig. 3A, lanes 5–7). The yield of com-
plex formation was lower when the samples were hea-
ted to a maximal temperature lower than 80 °C (data
not shown) or when the samples were not heated
(Fig. 3B, lane 8).
We tried to vary the cooling rate between 80 °C and
30 °C. The best yields were achieved at a rate of
Table 1. TFOs used in this study. The name and sequence of the TFOs are indicated. The TC TFO (TC4, TC6, TC8 and TC10) have a central
sequence made of T and C. The TG TFO (TG6, TG8, TG10 and TG11) have a central sequence made of T and G. The central sequences that
recognize the target sequence by triple-helix formation are represented in bold. On both sides, the sequences that hybridize to each other in
order to form a double-helical stem are underlined whereas the single-stranded sticky ends are shown in italics.
TFO Sequence
TC4
CGGTCCTATTTCGACGCTAGCTTTTTTTTCTCTTTCCTCCTTTTCTTTTCACGTGGAGCTTCTAGG
TC6
CGGTCCTAGTTCGACGCTAGCTTTTTTTTCTCTTTCCTCCTTTTCTTTTCACGTGGAGCTACTAGG
TC8
CGGTCCTAGTACTCGACGCTAGCTTTTTTTTCTCTTTCCTCCTTTTCTTTTCACGTGGAGCTGTACTAGG
TC10
CGGTCCTAGTACGCTCGACGCTAGCAAAATTTTCTCTTTCCTCCTTTTCAAAACACGTGGAGCTGCGTACTAGG
TG6
CGGTCCTAGTTCGACGCTAGCAAAAGTTTTGGTGGTTTGTGTTTTAAAACACGTGGAGCTACTAGG

TG8
CGGTCCTAGTACTCGACGCTAGCAAAAGTTTTGGTGGTTTGTGTTTTAAAACACGTGGAGCTGTACTAGG
TG10
CGGTCCTAGTACGCTCGACGCTAGCAAAAGTTTTGGTGGTTTGTGTTTTAAAACACGTGGAGCTGCGTACTAGG
TG11
CGGTCCTAGCTACGCTCGACGCTAGCAAAAGTTTTGGTGGTTTGTGTTTTAAAACACGTGGAGCTGCGTAGCTAGG
B. Ge
´
ron-Landre et al. Stem–loop padlock oligonucleotides for dsDNA
FEBS Journal 272 (2005) 5343–5352 ª 2005 FEBS 5345
0.25 °CÆmin
)1
(Fig. 3B), as observed for the GT oligo-
nucleotides. However, we noticed that a long heating
in the acidic buffer resulted in plasmid nicking. There-
fore, a cooling rate of 1 °CÆmin
)1
was prefered for
subsequent experiments with TC TFOs in order to
preserve the supercoiled conformation of the target
plasmid.
Specificity of padlock formation
Triple-helix formation is a sequence specific process
and it has been reported that the presence of mis-
matches between the third strand and the target
duplex decreases the stability of triple helical
complexes [15,16]. We wondered whether the use of
stem–loop TFOs would affect the specificity of com-
plex formation. We therefore constructed two other
plasmids (pY1m and pY2m) containing the 20-bp

oligopurineÆoligopyrimidine target sequence where 1
or 2 mismatches have been introduced (Fig. 2). For-
mation of the topological complex was carried out
in the presence of equimolar amounts of the two dif-
ferent plasmids (i.e. pY and pY1m or pY and
pY2m) in order to study the specificity of complex
formation. Labelling of the pY2m plasmid was never
observed (data not shown). Labelling of pY1m was
observed with a much lower yield than for pY
(Fig. 4). The labelling ratio between the two plas-
mids was used to estimate the specificity. This ratio
increased from 5 to 8 when the stem length of a TC
TFO increased from 6 to 10 bp and from 9 to 14
when the stem length of a TG TFO increased from
6 to 11 bp (Fig. 4).
Sensitivity of detection with a radiolabelled
padlock
Radioactive labelling is commonly used for sensitive
detection of DNA. Enzymatic synthesis of a DNA
fragment in the presence of a radiolabelled nucleotide
results in the incorporation of more isotopic labels at
the target site than direct phosphorylation of a TFO.
Therefore, we investigated the sensitivity of a DNA
detection assay based on ligation of a radiolabelled
DNA fragment to a TFO. [
32
P]dCTP[aP] was incor-
porated into a 0.5 kb DNA fragment during PCR.
Fig. 4. Specificity of padlock formation. Padlocks were formed in a
mix containing 100 ng (5 n

M) of pY (3.0 kb) and 170 ng (5 nM)of
pY1m (4.4 kb). Controls were performed with pY alone (lanes 1
and 7) or pY1m alone (lanes 2 and 8). Padlocks were formed with
radiolabelled GT TFOs (lanes 1–6) or TC TFOs (lanes 7–11) and the
short hairpin oligonucleotide. These TFOs differ in the length of the
double-stranded stem, as indicated by the number in their names.
The relative rate of padlock formation for the perfectly matched
and mismatched sequences is shown below the gels.
A
B
Fig. 3. Yields of padlock formation. (A) Influence of triple-helix motif
and stem length. (B) Influence of the cooling rate. Padlocks were
formed on the pY plasmid using radiolabelled GT TFOs (lanes 1–4)
or TC TFOs (lanes 5–7) and the hairpin oligonucleotide. The TFOs
differ in the length of the double-stranded stem, as indicated by
the number in their names. During padlock formation, the samples
were heated to 80 °C and cooled to 30 °C at various rates, as indi-
cated. A minus sign (–) indicates that the samples were not heated
at all (lanes 4 and 8). After the ligation reaction, complexes were
analysed on an agarose gel, which was dried and autoradiographed.
The intensities of both bands were quantified and summed. The
yield of padlock formation is shown below the gels, relatively to
the best yield for each experiment.
Stem–loop padlock oligonucleotides for dsDNA B. Ge
´
ron-Landre et al.
5346 FEBS Journal 272 (2005) 5343–5352 ª 2005 FEBS
The pY plasmid was incubated in the presence of the
nonlabelled 5¢-phosphorylated TFO (20 nm) and the
radiolabelled fragment (30 nm), and the sample was

heated before addition of T4 DNA ligase. After migra-
tion of the samples in a 1% agarose gel, comigration
of the labelled fragment and the plasmid was observed.
We were able to detect 250 attomol of plasmid without
ambiguity, and a band could be identified with as few
as 50 attomol (Fig. 5).
Padlock stability
The stability of the triple helical complex relies on
the presence of the triplex stabilizing agent BQQ or
on acidic pH. Therefore, stability may become a lim-
iting factor when further experiments are conducted
in the absence of BQQ or at neutral pH. On the
other hand, the topological link provides enhanced
stability to the complex. In order to study the
mobility of the topologically linked circular TFOs,
the pY plasmid was first linearized using different
restriction endonucleases before padlock formation.
The restriction sites were located at three different
positions located between 74 and 1040 bp away from
the target site (Fig. 6). The linearized DNA mole-
cules were still labelled after migration in a 1%
agarose gel (Fig. 6, lanes 2–4 and 6–8), indicating
that the topologically linked complexes are stable
enough not to dissociate during gel electrophoresis.
The migration rate of the modified linear plasmids
was observed to vary with different restriction
enzymes, which suggests that the migration rate
depends on the position of the label on the linear
molecule. The slowest migrations were obtained when
the attachment site was located close to the middle

of the linear DNA. The sharpness of the different
bands and the different migration rates suggest that
the short DNA fragment remains tightly associated
with its target sequence during electrophoresis.
Discussion
The aim of this work was to investigate the formation
of topological complexes where a stem–loop oligo-
nucleotide encircles a double-stranded DNA molecule.
Formation of these structures uses triple-helix forma-
tion to wind an oligonucleotide around a double-stran-
ded DNA target. The TFO is then ligated to a short
hairpin oligonucleotide or to a longer double-stranded
DNA, which results in a topological link between the
TFO and the target duplex. The influence of various
parameters such as TFO stem length and heating tem-
perature have been studied, as well as the sensitivity
and specificity of this approach. Heating the samples is
necessary for efficient complex formation. Stem length
and heating conditions have a great influence on the
labelling yield for both GT and TC TFOs. An optimal
Fig. 5. Plasmid detection with a radiolabelled DNA fragment. A radio-
labelled DNA fragment was ligated to a TFO (TG8) in the presence of
different amounts of the pY plasmid. The quantity of plasmid is indi-
cated, as well as the signal to noise ratio (S ⁄ N).
Fig. 6. Padlock stability on linear DNA. Plasmid pY was digested
with the restriction enzymes XmnI, DraIII, or XbaI, which cut at
1040, 498, and 74 bp, respectively, from the triplex target site. Pad-
locks were formed on the undigested plasmid (lanes 1 and 5) or on
the linearized plasmids (lanes 2–4 and 6–8) with the TFO TG8
(lanes 1–4) or TC8 (lanes 5–8) and a radiolabelled DNA fragment.

The small band in lane 6 which migrates like the main band in lane
8 may be due to some radiolabelled fragment ligated at the end of
the linearized plasmid.
B. Ge
´
ron-Landre et al. Stem–loop padlock oligonucleotides for dsDNA
FEBS Journal 272 (2005) 5343–5352 ª 2005 FEBS 5347
labelling yield is obtained when the samples are heated
up to 80 °C before the temperature is slowly decreased,
and for intermediate stem length values.
For the first time, we demonstrate that topologically
linked complexes can be assembled on supercoiled
plasmids using TC TFOs, which bind double-stranded
DNA at acidic pH, in place of GT TFOs that bind in
the presence of triplex stabilizing agents. This was
possible by performing the hybridization and ligation
steps at different pHs. This allows the process to be
conducted in the absence of any DNA intercalating
agents. A topologically linked complex involving a TC
oligonucleotide had been previously described [17]. In
this study, a precircularized TFO was threaded on a
short double-stranded DNA before this short double-
stranded DNA was ligated into a longer circular, non-
supercoiled molecule. This strategy cannot be used for
labelling circular DNA.
In our approach, TFOs do not have to thread on
the target DNA. They are probably not able to thread
on long DNA anyway, as shown by experiments with
phage k DNA [13]. A heating step is necessary to open
the stem–loop structure, which can reassociate after

triple-helix formation (Fig. 7). We have previously sug-
gested that in the absence of heating, the TFO
becomes ligated while it is not wound around the dou-
ble-stranded DNA target. Whether this circular TFO
can still form a triple helical structure after ligation
remains an unresolved question, as the formation of
triple helices by linear TFOs could not be detected by
gel electrophoresis under our experimental conditions.
But the length of the linkers between the region that
forms a triple helix and the stem (14 nucleotides on
both sides) is probably too short to permit binding of
the ligated TFO to more than 10 base pairs of the target
(i.e. one turn around the double helix). In contrast, the
topological link provides an enhanced stability, which
results in a band shift that can be clearly detected.
The proposed model can be further exploited in
order to explain the results observed in the present
study (Fig. 7). For long stem lengths, the stem can
dissociate only at very high temperatures and is likely
to reassociate at a temperature higher than the one at
which triplex formation occurs. The ligation reaction
will result in a complex that does not encircle the tar-
get DNA. The decreased efficiency observed with very
short stem lengths requires a different explanation.
The short double-helical structure has a low stability.
Therefore, hybridization of the short single-stranded
ends may be inhibited by the tension exerted on them
by the triple helical structure. We observed indeed that
ligation was inhibited in the presence of an excess of
plasmid (not shown). This hybridization may occur

when the TFO dissociates from its target, resulting in
a complex that does not encircle the double helix tar-
get after ligation. Therefore, the ligation reaction
drives the complex towards circularization outside of
the double-stranded target. The effects of the heating
conditions on labelling efficiency can probably also be
explained by this model, taking into account the relat-
ive kinetics of both triplex and stem–loop formation.
A high cooling rate may not be compatible with effi-
cient triple-helix formation due to slow association
kinetics [18]. Therefore the TFO stem might reassoci-
ate while the triple-helix has not formed, resulting in a
complex that does not encircle the target DNA.
We have shown that a longer stem provides an
enhanced specificity to the labelling reaction. This
observation can be explained by noticing that the pres-
ence of mismatches will decrease the melting tempera-
ture of the triple-helical complex, which may become
lower than the melting temperature of the stem. Other
Fig. 7. Scheme for interpretation of the results. The target, the
stem–loop TFO and the short hairpin oligonucleotide are represen-
ted. The padlock structure (centre) forms upon dissociation of the
stem (1) followed by triple-helix formation (2), stem reformation (3)
and ligation of the hairpin oligonucleotide (4). When the stem is lon-
ger, ligation of the TFO may occur outside of the target before tri-
ple-helix formation (right). When the stem is too short (left), the
formation of a triple helical complex may inhibit stem reassociation.
The reassociation and ligation may happen while the triple-helix is
dissociated.
Stem–loop padlock oligonucleotides for dsDNA B. Ge

´
ron-Landre et al.
5348 FEBS Journal 272 (2005) 5343–5352 ª 2005 FEBS
strategies have been described for designing DNA
probes with an enhanced specificity. For example,
molecular beacons are stem–loop oligonucleotides
which are used in a specific single-stranded DNA
detection assay based on fluorescence quenching
[19,20]. Competition between formation of the stem–
loop structure and hybridization to the target results
in an increased specificity. The stem–loop oligonucleo-
tides presented in this paper differ from molecular bea-
cons as the stem–loop structure and the triple-helical
complex exist simultaneously, in contrast to molecular
beacons. Formation of the stem–loop structure reinfor-
ces the strength and specificity of the triple-helical
structure.
Several oligopurineÆoligopyrimidine sequences have
been used as targets for attaching stem–loop padlock
oligonucleotides ([12,13], B. Ge
´
ron-Landre, T. Roulon,
M. Bello-Roufaı
¨
& C. Escude
´
, unpublished results).
Their length varies from 12 to 20 base pairs. We present
here the first systematic study of stem length for a 20-bp
target sequence and two derivatives with one or two mis-

matches. The yields have been shown to depend on the
length of the stem. More generally, they are likely to
depend on the stability of both the stem and the triple
helix, i.e. on their length and base pair composition.
Formation of the catenated complex is sequence specific.
This feature makes our approach an interesting one for
labelling genomic targets. Experiments with phage k
DNA have confirmed this trend [13], and the present
results will help in the design of experiments aimed
at targeting a single sequence within the yeast Saccharo-
myces cerevisiae genome. OligopurineÆoligopyrimidine
sequences are over-represented in eukaryotic genomes
[21], and strategies have been described which allow
recognition of sequences containing single- or double-
inversions as well as alternating oligopurineÆ.oligopyrim-
idine sequences [22], which reinforce the interest of our
labelling approach.
We have also demonstrated that ligation of a radio-
labelled DNA fragment to a stem–loop TFO can be
used for sensitive sequence-specific detection of DNA.
Other approaches have been proposed for this task,
for example the use of strand-invading peptide nucleic
acids oligonucleotides that facilitate binding of an
oligonucleotide to a single-stranded target [23]. In this
study, quantification of the target was achieved by
extension of the hybridized oligonucleotide, which acts
as a primer. In our approach, the label is present on
the DNA fragment, and this reaction is independent
from the target sequence.
Padlock oligonucleotides for double-stranded DNA

offer an interesting alternative to irreversible triplexes
such as those obtained for example by irradiation of
psoralen–TFO conjugates [6]. It is also possible to cir-
cularize an oligonucleotide around a locally denatured
DNA target. This can be achieved using peptide
nucleic acids openers, forming a so-called earring com-
plex that can be used for DNA labelling or isolation
of specific sequences from genomic DNA [24]. In such
complexes, it was believed that the fact that the circle
was threaded between both DNA strands was required
in order to inhibit sliding of the circular oligonucleo-
tide. The present report shows that the circular TFO
did not slide during gel electrophoresis even under con-
ditions that were not favourable to triplex stability,
such as the absence of the triplex stabilizing agent, or
a pH that does not favour triple-helix formation. Pre-
vious experiments, in which triplex formation competed
with cleavage by a restriction enzyme, had shown that
a circular TFO could remain tightly locked on its target
sequence or leave the restriction site accessible, depend-
ing on the presence of a triplex stabilizing agent [10].
Therefore, conditions that promote local mobility of
the circular TFO are not sufficient to make it slide
freely along the target DNA, and some forces must be
exerted on the padlock oligonucleotide in order to
make it move. Such forces may be provided by the
movements of enzymes that translocate on DNA [25]
or by processive enzymes like RNA polymerases [11].
In this regard, our system may provide an interesting
tool for the study of protein movements on DNA.

Sequence-specific DNA binding agents have several
applications. For example, they can be used for grafting
chemical moieties to plasmids, such as targeting peptides
or fluorophores, in order to target plasmids towards spe-
cific subcellular compartments [12] or to study their
intracellular localization [26], respectively. This so-called
‘DNA vector chemistry’ is especially useful in gene ther-
apy. Fluorescent detection of short oligopurineÆoligo-
pyrimidine sequences on large genomic DNA molecules
that have been stretched by microfluidic devices opens
the way to new types of genomic studies [27]. The for-
mation of catenated complexes has also been used for
detection of single-stranded nucleic acid sequences by
fluorescent in situ hybridization [28]. Interestingly, the
topological link allows washing under stringent condi-
tions. Similar detection technologies may be carried out
with probes that recognize specific sequences on native
DNA.
In conclusion, we have studied the formation of topo-
logically linked complexes between an oligonucleotide
and a double-stranded DNA target. This versatile label-
ling strategy uses two independent moieties: the first one
is an oligonucleotide that recognizes a double-stranded
DNA in a sequence specific way, the second one may
be an oligonucleotide or a DNA fragment. The DNA
B. Ge
´
ron-Landre et al. Stem–loop padlock oligonucleotides for dsDNA
FEBS Journal 272 (2005) 5343–5352 ª 2005 FEBS 5349
fragment may be used for incorporation of multiple

labels in order to enhance detection sensitivity. The
stem–loop structure of the oligonucleotide displays
unique and undescribed characteristics in terms of
probe–target interactions which represent a new
approach for enhancing the specificity of nucleic acid
hybridization.
Experimental procedures
Oligonucleotides and chemicals
Sequences of the TFOs are given in Table 1. The sequence of
the short hairpin oligonucleotide was 5¢-ACCGTCCGG
ATTGGCTTTTGCCAATCCGGA-3¢. This oligonucleotide
was 5¢-phosphorylated during synthesis. The sequence of the
primers used for PCR were 5¢-CGGTATCAGCTCACTC
AAAG-3¢ (fw), and 5¢-ATGCTGGTCTCTACCGGCGAT
AAGTCGTGTCTTAC-3¢ (rv). The rv primer was biotinyl-
ated at the 5¢ end during synthesis. All these oligonucleotides
were obtained from Eurogentec (Seraing, Belgium); their
concentration was calculated using a nearest-neighbour
model for absorption coefficients.
TFOs were radiolabelled by incubating 10 pmol TFO in
20 lL T4 polynucleotide kinase buffer (New England Bio-
labs, Beverly, MA, USA) with 10 lCi [
32
P]ATP[cP] (Amer-
sham, > 5000 CiÆmmol
)1
) and 5 U T4 polynucleotide kinase
(New England Biolabs) for 1 h at 37 °C. Unincorporated
[
32

P]ATP[cP] was removed using Micro Bio-Spin columns
(Bio-Rad, Hercules, CA, USA). For use with radiolabelled
DNA fragments, TFOs were 5¢-phosphorylated by incuba-
ting 300 pmol TFO in 50 lL T4 DNA ligase buffer (New
England Biolabs) with 10 U T4 polynucleotide kinase for
2 h at 37 °C.
Synthesis of the triplex stabilizing agent BQQ has been
described previously [29].
Plasmids
Plasmids pY, pY1m and pY2m were constructed by cloning
the appropriate oligonucleotide pair between the HindIII and
StyI sites of pBluescript SK+ (3.0 kb, Stratagene, La Jolla,
CA, USA), between the HindIII and EcoRI sites of pBR322
(4.4 kb, New England Biolabs) and between the HindIII and
EcoRI sites of pGL2 control (6.0 kb, Promega, Madison,
WI, USA), respectively. The sequence of the target sequence
inserted in these plasmids is indicated in Fig. 2.
For experiments regarding the mobility of padlock oligo-
nucleotides, 1 l g pY was linearized with 20 U of either
XmnI (New England Biolabs), DraIII (New England Bio-
labs) or XbaI (Amersham, Bucks, UK) in the recommended
buffers for 3 h at 37 °C. In order to avoid recircularization
or multimer formation, the digested plasmid was dephos-
phorylated by adding shrimp alcaline phosphatase (USB,
Cleveland, OH, USA) (1 U for XmnI, 12 U for DraIII,
2.5 U for XbaI) and incubating for 2 h at 37 °C. Phospha-
tase was inactivated for 20 min at 65 °C. DNA was then
ethanol precipitated and resuspended in Tris 10 mm pH 8.0.
Preparation of radiolabelled DNA fragments
PCR primers were designed in order to produce a fragment

of a 0.5 kb starting from the pBluescript SK+ plasmid
(Stratagene). The sequence of the fw primer was chosen in
order to introduce a cleavage site for the BsaI restriction
enzyme. The PCR was carried out by mixing in 50 lL Taq
buffer (Promega) supplemented with 2 mm MgCl
2
1.6 lm
of each primer, 200 lm of each dNTP, 50 lCi
[
32
P]dCTP[aP] (10 lCiÆ lL
)1
, 3000 CiÆmmol
)1
) (Amersham),
10 pgÆlL
)1
pBluescript and 0.1 UÆlL
)1
Taq DNA poly-
merase (Promega). After 30 cycles of 30 s at 94 °C, 30 s at
61 °C and 1 min at 72 °C, the concluding extension was
carried out for 10 min at 72 °C. Primers and unincorporat-
ed dNTP were removed using Qiagen (Valencia, CA, USA)
PCR purification kits, using the standard protocol. Then
the PCR products were digested overnight at 50 °C with
50 U of BsaI (New England Biolabs). The biotinylated
extremities and the nondigested biotinylated PCR products
were removed using streptavidin-coated magnetic beads
(Dynabeads, Dynal, Oslo, Norway). The labelled fragments

were then ethanol precipitated, resuspended in 10 mm
Tris ⁄ HCl pH 8.0 and quantified on a gel by comparison
with a standard.
Padlock formation
Unless otherwise stated, padlocks made of a TG TFO
were formed with 20 nm of the TFO and either 30 nm of
the hairpin oligonucleotide or the 0.5-kb DNA fragment
incubated with 100 ng plasmid and 20 lm triplex stabil-
izing ligand BQQ in 10 lL T4 DNA ligase buffer
(50 mm Tris ⁄ HCl, 10 mm MgCl
2
,10mm dithiothreitol,
1mm ATP, 25 lgÆmL
)1
BSA, pH 7.8 at 25 °C). The
sample was heated to 80 °C and cooled to 30 °Cata
rate of 0.25 °CÆmin
)1
in an MJResearch thermocycler.
Forty units of T4 DNA ligase (New England Biolabs)
were then added and the sample was incubated overnight
at 20 °C. Padlocks made of a TC TFO were formed with
20 nm TFO and 30 nm of the hairpin oligonucleotide or
the 0.5-kb DNA fragment incubated with 100 ng plasmid
in 10 lL acetate buffer (20 mm ammonium acetate,
20 mm MgCl
2
,3mm dithiothreitol and 1 mm ATP,
pH 5.0 at 25 °C). The sample was heated to 80 °C and
cooled down to 30 °C at a rate of 1 °CÆmin

)1
in a
MJResearch thermocycler. It was then cooled on ice and
2 lL of an ice-cold neutralizing solution (150 mm Tris
pH 8.0, T4 DNA ligase 100 U ÆlL
)1
) were added. The
sample was incubated overnight at 16 °C.
Stem–loop padlock oligonucleotides for dsDNA B. Ge
´
ron-Landre et al.
5350 FEBS Journal 272 (2005) 5343–5352 ª 2005 FEBS
Padlock formation was assessed by electrophoresis on a
1% agarose gel in 0.5· TBE buffer at room temperature.
The gels were then dried, autoradiographed using a Typhoon
apparatus (Amersham) and analysed with the imagequant
software (Molecular Dynamics, Sunnyvale, CA, USA).
Acknowledgement
BGL was supported by a grant from Ministe
`
re de la
Recherche.
References
1 Giovannange
´
liC&He
´
le
`
ne C (2000) Triplex-forming

molecules for modulation of DNA information proces-
sing. Curr Opin Mol Ther 2, 288–296.
2 Potaman VN (2003) Applications of triple-stranded
nucleic acid structures to DNA purification, detection
and analysis. Expert Rev Mol Diagn 3, 481–496.
3 Fox KR (2000) Targeting DNA with triplexes. Curr
Med Chem 7, 17–37.
4 Buchini S & Leumann CJ (2004) Stable and selective
recognition of three base pairs in the parallel triple-
helical DNA binding motif. Angew Chem Int Ed Engl
43, 3925–3928.
5 Rusling DA, Powers VE, Ranasinghe RT, Wang Y,
Osborne SD, Brown T & Fox KR (2005) Four base
recognition by triplex-forming oligonucleotides at
physiological pH. Nucl Acids Res 33, 3025–3032.
6 Takasugi M, Guendouz A, Chassignol M, Decout JL,
Lhomme J, Thuong NT & He
´
le
`
ne C (1991) Sequence-
specific photo-induced cross-linking of the two strands
of double-helical DNA by a psoralen covalently linked
to a triple helix-forming oligonucleotide. Proc Natl Acad
Sci USA 88, 5602–5606.
7 Pfannschmidt C, Schaper A, Heim G, Jovin TM &
Langowski J (1996) Sequence-specific labeling of super-
helical DNA by triple helix formation and psoralen
crosslinking. Nucleic Acids Res 24, 1702–1709.
8 Lampe JN, Kutyavin IV, Rhinehart R, Reed MW,

Meyer RB & Gamper HBJ (1997) Factors influencing
the extent and selectivity of alkylation within triplexes
by reactive G ⁄ A motif oligonucleotides. Nucleic Acids
Res 25, 4123–4131.
9 Escude
´
C, Garestier T & He
´
le
`
ne C (1999) Padlock
oligonucleotides for duplex DNA based on sequence-
specific triple helix formation. Proc Natl Acad Sci USA
96, 10603–10607.
10 Roulon T, He
´
le
`
ne C & Escude
´
C (2001) A ligand-modu-
lated padlock oligonucleotide for supercoiled plasmids.
Angew Chem Int Ed Engl 40, 1523–1526.
11 Bello-Roufai M, Roulon T & Escude
´
C (2004) Ligand-
mediated transcription elongation control using triplex-
based padlock oligonucleotides. Chem Biol 11, 509–516.
12 Roulon T, He
´

le
`
ne C & Escude
´
C (2002) Coupling of a
targeting peptide to plasmid DNA using a new type of
padlock oligonucleotide. Bioconjug Chem 13 , 1134–1139.
13 Ge
´
ron-Landre B, Roulon T, Desbiolles P & Escude
´
C
(2003) Sequence-specific fluorescent labeling of double-
stranded DNA observed at the single molecule level.
Nucleic Acids Res 31, e125.
14 Roulon T, Coulaud D, Delain E, Le Cam E, He
´
le
`
ne C &
Escude
´
C (2002) Padlock oligonucleotides as a tool for
labeling superhelical DNA. Nucleic Acids Res 30, e12.
15 Greenberg WA & Dervan PB (1995) Energetics of
formation of sixteen triple helical complexes which vary
at a single position within a purine motif. J Am Chem
Soc 117, 5016–5022.
16 Mergny JL, Sun JS, Rouge
´

e M, Montenay-Garestier T,
Barcelo F, Chomilier J & He
´
le
`
ne C (1991) Sequence
specificity in triple-helix formation: experimental and
theoretical studies of the effect of mismatches on triplex
stability. Biochemistry 30, 9791–9798.
17 Ryan K & Kool ET (1998) Triplex-directed self-assem-
bly of an artificial sliding clamp on duplex DNA. Chem
Biol 5, 59–67.
18 Rouge
´
e M, Faucon B, Mergny JL, Barcelo F, Giovann-
angeli C, Garestier T & He
´
le
`
ne C (1992) Kinetics and
thermodynamics of triple-helix formation: effects of ionic
strength and mismatches. Biochemistry 31, 9269–9278.
19 Tyagi S & Kramer FR (1996) Molecular beacons:
probes that fluoresce upon hybridization. Nat Biotechnol
14, 303–308.
20 Bonnet G, Tyagi S, Libchaber A & Kramer FR (1999)
Thermodynamic basis of the enhanced specificity of
structured DNA probes. Proc Natl Acad Sci USA 96,
6171–6176.
21 Goni JR, de la Cruz X & Orozco M (2004) Triplex-

forming oligonucleotide target sequences in the human
genome. Nucleic Acids Res 32, 354–360.
22 Sun JS (1999) New targets for triple helix forming oligo-
nucleotides. Triple Helix Forming Oligonucleotides
(Malvy C, Harrel-Bellan A & Pritchard LL, eds),
pp. 273–284. Kluwer Academic Publishing, Dordrecht,
the Netherlands.
23 Broude NE, Demidov VV, Kuhn H, Gorenstein J,
Pulyaeva H, Volkovitsky P, Drukier AK & Frank-
Kamenetskii MD (1999) PNA openers as a tool for
direct quantification of specific targets in duplex DNA.
J Biomol Struct Dyn 17, 237–244.
24 Bukanov NO, Demidov VV, Nielsen PE & Frank-
Kamenetskii MD (1998) PD-loop: a complex of duplex
DNA with an oligonucleotide. Proc Natl Acad Sci USA
95, 5516–5520.
25 McClelland SE, Dryden DT & Szczelkun MD (2005)
Continuous assays for DNA translocation using fluores-
cent triplex dissociation: application to type I restriction
endonucleases. J Mol Biol 348, 895–915.
B. Ge
´
ron-Landre et al. Stem–loop padlock oligonucleotides for dsDNA
FEBS Journal 272 (2005) 5343–5352 ª 2005 FEBS 5351
26 Zelphati O, Liang X, Hobart P & Felgner PL (1999) Gene
chemistry: functionally and conformationally intact fluor-
escent plasmid DNA. Hum Gene Ther 10, 15–24.
27 Chan EY, Goncalves NM, Haeusler RA, Hatch AJ,
Larson JW, Maletta AM, Yantz GR, Carstea ED,
Fuchs M, Wong GG, Gullans SR & Gilmanshin R

(2004) DNA mapping using microfluidic stretching and
single-molecule detection of fluorescent site-specific tags.
Genome Res 14, 1137–1146.
28 Nilsson M, Malmgren H, Samiotaki M, Kwiatkowski
M, Chowdhary BP & Landegren U (1994) Padlock
probes: circularizing oligonucleotides for localized DNA
detection. Science 265, 2085–2088.
29 Zain R, Marchand C, Sun J, Nguyen CH, Bisagni E,
Garestier T & He
´
le
`
ne C (1999) Design of a triple-helix-
specific cleaving reagent. Chem Biol 6, 771–777.
Stem–loop padlock oligonucleotides for dsDNA B. Ge
´
ron-Landre et al.
5352 FEBS Journal 272 (2005) 5343–5352 ª 2005 FEBS